Trichothecene chemotypes of Fusarium culmorum infecting wheat in Tunisia

International Journal of Food Microbiology 140 (2010) 84–89

Contents lists available at ScienceDirect

International Journal of Food Microbiology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i j f o o d m i c r o

Trichothecene chemotypes of Fusarium culmorum infecting wheat in Tunisia Lobna Gargouri Kammoun a,⁎, Samia Gargouri a, Christian Barreau b, Florence Richard-Forget b, Mohamed Rabeh Hajlaoui a a b

Laboratoire de Protection des végétaux, Institut National de la Recherche Agronomique de Tunis, rue Hédi Karray, 2049, Tunisia Unité de Mycologie et Sécurité des Aliments, Institut National de la Recherche Agronomique, 71 avenue Edouard Bourleaux, France

a r t i c l e

i n f o

Article history: Received 25 August 2009 Received in revised form 6 January 2010 Accepted 28 January 2010 Keywords: Wheat Mycotoxins Fusarium culmorum Deoxynivalenol Nivalenol Aggressiveness

a b s t r a c t Fusarium culmorum is a major pathogen associated with Fusarium head blight (FHB) of wheat in Tunisia. It may cause yield loss or produce mycotoxins in the grain. The objectives of the present study were threefold: to evaluate by PCR assays the type of mycotoxins produced by 100 F. culmorum isolates recovered from different regions in Northern Tunisia, to determine the amount of mycotoxin production by HPLC analysis, and to analyse for correlations between the amount of mycotoxin produced and the aggressiveness of isolates. PCR assays of Tri5, Tri7, Tri13, and Tri3 were used to predict whether these isolates could produce nivalenol, 3-acetyl-deoxynivalenol, or 15-acetyl-deoxynivalenol. Two of the isolates were predicted to produce NIV, whereas the others were predicted to produce 3-AcDON. Trichothecene production was confirmed and quantified by high pressure liquid chromatography (HPLC) in 28 isolates, after growth on wheat grains, and in a liquid Mycotoxin Synthetic medium (MS). All strains produced DON/3-AcDON at detectable levels ranging from 21 µg/g to 11.000 µg/g of dry biomass on MS medium and from 10 µg/g to 610 µg/g on wheat grain. The evaluation of the relationship between 3-AcDON production and aggressiveness of 17 strains revealed a significant difference in aggressiveness among the isolates. Moreover, only a significant correlation was revealed between aggressiveness and the amount of 3-AcDON produced on MS medium (r = 0.36). Chemotyping of F. culmorum isolates is reported for the first time for isolates from Tunisia, and highlights the important potential of F. culmorum to contaminate wheat with 3-AcDON trichothecenes. © 2010 Elsevier B.V. All rights reserved.

1. Introduction Fusarium head blight (FHB), is a major fungal disease affecting wheat (Triticum aestivum L.) worldwide. The disease is associated with several Fusarium spp. including F. graminearum Schwabe (teleomorph: Gibberella zeae (Schwein.) Petch), Fusarium culmorum (W.G. Smith) Sacc., F. poae (Peck) Wollenw., F. avenaceum (Fr.) Sacc., and Microdochium nivale (Fr.) Samuels & I.C. Hallett (Osborne and Stein, 2007). Globally, F. graminearum is the prevalent species, but in several European countries, F. culmorum is the main causative agent of FHB (Jennings et al., 2004; Bottalico and Perrone, 2002). FHB often is accompanied by contamination of the substrate with trichothecenes, a toxin family of considerable concern for human and animal health (Bennett and Klich, 2003). Type B trichothecenes are the principal mycotoxins produced in cereals by F. culmorum as well as other species of Fusarium (Desjardins, 2006). They include deoxynivalenol (DON) and its acetylated forms 3-acetyl-deoxynivalenol and 15-acetyldeoxynivalenol (3- and 15-AcDON), and nivalenol (NIV) and its acetylated form 4-acetylnivalenol or fusarenone X (FX). NIV is generally

⁎ Corresponding author. E-mail address: [email protected] (L.G. Kammoun). 0168-1605/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2010.01.040

regarded as more toxic to humans and animals than is DON (Ryu et al., 1988), although DON may be more phytotoxic than NIV (Eudes et al., 2000). The production of DON by F. culmorum may play a role in pathogenesis (Eudes et al., 2001). The usual methods for chemotyping Fusarium isolates are high performance liquid chromatography (HPLC) or gas chromatography/ mass spectroscopy (GS/MS) analysis of extracts from substrates such as wheat, maize or rice artificially inoculated with Fusarium (Sugiura et al., 1990; Miller et al., 1991; Muthomi et al., 2000). DNA based methods that rely on the amplification of the genes involved in the biosynthesis of trichothecenes also are available. Specific PCR primers have been developed to the Tri5 gene which encodes trichodiene synthase, an enzyme that catalyses the first step in the biosynthesis of trichothecenes. Two others genes, Tri7 and Tri13, also have been sequenced and found to be functional in NIV-producing isolates and nonfunctional in DON-producing isolates (Lee et al., 2001, 2002; Chandler et al., 2003). Positive–negative PCR assays based on these two genes have been developed to characterize the DON and NIV genotypes. Primers developed to the Tri3 gene have enabled the acetyl derivatives of DON (3- or 15-AcDON) to be determined (Chandler et al., 2003; Gale et al., 2007; Jennings et al., 2004; Quarta et al., 2005; Stepièn et al., 2008). The distribution of each chemotype/genotype varies by geographic region. Thus, strains of F. culmorum with DON and NIV chemotype/

L.G. Kammoun et al. / International Journal of Food Microbiology 140 (2010) 84–89

genotype are known from several countries, including UK (Jennings et al., 2004), Germany (Muthomi et al., 2000), the Netherlands and Norway (Langseth et al., 1999), Italy (Gang et al., 1998), France (Bakan et al., 2001) and USA (Mirocha et al., 1994), whereas only the DON chemotype was detected in western Canada (Abramson et al., 2001). Recent surveys conducted in Tunisia have shown that harvested grains are contaminated with DON and that F. culmorum was the dominant Fusarium species present (Kammoun et al., 2009; Bensassi et al., 2009). To our knowledge, there are no previous reports on the mycotoxins produced by Tunisian F. culmorum isolates. Since wheat represents the major staple food for the people of Tunisia, it is important to assess the mycotoxin production capability of Fusarium isolates and to determine the types and amounts of mycotoxins produced to evaluate the risk that might be posed by contaminated food or feed. Our objectives in this study were to determine the trichothecene genotypes of Tunisian isolates of F. culmorum, through PCR analysis of the Tri5, Tri7, Tri13 and Tri3 genes, to quantify mycotoxin production by HPLC analysis, and to determine if there is a correlation between the amount of mycotoxin produced and the aggressiveness of an isolate.

2. Materials and methods 2.1. Isolates One hundred single-spore isolates of F. culmorum, described in detail by Kammoun et al. (2009), were used. These isolates originated from different regions of Northern Tunisia (Table 1). All Fusarium isolates were identified based on conidial morphology according to Leslie and Summerell (2006) and then confirmed by polymerase chain reaction (PCR) with specific primers described by Schilling et al. (1996).

2.2. DNA extraction Isolates of F. culmorum were grown on potato dextrose agar medium (PDA) (Sigma Chemical Co., St. Louis, MO) plates for 5–6 days.

Table 1 Isolates of F. culmorum examined in this study. Isolates

Geographic origin

Cultivar of durum wheat

Fcu1, Fcu18, Fcu30, Fcu32, Fcu78. Fcu17, Fcu31. Fcu 25, Fcu70. Fcu 9, Fcu38, Fcu39, Fcu44, Fcu47, Fcu43. Fcu 3, Fcu35, Fcu37, Fcu40, Fcu42, Fcu46. Fcu 5, Fcu8, Fcu2, Fcu34, Fcu36, Fcu41. Fcu 14, Fcu24, Fcu49, Fcu53, Fcu55, Fcu59, Fcu61, Fcu67, Fcu68. Fcu 16, Fcu51, Fcu52, Fcu 56, Fcu58, Fcu60, Fcu64, Fcu66, Fcu88 Fcu 48, Fcu50, Fcu54, Fcu57, Fcu62, Fcu63, Fc65, Fcu69 Fcu 4, Fcu15, Fcu45, Fcu94, Fcu95, Fcu97. Fcu 6, Fcu11, Fcu19, Fcu29, Fcu96, Fcu98. Fcu 7, Fcu13, Fcu20, Fcu23, Fcu33, Fcu93. Fcu 10, Fcu71, Fcu73, Fcu75, Fcu79, Fcu81, Fcu86, Fcu87. Fcu 12, Fcu26, Fcu74, Fcu83, Fcu85. Fcu 22, Fcu28, Fcu72, Fcu76, Fcu77, Fcu80, Fcu82, Fcu84. Fcu 21, Fcu90, Fcu100 Fcu 27, Fcu89, Fcu99 Fcu 91, Fcu92.

Cap Bon Cap Bon Cap Bon Tunis Tunis Tunis Jendouba

Karim Khiar Razzek Karim Khiar Razzek Karim

Jendouba

Khiar

Jendouba

Razzek

Mateur Mateur Mateur Beja

Karim Khiar Razzek Karim

Beja Beja

Khiar Razzek

Bizerte Bizerte Bizerte

Karim Khiar Razzek

85

The mycelia were freeze-dried and ground to a fine powder. DNA was extracted by using a method adapted from Möller et al. (1992). 2.3. Fusarium culmorum species-specific PCR DNA of 100 isolates identified as F. culmorum was amplified with PCR using species-specific primers OPT18F/OPT18R (Schilling et al., 1996). The amplification conditions were: approximately 20 ng of fungal DNA, 1 mM of each dNTP, 1.5 mM MgCl2, 1 unit of GoTaq® DNA polymerase (Promega, USA), 1X PCR polymerase reaction buffer, and 0.25 μM of each forward and reverse primer. DNA amplification was performed in a Thermal Cycler (Biometra, T-1, Göttingen, Germany) as described by Schilling et al. (1996). Amplification products were separated by electrophoresis in 1.5% agarose gels in TBE buffer (0.9 M Tris, 0.9 M boric acid, 2 mM EDTA, pH 8.0). Gels were stained with ethidium bromide (10 mg/μl) and photographed under UV light. 2.4. PCR analysis of trichothecenes genes PCR assays with primer pair Tox5-1/Tox5-2 (Table 2) developed for the gene Tri5 were used to determine the potential ability of F. culmorum isolates to produce trichothecenes (Niessen and Vogel, 1998). The PCR mixture was as described above and the PCR reactions were: 4 min at 96 °C; 5 cycles of 1 min at 96 °C, 2 min at 68 °C, and 3 min at 75 °C; 30 cycles of 30 s at 96 °C, 30 s at 68 °C, and 1 min at 75 °C followed by a final 10 min incubation at 72 °C. Primers pairs Tri13NIVF/Tri13R and Tri7F/Tri7NIV were used to identify NIV-producing isolates, and primer pairs Tri13F/Tri13DONR and MinusTri7F/MinusTri7R were used to identify DON-producing isolates (Chandler et al., 2003; Table 2). The cycling protocol for Tri7F/ Tri7NIV was 2 min at 94 °C followed by 35 cycles of 30 s at 94 °C, 30 s at 60 °C, and 30 s at 72 °C followed by a final extension of 5 min at 72 °C. The annealing temperature was 58 °C for the other three primers and the extension time was 45 s for Tri13NIVF/Tri13R and Tri13F/Tri13DONR and 30 s for MinusTri7F/MinusTri7R. Two primer sets Tri3F971/Tri3R1679 and Tri3F1325/Tri3R1679, were used to distinguish the 15-AcDON and 3-AcDON genotypes (Table 2) (Quarta et al., 2005). The PCR program used was: 94 °C for 3 min (1 cycle only), then 35 cycles of 94 °C for 30 s, 53 °C for 30 s, and 72 °C for 1 min, followed by a final extension step of 72 °C for 10 min. Negative controls (no DNA template) were included in each set of experiments to test for the presence of DNA contamination in reagents and reaction mixtures. Amplification products were analysed as described above. 2.5. HPLC analysis Twenty-eight isolates of F. culmorum were selected arbitrarily from the collection used for this study. Each isolate was cultured on

Table 2 Primer sequences used in this study and their references. Primer

Sequence (5′–3′)

References

Tox5-1 Tox5-2 Tri13NIVF Tri13R Tri7F Tri7NIV Tri13F Tri13DONR MinusTri7F MinusTri7R Tri3F971 Tri3R1679 Tri3F1325

GCTGCTCATCACTTTGCTCAG CTGATCTGGTCACGCTCATC CCAAATCCGAAAACCGCAG TTGAAAGCTCCAATGTCGTG TGCGTGGCAATATCTTCTTCTA GGTTCAAGTAACGTTCGACAATAG CATCATGAGACTTGTKCRAGTTTGGG GCTAGATCGATTGTTGCATTGAG TGGATGAATGACTTGAGTTGACA AAAGCCTTCATTCACAGCC CATCATACTCGCTCTGCTG TT(AG)TAGTTTGCATCATT(AG)TAG GCATTGGCTAACACATGA

Niessen and Vogel (1998) Niessen and Vogel (1998) Chandler et al. (2003) Chandler et al. (2003) Chandler et al. (2003) Chandler et al. (2003) Chandler et al. (2003) Chandler et al. (2003) Chandler et al. (2003) Chandler et al. (2003) Quarta et al. (2005) Quarta et al. (2005) Quarta et al. (2005)

86

L.G. Kammoun et al. / International Journal of Food Microbiology 140 (2010) 84–89

PDA slants at 25 °C for spore production. After 7 days, macroconidia were harvested by adding 6 ml of sterile distilled water to the slants with gentle shaking. Trichothecenes produced by these isolates were analysed and quantified. Experiments were performed after incubation in two media: wheat grain and liquid culture (Mycotoxin Synthetic medium (MS)). 2.5.1. Cultures on wheat grains Toxin production by Fusarium strains was assessed on autoclaved wheat grains variety Oratorio. Before inoculation, wheat was moistened with sterile distilled water to a water activity (aw; 0.98) and kept overnight in a controlled atmosphere with suitable equilibrium relative humidity. Fifty g of wheat grain was placed in a 500 ml Erlenmeyer flask, and autoclaved twice for 25 min at 110 °C as described by Bakan et al. (2002). Each flask was inoculated with 0.5 ml of an aqueous suspension containing approximately 104 conidia/ml harvested from 7 day-old cultures grown on PDA. Three flasks were inoculated for each strain. Flasks were incubated without shaking at 25 °C for 21 days in the dark. Culture material was dried in a forced-air oven at 75 °C for 48 h. At the end of incubation, cultures were homogenized and ground into a fine powder (particles size were about 100 µm). Controls were treated in the same way except that they were not inoculated. Wheat used as the substrate was previously analysed and found to contain undetectable levels of DON, NIV, 15-AcDON, 3-AcDON and FX. The detection limits were 1 µg/kg. For analysis, a 25 g portion of the each ground sample was extracted with 100 ml of acetonitrile:water (84:16, v/v), in a 250 ml Erlenmeyer flask placed in a Multitron incubator shaker (INFORS AG, Bottmingen, Switzerland) for 1 h as described by Bily et al. (2004). After filtering through a filter paper disc (No.4 Whatman International Ltd, Maidstone, UK), an aliquot of 5 ml was subjected to clean-up through a Mycosep column. A volume of 3 ml of the purified extract was evaporated to dryness at 70 °C under nitrogen, and then resuspended in 200 μl of methanol:water (1:1, v/v). Trichothecenes were separated by high performance liquid chromatography (HPLC) (Hewlett Packard LC 1100, Agilent Technologies, Waldbronn, Germany) with an Agilent photodiode array detector (DAD), and on a ZORBAX Eclipse® XDB-C8 column (5 μm, 150 mm× 4.6 mm, Palo Alto, CA, USA) and detected at 230 nm. Separation was achieved by using two mobile phases of autoclaved pure water (MilliQ, Millipore, Billerica, MA, USA), pH 2.6 (o-phosphoric acid) (acetonitrile at a rate of 1 ml of solvent per min for 45 min). NIV, DON, FX, 15-AcDON, and 3-AcDON were eluted at 4.5, 6.5, 9.03, 12.10, and 12.3 min, respectively. Type B trichothecene standards solution (NIV, DON, FX, 15-AcDON and 3-AcDON) prepared from pure commercial powders obtained from Sigma-Aldrich (St Quentin Fallavier, France), and dissolved in methanol–water (1:1, v/v). Trichothecenes in samples were identified by comparing their spectra with those of the known commercial standards. This experiment was performed in triplicate.

water (1:1, v/v) and then analysed with HPLC as previously described (Bily et al.; 2004). This experiment was done in triplicate.

2.5.3. Statistical analysis Data were subjected to analysis of variance (ANOVA) with SPSS software version 13.0 for Windows (Chicago, Illinois, USA). Significance of mean differences were determined using the Duncan's test, and responses were judged significant at the 5% level (P = 0.05). Correlation test were performed using the Pearson's coefficient.

2.6. Aggressiveness of isolates Seventeen isolates of F. culmorum differing in DON/3-AcDON production were tested for aggressiveness towards the susceptible durum wheat cultivar Karim. Seeds were planted in an autoclaved potting mix (1 part sand, 1 part peat, 1 part compost) at a depth of 2 cm in each pot, and were grown in a greenhouse at 25 °C. Seedlings were inoculated with an agar plug at the two- to three-leaf Zadoks's growth stage (Zadoks et al., 1974). An agar plug (1 cm diameter) with mycelium was cut from the periphery of a 5 day-old culture grown on PDA (Potato Dextrose Agar). The agar plug was placed next to the stem base of each plant and covered with soil. Controls were inoculated with a mycelium free agar plug. There were three replicates per isolate with three seedlings in each replicate in a completely randomised design. All plants were watered daily with tap water, and grown in a greenhouse at 25 °C and 16 h photoperiod. Twenty-one days after inoculation, each of the plants was pulled out and washed. Disease symptoms for each individual plant were assessed by calculating the proportion of the length of stem discoloration and plant height and rated using a 0–5 scale (0 = no discoloration; 1 = trace to 25%; 2 = 25% to 50%; 3 = more than 50% to 75%; 4 = more than 75%; and 5 = dead plant) as described by Tinline (1986), with minor modifications. All experiments were carried out in triplicate. For each replicate, a disease index (DI) was calculated as the mean of disease scores of the seedlings. Disease severity data also were subjected to an analysis of variance. The statistical analysis of aggressiveness was based on the disease index (DI).

3. Results 3.1. PCR assays of Fusarium culmorum Morphological identification of all F. culmorum isolates was confirmed by PCR with specific primers described by Schilling et al. (1996). Thus, a fragment of 450 bp characteristic of F. culmorum was observed in all isolates.

3.2. Analysis of trichothecenes genes by PCR 2.5.2. Cultures in liquid cultures Eight ml of MS medium (0.5 g/l KH2PO4; 0.6 g/l K2HPO4; 17 mg/ l MgSO4; 1 g/l (NH4)2SO4; 20 g/l glucose; 0.1 mg/l of biotine, and 0.1 ml/l of mineral salts solution 50X) (Boutigny et al., 2009) poured in sterile Petri dishes (Ø 55 mm) was inoculated with each isolate at a final concentration of 104 spores/ml. Fungal liquid cultures were grown in triplicate and incubated in the dark at 25 °C. Fourteen days after inoculation the mycelia were pelleted by centrifugation (2000 rpm, 10 min, 4 °C) and the decanted supernatants were stored at −20 °C until analysed. The mycelium was stored at −80 °C for 24 h. Fungal biomass production was measured by weighing the mycelia after 48 h of lyophilisation. A 4 ml aliquot of the culture filtrate was extracted with two volumes of ethyl acetate. A 6 ml aliquot of the organic phase was evaporated to dryness at 70 °C under nitrogen. Dried samples were dissolved again in 200 μl of methanol–

Amplification with the Tox5-1 and Tox5-2 primers produced a single band of 650 bp as previously described (Niessen and Vogel, 1998) for all F. culmorum isolates studied. Thus, all of the isolates tested are potential trichothecene producers. PCR assays based on the Tri7 and Tri13 genes were used to determine the genotype of each F. culmorum isolate. Results showed that 98 isolates yielded a 282 bp fragment with the Tri13DON assay indicating that they were of DON PCR genotype. These isolates produced a PCR product of 483 bp with the MinusTri7 assay indicating deletion of the entire Tri7 gene sequence. Two strains from Bizerte yielded specific PCR products with Tri13NIVF/Tri13R (465 bp) and Tri7F/Tri7NIV (312 bp) indicative of NIV producers. Thus, both DON and NIV-producing strains were present but the majority of the strains were the DON genotype. All strains with the DON genotype produced 3-AcDON.

L.G. Kammoun et al. / International Journal of Food Microbiology 140 (2010) 84–89 Table 3 Geographic origin, production of mycotoxin and aggressiveness of F. culmorum strains. Geographic origin

Toxin (µg/g) on MS

Toxin (µg/g) on grains

Disease index (DI)

Cap Bon

11,000 l ± 200 160 ab ± 10 140 ab ± 10 n.d. 6600 k ± 500 4100 j ± 320 3300 i ± 180 1900f g ± 160 1700 efg ± 100 3700 j ± 100 2400 h ± 120 2000 gh ± 150 770 d ± 5 290 ab ± 20 40 a ± 3 1600 ef ± 100 690 e ± 60 36 a ± 1 n.d. n.d. 420 bc ± 15 200 ab ± 15 21 a ± 1 630 cd ± 50 51 a ± 5 36 a ± 3 33 a ± 3 n.d.

150 ef ± 10 21 abc ± 2 160 f ± 6 25 abc ± 1.5 210 g ± 6 10 ab ± 0.5 80 d ± 4 51 c ± 3.5 n.d. 610 k ± 55 130 e ± 10 20 abc ± 1.5 22 abc ± 0.5 300 h ± 3.5 23 abc ± 2 30 abc ± 1 460 j ± 4.5 220 g ± 8 15 ab ± 1 150 f ± 6 370 i ± 30 22 abc ± 2 61 e ± 3.5 19 abc ± 1.5 42 bc ± 0.5 18 abc ± 1.5 22 abc ± 1.5 43 bc ± 2.5

4.2 hi n.t. 3.7 ef 5j 4.4 i n.t. n.t. n.t. 4 gh 3.7 efg 2b 3.4 e n.t. n.t. 3.5 ef n.t. n.t. 3d 3.5 e n.t. n.t. 1a 4 fgh 3.4 e n.t. 2.4 c 2.5 c 2.7 c

Tunis

Mateur

Béja

Jendouba

Bizerte

Each value is a mean of three experiments. Values with the same letter are not significantly different (P N 0.05); n.d., not detectable; n.t., not tested.

3.3. Analysis of trichothecenes by HPLC Of the four trichothecenes, only DON and 3-AcDON were produced at detectable levels. DON levels from both grain and MS media cultures were much lower than the 3-AcDON levels. The HPLC analyses confirmed the chemotypes predicted by the PCR assays. However one of the 28 isolates did not produce trichothecene on grain culture, and 4/28 isolates did not show trichothecene production on MS medium. Isolates that produced 3-AcDON varied in the amount of toxin production, with the amount of toxin produced depending on the medium (wheat grain or MS medium, Table 3). On grain culture, the detectable amounts of mycotoxins produced by F. culmorum ranged from 10 µg/g to 610 µg/g, with a mean of 122 µg/g. On MS medium, it ranged from 21 µg/g to 11.000 µg/g of dry biomass, with a mean of 1743 µg/g. The level of toxin production was significantly dependent on medium and isolate (P b 0.05). 3.4. Aggressiveness tests All of the isolates were pathogenic towards wheat seedlings, but aggressiveness among the isolates varied significantly (P b 0.05)

87

(Table 2). Discoloration and browning of the coleoptiles were observed on all inoculated wheat seedlings. Results showed no correlation between disease severity index (DI) and the quantity of DON/3-AcDON produced by a strains growing on grain medium (Fig. 1), however, a significant correlation between aggressiveness and the amount of DON/3-AcDON produced on MS medium (r = 0.36, P b 0.01) was revealed (Fig. 2). 4. Discussion Within the last five years, there have been serious outbreaks of FHB in wheat in northern Tunisia. Previous studies identified F. culmorum as the dominant toxinogenic species present (Kammoun et al., 2009). A total of 100 F. culmorum isolates originated from different regions were assayed by PCR for their mycotoxin chemotypes. Results obtained showed that all strains have the Tri5 region and thus are potential producers of trichothecene mycotoxins. Additional PCR amplification of Tri7 and Tri13 alleles suggests that two of 100 isolates could produce NIV, but 98% of the strains produce DON. Accumulation of DON in harvested grain has been reported previously (Kammoun et al., 2009; Bensassi et al., 2009), but this report is the first to identify toxin genotypes amongst F. culmorum isolates in Tunisia. Our results are consistent with previous studies that have shown that in northern Mediterranean countries, including Italy, France, Portugal and Yugoslavia (Logrieco et al., 2003), and in many other European countries (Tóth et al., 2004; Jennings et al., 2004), the DON chemotype dominates in F. culmorum. In contrast, a high proportion of the F. culmorum strains from New Zealand, Korea and Japan (Lauren et al., 1992; Kim et al., 1993; Lee et al., 2002), was the NIV chemotype/genotype. The PCR assays of the Tri7 and Tri13 genes identified both DON and NIV genotypes. The nonfunctional copies of these genes indicated that DON-producing isolates of F. culmorum did not carry Tri7 gene and carried a Tri13 pseudogene with two deletions. Our results showed that all F. culmorum DON genotypes produced a PCR product with assay MinusTri7, indicating the deletion of the entire Tri7 gene sequence. Similar results have been previously reported showing that the deletion of Tri7 is the norm in all DON isolates for F. culmorum species (Chandler et al., 2003; Jennings et al., 2004; Tóth et al., 2004), however, such deletion has been rarely observed in the DON isolates of the species F. graminearum (Lee et al., 2001; Chandler et al., 2003; Jennings et al., 2004). All of the strains of F. culmorum we examined produced 3-AcDON. These results are consistent with the previous findings of Jennings et al. (2004), showing that the deletion of Tri7 in F. culmorum isolates is associated with the 3-AcDON chemotype. Results from Mediterranean countries (Logrieco et al., 2003) also indicated that only 3-AcDON was produced by F. culmorum isolates recovered from cereal grains. Similarly, 3-AcDON was the only trichothecene produced by F. culmorum collected in Germany (Muthomi et al., 2000), in the UK (Tóth et al., 2004) and in Wales (Jennings et al., 2004). The prevalence of 3-AcDON chemotypes in Tunisian population of F. culmorum could

Fig. 1. Relation between disease index (DI) and DON/3-ADON concentration produced by F. culmorum cultured on wheat grains.

88

L.G. Kammoun et al. / International Journal of Food Microbiology 140 (2010) 84–89

Fig. 2. Relation between disease index (DI) and DON/3-ADON concentration produced by F. culmorum cultured on MS medium.

have an epidemiological implication because 3-AcDON chemotypes are known to produce more DON, to be more aggressive on hosts and to have highest fitness than a 15-AcDON chemotypes (Guo et al., 2008). Results of the molecular essays were confirmed by chemistry analyses. Thus HPLC conducted on 28 potential 3-AcDON producer isolates revealed that all isolates produced this mycotoxin in both medium and differed significantly in their production (P b 0.05). However, for one isolate no toxin was detected on grain culture, and for 4/28 isolates no trichothecene was produced on MS medium. This result was not unexpected since Quarta et al. (2005) identified 9/55 F. culmorum strains with the 3Ac-DON genotypes did not produce trichothecenes. Thus while a positive trichothecene genotype indicates the potential for trichothecene biosynthesis, only a test for the toxin itself can be used to determine if and how much toxin a strain has produced. Furthermore, our results showed that 3Ac-DON production in vitro by F. culmorum isolates varied widely, with some strains producing large amounts of 3Ac-DON, whereas others produce relatively small amounts of these toxins. In vitro, DON may be produced by utilizing very different culture conditions such as whole grain, solid substrate fermentation, or liquid cultures using a defined minimal medium. Our results corroborate that growth conditions greatly influence the amount of mycotoxin produced. Trichothecene biosynthesis may be regulated by temperature (Ramirez et al., 2006), relative humidity (Beyer et al., 2005), and substrate composition (O'Neill et al., 1993). The large difference in DON contents may be also supported by the genetic effects. Bakan et al. (2002) demonstrated that in vitro high-producing and low-producing F. culmorum strains differed in two separate gene clusters. Such intraspecific variation in toxin production by all Fusarium species is well known, e.g. Llorens et al. (2006), Walker et al. (2001), Muthomi et al. (2000), and Langseth et al. (1999). Results lead to the conclusion that in vitro assays could not appropriate to predict production of DON in the field as suggested by Gang et al. (1998). The physiology of plant-hosts and pathogenesis of the strain itself may further influence mycotoxin accumulation under field conditions. The phytotoxic nature of DON led to the hypothesis that its production is an important component of the pathogenicity and aggressiveness of Fusarium species (Gang et al., 1998; Harris et al., 1999; Mudge et al., 2006; Wagacha and Muthomi, 2007). Accordingly, an attempt to study the correlation between the aggressiveness and mycotoxin production has been performed on 17 isolates on wheat seedlings under controlled conditions. All 17 isolates were pathogenic to seedlings, and there was a significant difference in aggressiveness among these isolates (P b 0.05). Furthermore, results showed no correlation between aggressiveness and 3Ac-DON production on wheat grain, while a significant correlation between aggressiveness and the amount of 3-AcDON produced on MS medium (r = 0.36, P b 0.01). This observation is in line with the hypothesis that DON is an effective virulence factor on wheat (Tóth et al., 2005; Wagacha and Muthomi, 2007). Although very few attempts have been made to connect seedling blight severity directly to DON-producing, Hestbjerg

et al. (2002) have found a positive correlation between aggressiveness and DON content in barley seedlings inoculated with F. culmorum. This author added that the production of DON is independent of which plant part is infected and correlates to the amount of disease. In contrast, Manka et al. (1985) reported that for some strains of F. graminearum that do not produce DON can cause seedling blight of wheat, rye and triticale. The occurrence of Fusaria is significantly affected by environmental conditions (temperature, precipitation, air humidity), and cultures practices. The species F. culmorum is dominant in cooler areas like north, central and western Europe (Wagacha and Muthomi, 2007). The prevalence of F. culmorum on wheat head under Tunisian climate could be explained by the occurrence of exceptional climatic conditions during flowering, a more susceptible stage to FHB infection (Kammoun et al., 2009). In contrast, in dry springs and the irregular rainfall conditions, F. culmorum is also associated with Fusarium foot rot (Gargouri et al., 2001). This research has demonstrated the prevalence of 3-AcDON in tunisien F. culmorum population which is a pathogenic factor that aggravate the epidemic development of Fusarium diseases, and stress the nationwide surveillance for increasing food and feed safety. Acknowledgements We thank Marie-Noëlle Verdal-Bonnin, Vessela AtanassovaPénichon, Laëtitia Pinson-Gadais Françoise, and Giselle Marchegay for help with the HPLC analysis, and Dr Rhouma Ali for advice on statistical analysis. This work was funded in part by the International Foundation for Science (IFS: C/4026-1), the MESRST (Ministère de l'Enseignement Supérieur, de la Recherche Scientifique et de la Technologie, LR00AGR02), and by INRA Bordeaux (MycSA, UR 1264, Aquitaine). References Abramson, D., Clear, R.M., Gaba, D., Smith, D., Patrick, S.K., Saydak, D., 2001. Trichothecene and moniliformin production by Fusarium isolates from western Canadian wheat. Journal of Food Protection 64, 1220–1225. Bakan, B., Pinson, L., Cahagnier, B., Melcion, D., Sémon, E., Richard-Molard, D., 2001. Toxigenic potential of Fusarium culmorum strains isolated from French wheat. Food Additives and Contaminants 18, 998–1003. Bakan, B., Giraud-Delville, C., Pinson, L., Richard-Molard, D., Fournier, E., Brygoo, Y., 2002. Identification by PCR of Fusarium culmorum strains producing large and small amounts of deoxynivalenol. Applied and Environmental Microbiology 68, 5472–5479. Bennett, J.W., Klich, M., 2003. Mycotoxins. Clinical Microbiology Reviews 16, 497–516. Bensassi, F., Zaied, C., Abid, S., Hajlaoui, M.R., Bacha, H., 2009. Occurrence of deoxynivalenol in durum wheat in Tunisia. Food Control 281–285. doi:10.1016/j. foodcont.2009.06.005. Beyer, M., Verreet, J.A., Ragab, W.S.M., 2005. Effect of relative humidity on germination of ascospores and macroconidia of Gibberella zeae and deoxynivalenol production. International Journal of Food Microbiology 98, 233–240. Bily, A.C., Reid, L.M.M., Savard, E., Reddy, R., Blackwell, B.A., Campbell, C.M., Krantis, A., Durst, T., Philogene, B.J.R., Arnason, J.T., Regnault-Roger, C., 2004. Analysis of Fusarium graminearum mycotoxins in different biological matrices by LC/MS. Mycopathologia 157, 117–126.

L.G. Kammoun et al. / International Journal of Food Microbiology 140 (2010) 84–89 Bottalico, A., Perrone, G., 2002. Toxigenic Fusarium species and mycotoxins associated with head blight in small-grain cereals in Europe. European Journal of Plant Pathology 108, 611–624. Boutigny, A.L., Barreau, C., Atanasova-Penichon, V., Verdal-Bonnin, M.N., Pinson-Gadais, L., Richard-Forget, F., 2009. Ferulic acid, an efficient inhibotor of type B trichothecene biosynthesis and Tri gene expression in Fusarium liquid cultures. Mycological Research 113, 746–753. Chandler, E.A., Simpson, D.R., Thomsett, M.A., Nicholson, P., 2003. Development of PCR assays to Tri7 and Tri13 trichothecene biosynthetic genes, and characterisation of chemotypes of Fusarium graminearum, Fusarium culmorum and Fusarium cerealis. Physiological and Molecular Plant Pathology 62, 355–367. Desjardins, A.E., 2006. Fusarium Mycotoxins Chemistry, Genetics, and Biology. APS PRESS, St. Paul, Minnesota, USA. Eudes, F., Comeau, A., Rioux, S., Collin, J., 2000. Phytotoxicity of eight mycotoxins associated with Fusarium in wheat head blight. Canadian Journal of Plant Pathology 22, 286–292. Eudes, F., Comeau, A., Rioux, S., Collin, J., 2001. Impact of trichothecenes on Fusarium head blight (Fusarium graminearum) development in spring wheat (Triticum aestivum). Canadian Journal of Plant Pathology 23, 318–322. Gale, L.R., Ward, T.J., Balmas, V., Kistler, H.C., 2007. Population subdivision of Fusarium graminearum sensu stricto in the upper midwestern United States. Phytopathology 97, 1434–1439. Gang, G., Miedaner, T., Schuhmacher, U., Schollenberger, M., Geiger, H.H., 1998. Deoxynivalenol and nivalenol production by Fusarium culmorum isolates differing in aggressiveness toward winter rye. Phytopathology 88, 879–884. Gargouri, S., Hajlaoui, M.R., Gurmech, A., Marrakchi, M., 2001. Identification des espèces fongiques associées à la pourriture du pied du blé et leur répartition selon les étages bioclimatiques. Bulletin OEPP 31, 499–503. Guo, X.W., Fernando, W.G.D., Seow-Brock, H.Y., 2008. Population structure, chemotype diversity, and potential chemotype shifting of Fusarium graminearum in wheat fields of Manitoba. Plant Disease 92, 756–762. Harris, L.J., Desjardins, A.E., Plattner, R.D., Nicholson, P., Butler, G., Young, J.C., Weston, G., Proctor, R.H., Hohn, T.M., 1999. Possible role of trichothecenes mycotoxins in virulence of Fusarium graminearum on maize. Plant Disease 83, 954–960. Hestbjerg, H., Felding, G., Elmholt, S., 2002. Fusarium culmorum infection of barley seedlings: correlation between aggressiveness and deoxynivalenol content. Journal of Phytopathology 150, 308–312. Jennings, P., Coates, M.E., Turner, J.A., Chandler, E.A., Nicholson, P., 2004. Determination of deoxynivalenol and nivalenol chemotypes of Fusarium culmorum isolates from England and Wales by PCR assay. Plant Pathology 53, 182–190. Kammoun, G.L., Gargouri, S., Hajlaoui, M.R., Marrakchi, M., 2009. Occurrence and distribution of Microdochium and Fusarium species isolated from durum wheat in northern Tunisia and detection of mycotoxins in naturally infested grain. Journal of Phytopathology 157, 546–551. Kim, J.C., Kang, H.J., Lee, D.H., Lee, Y.W., Yoshizawa, T., 1993. Natural occurrence of Fusarium mycotoxins (trichothecenes and zearalenone) in barley and corn in Korea. Applied and Environmental Microbiology 59, 3798–3802. Langseth, W., Bernhoft, A., Rundberget, T., Kosiak, B., Gareis, M., 1999. Mycotoxin production and cytotoxicity of Fusarium strains isolated from Norwegian cereals. Mycopathologia 144, 103–113. Lauren, D.R., Sayer, S.T., diMenna, M.E., 1992. Trichothecene production by Fusarium species isolated from grain and pasture throughout New Zealand. Mycopathologica 120, 167–176. Lee, T., Oh, D.W., Kim, H.S., Lee, J., Kim, Y.H., Yun, S.H., Lee, Y.W., 2001. Identification of deoxynivalenol and nivalenol producing chemotypes of Gibberella zeae by using PCR. Applied and Environmental Microbiology 67, 2966–2972. Lee, T., Han, Y.K., Kim, K.H., Yun, S.H., Lee, Y.W., 2002. Tri13 and Tri7 determine deoxynivalenol and nivalenol producing chemotypes of Gibberella zeae. Applied and Environmental Microbiology 68, 2148–2154. Leslie, J.F., Summerell, B.A., 2006. The Fusarium Laboratory Manual. Blackwell Publishing Professional 2121 State Avenue, Ames, Iowa, 50014, USA. Llorens, A., Hinojo, M.J.M., Mateo, R., Gonzalez-Jaen, M.T., Valle-Algarra, F.M., Logrieco, A., Jimenez, M., 2006. Characterization of Fusarium spp. isolates by PCR-RFLP analysis of the intergenic spacer region of the rRNA gene (rDNA). International Journal of Food Microbiology 106, 287–306.

89

Logrieco, A., Bottalico, A., Mulé, G., Moretti, A., Perrone, G., 2003. Epidemiology of toxigenic fungi and their associated mycotoxins for some Mediterranean crops. European Journal of Plant Pathology 109, 645–667. Manka, M., Visconti, A., Chelkowski, J., Bottalico, A., 1985. Pathogenicity of Fusarium isolates from wheat, rye, and triticale towards seedlings and their ability to produce trichothecenes and zearalenone. Phytopathology 13, 24–29. Miller, J.D., Greenhalgh, R., Wang, Y.Z., Lu, M., 1991. Trichothecene chemotypes of three Fusarium species. Mycologia 83, 121–130. Mirocha, C.J., Xie, W., Xu, Y., Wilcoxson, R.D., Woodward, R.P., Etebarian, R.H., Behele, G., 1994. Production of trichothecene mycotoxins by Fusarium graminearum and Fusarium culmorum or barley and wheat. Mycopathologia 128, 19–23. Möller, E.M., Bahnweg, G., Sandermann, H., Geiger, H.H., 1992. A simple and efficient protocol for isolation of high molecular weight DNA from filamentous fungi, fruit body and infected plant tissue. Nucleic Acids Research 20, 6115–6116. Mudge, A.M., Dill-Macky, R., Dong, Y., Gardiner, D.M., White, R.G., Manners, J.M., 2006. A role for the mycotoxin deoxynivalenol in stem colonisation during crown rot disease of wheat caused by Fusarium graminearum and Fusarium pseudograminearum. Physiological and Molecular Plant Pathology 69, 73–85. Muthomi, J.W., Schutze, A., Dehne, H.W., Mutitu, E.W., Oerke, E.C., 2000. Characterisation of Fusarium culmorum isolates by mycotoxin production and aggressiveness to winter wheat. Journal of Plant Disease and Protection 107, 113–123. Niessen, M.L., Vogel, R.F., 1998. Group specific PCR-detection of potential trichotheceneproducing Fusarium species in pure cultures and cereal samples. Systematic and Applied Microbiology 21, 618–631. O'Neill, K., Damaglou, A.P., Patterson, M.F., 1993. Toxin production by Fusarium culmorum IMI 309344 and F. graminearum NRRL 5883 on grain substrates. Journal of Applied Bacteriology 74, 625–628. Osborne, L.E., Stein, J.M., 2007. Epidemiology of Fusarium head blight on small-grain cereals. International Journal of Food Microbiology 119, 103–108. Quarta, A., Mita, G., Haidukowski, M., Santino, A., Mulè, G., Visconti, A., 2005. Assessment of trichothecene chemotypes of Fusarium culmorum occurring in Europe. Food Additives and Contaminants 22, 309–315. Ramirez, M.L., Chulze, S., Magan, N., 2006. Temperature and water activity effects on growth and temporal deoxynivalenol production by two Argentinean strains of Fusarium graminearum on irradiated wheat grain. International Journal of Food Microbiology 106, 291–296. Ryu, J.C., Ohtsubo, K., Izumiyama, N., Nakamura, K., Tanaka, T., Yamamura, H., Ueno, Y., 1988. The acute and chronic toxicities of nivalenol in mice. Fundamental and Applied Toxicology 11, 38–47. Schilling, A.G., Moller, E.M., Geiger, H.H., 1996. Polymerase chain reaction-based assays for species-specific detection of Fusarium culmorum, Fusarium graminearum and F. avenaceum. Phytopathology 86, 515–522. Stepièn, L., Popiel, D., Koczyk, G., Chelkowsk, J., 2008. Wheat-infecting Fusarium species in Poland—their chemotypes and frequencies revealed by PCR assay. Journal of Applied Genetics 49, 433–441. Sugiura, Y., Watanabe, Y., Tanaka, T., Yamamoto, S., Ueno, Y., 1990. Occurrence of Gibberella zeae strains that produce both nivalenol and deoxynivalenol. Applied and Environmental Microbiology 56, 3047–3051. Tinline, R.D., 1986. Agronomic practices and common root rot in spring wheat: effect of depth and density of seedling on disease. Canadian Journal of Plant Pathology 8, 429–435. Tóth, B., Mesterhazy, A., Nicholson, P., Teren, J., Varga, J., 2004. Mycotoxin production and molecular variability of European and American isolates of Fusarium culmorum. European Journal of Plant Pathology 110, 587–599. Tóth, B., Mesterhazy, A., Horváth, Z., Bartók, T., Varga, M., Varga, J., 2005. Genetic variability of central European isolates of he Fusarium graminearum species complex. European Journal of Plant Pathology 113, 35–45. Wagacha, J.M., Muthomi, J.W., 2007. Fusarium culmorum: infection process, mechanisms of mycotoxin production and their role in pathogenesis in wheat. Crop Protection 26, 877–885. Walker, S., Leath, S., Hagier, W., Murphy, J., 2001. Variation among isolates of Fusarium graminearum associated with Fusarium head blight in North Carolina. Plant Disease 85, 404–410. Zadoks, J.C., Chang, T.T., Konzak, C.F., 1974. A decimal code for the growth stages of cereals. Weed Research 14, 415–421.