Fibrosis in Mice

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

ORIGINAL RESEARCH

59 60 61 62 63 64 65 Ling Yang,1,2,* Kouichi Miura,1,3,* Bi Zhang,1,* Hiroshi Matsushita,1,4 Yoon Mee Yang,4 66 67 Shuang Liang,1 Jingyi Song,1 Yoon Seok Roh,1,4 and Ekihiro Seki1,4,5,6 68 1 69 Division of Gastroenterology, Department of Medicine, University of California San Diego, School of Medicine, La Jolla, 2 70 California; Division of Gastroenterology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China; 3Department of Gastroenterology, Akita University Graduate School of Medicine, Akita, Japan; 71 4 Division of Gastroenterology, Department of Medicine, 5Department of Biomedical Sciences, Cedars-Sinai Medical Center, 72 Los Angeles, California; 6Department of Medicine, University of California Los Angeles, David Geffen School of Medicine, 73 Los Angeles, California 74 75 inflammation, and fibrosis. (Cell Mol Gastroenterol Hepatol 76 SUMMARY 2017;-:-–-; http://dx.doi.org/10.1016/j.jcmgh.2016.12.004) 77 Translocated intestine-derived lipopolysaccharide stimu78 lates Toll-like receptor 4 expressed in different liver cells Keywords: TLR4; Hepatocyte Apoptosis; LPS; Neutrophils. 79 that have distinct roles in the development of nonalcoholic 80 steatohepatitis. The Toll-like receptor 4–mediated TRIF Q7 81 pathway promotes liver steatosis, but inhibits inflammation atty liver disease is the result of excessive fat Q8 82 and fibrosis in nonalcoholic steatohepatitis. accumulation in hepatocytes. Nonalcoholic fatty liver Q9 83 disease (NAFLD) is a manifestation of the metabolic 84 syndrome, commonly associated with obesity and insulin 85 BACKGROUND & AIMS: Toll-like receptor 4 (TLR4) signaling is resistance. The spectrum of NAFLD ranges from simple 86 activated through 2 adaptor proteins: MyD88 and TRIF. TLR4 steatosis to steatosis accompanied by hepatocyte ballooning, 87 and MyD88 are crucial in nonalcoholic steatohepatitis (NASH) inflammation, and fibrosis, referred to as nonalcoholic 88 1–4 NASH can progress to cirrhosis, Q10 89 and fibrosis. However, the role of TRIF in TLR4-mediated steatohepatitis (NASH). NASH and fibrosis has been elusive. This study investigated which significantly increases the risk of hepatocellular 90 the differential roles of TRIF in hepatic steatosis and inflam- carcinoma.1–4 To date, there is no effective preventive or 91 mation/fibrosis. therapeutic agent for NASH and its associated fibrosis and 92 hepatocellular carcinoma. Therefore, a better understanding 93 METHODS: A choline-deficient amino acid defined (CDAA) diet of the underlying molecular mechanism is critical for the 94 was used for the mouse NASH model. On this diet, the mice development of new and effective therapies. 95 develop hepatic steatosis, inflammation, and fibrosis. TLR4 Consumption of diets containing excessive fat and sugar 96 -/-/wild-type and TLR4 bone marrow chimeric mice and TRIF mice were fed CDAA or a control diet for 22 weeks. Hepatic is a risk factor for metabolic syndrome. These so-called 97 Western-style diets may cause intestinal bacterial over- 98 steatosis, inflammation, and fibrosis were examined. growth as well as alter the composition of the intestinal 99 RESULTS: In the CDAA diet–induced NASH, the mice with wild- microbiome. The altered intestinal microbiome may partic100 type bone marrow had higher alanine aminotransferase and ipate in endotoxin production, endogenous alcohol produc101 -/hepatic tumor necrosis factor levels than the mice with TLR4 tion, bile acid metabolism, and choline metabolism. 102 bone marrow. The nonalcoholic fatty liver disease activity score Western-style diets form a gut microbiota that converts showed that both wild-type and TLR4-/- bone marrow chimeras dietary choline into methylamines, reducing plasma levels 103 had reduced hepatic steatosis, and that both types of chimeras of phosphatidylcholine. Because phosphatidylcholine is 104 105 had similar levels of inflammation and hepatocyte ballooning to 106 whole-body wild-type mice. Notably, wild-type recipients -/107 showed more liver fibrosis than TLR4 recipients. Although *Authors share co-first authorship. -/108 TRIF mice showed reduced hepatic steatosis, these mice Abbreviations used in this paper: ALT, alanine aminotransferase; BM, bone marrow; BMT, bone marrow transplantation; CDAA, choline109 showed more liver injury, inflammation, and fibrosis than wilddeficient amino acid defined; DGAT2, diacylglycerol acyltransferase 2; 110 type mice. TRIF-/- stellate cells and hepatocytes produced more HFD, high-fat diet; HSC, hepatic stellate cell; IL, interleukin; LDH, lactate dehydrogenase; LPS, lipopolysaccharide; NAFLD, nonalcoholic 111 CXCL1 and CCL3 than wild-type cells in response to lipopolyfatty liver disease; NASH, nonalcoholic steatohepatitis; PCR, saccharide. Consistently, TRIF-/- mice showed increased CXCL1 112 polymerase chain reaction; a-SMA, a-smooth muscle actin; TLR4, and CCL3 expression along with neutrophil and macrophage 113 Toll-like receptor 4; TNF, tumor necrosis factor. infiltration, which promotes liver inflammation and injury. 114 © 2017 The Authors. Published by Elsevier Inc. on behalf of the AGA Institute. This is an open access article under the CC BY-NC-ND 115 license (http://creativecommons.org/licenses/by-nc-nd/4.0/). CONCLUSIONS: In TLR4-mediated NASH, different liver cells 116 2352-345X

TRIF Differentially Regulates Hepatic Steatosis and Inflammation/Fibrosis in Mice

Q21

F

Q5

Q6

have distinct roles in hepatic steatosis, inflammation, and fibrosis. TRIF promotes hepatic steatosis but it inhibits injury,

http://dx.doi.org/10.1016/j.jcmgh.2016.12.004

FLA 5.4.0 DTD
JCMGH190 proof
2 February 2017
1:15 pm
ce DVC

2

117 118 119 120 121 122 123 124 125 126 127 Q11 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 Q12 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175

Yang et al

Cellular and Molecular Gastroenterology and Hepatology Vol.

required for the secretion of very low density lipoprotein from hepatocytes, reduced choline levels can exacerbate fat accumulation in hepatocytes.5 Increased blood lipopolysaccharide (LPS) levels often are observed in patients with NASH.5–7 Toll-like receptor 4 (TLR4) is a pattern-recognition receptor for LPS and induces activation of innate immune signaling through adaptor proteins MyD88 and TRIF.8 Previous studies clearly have shown the critical roles of TLR4 and MyD88 in promoting NASH and its related fibrosis.9–11 Interestingly, IRF3, downstream of the TRIF-dependent pathway, plays paradoxic roles between alcoholic liver disease and high-fat diet (HFD)-induced NAFLD. The TRIF-mediated IRF3 activation promotes alcohol-induced liver injury whereas IRF3 negatively regulates HFD-induced steatosis.12,13 However, the precise roles of the TLR4–TRIF pathway in NASH and fibrosis remain elusive. HFD feeding induces fatty liver, weight gain, and insulin resistance, but liver inflammation is very mild and fibrosis does not occur. In contrast, feeding of a methioninecholine–deficient diet, commonly used for NASH studies in rodents, induces liver injury and inflammation, but body weight is reduced and insulin resistance is not developed. Notably, rodents fed a choline-deficient amino acid defined (CDAA) diet evidently develop fibrosis along with hepatic steatosis, inflammation, weight gain, and mild insulin resistance.10 Because we aimed to examine TLR4-mediated NASH fibrosis, this study used CDAA diet feeding to understand the mechanisms of the pathogenesis of NASH fibrosis. The present study investigated to determine the responsible cell types for TLR4-mediated NASH and fibrosis, and the role of TRIF in the development of NASH and its related fibrosis.

Materials and Methods Mouse Colonies Wild-type C57BL/6 mice and Triflps/lps mice (hereafter referred to as TRIF-/- mice) were purchased from The Jackson Laboratory (Bar Harbor, MA).14 TLR4-/- mice and MyD88-/- mice originally were developed in Shizuo Akira’s laboratory and were back-crossed to C57BL/6 for more than 10 generations.15 Male mice were divided into 2 groups at 8 weeks old: choline-supplemented L-amino acid–defined diet (catalog no. 518754; Dyets, Inc, Bethlehem, PA) and CDAA (catalog no. 518753; Dyets, Inc).10 These diets were continued for 22 weeks. The mice received humane care based on the National Institutes of Health recommendations outlined in the Guide for the Care and Use of Laboratory Animals. All animal experiments were approved by the University of California San Diego and Cedars-Sinai Medical Center Institutional Animal Care and Use Committee.

Bone Marrow Transplantation We performed bone marrow transplantation (BMT) experiments as previously described.14 Briefly, bone marrow (BM) cells (1
107 cells) obtained from wild-type and TLR4-/- mice were transplanted through tail veins after the recipient mice were lethally irradiated (10 Gy). After 2 weeks of lethal irradiation followed by BMT, liposomal

-,

No.

-

clodronate (200 mL intravenously) was injected to deplete 176 liver resident macrophages, Kupffer cells, which accelerate 177 hepatic macrophage turnover with BM cells. The mice were 178 fed with CDAA and choline-supplemented amino acid– 179 defined diet after 10 weeks of BMT. These diets were 180 continued for 22 weeks. Some mice were transplanted with 181 BM from b-actin promoter–driven green fluorescent protein 182 (GFP) transgenic mice for assessing the efficiency of the Q13 183 engraftment of transplanted BM cells. 184 185 186 Mouse Tissue Processing Mouse tissues were either snap-frozen in liquid nitrogen 187 for RNA, or fixed in 10% or 4% neutral buffered formalin 188 phosphate (Fisher Scientific, Pittsburgh, PA) to be embedded 189 in paraffin or OCT compound, then cut into 5-mm sections 190 for H&E, Oil-red O, and Sirius red staining. The Sirius 191 red–positive area was measured on 10 low-power (40
) 192 fields/slide and quantified with the use of National Institutes 193 of Health imaging software. NAFLD activity score was 194 determined as described.10 Immunostaining for a-smooth 195 196 muscle actin (a-SMA), Ly6G, and F4/80 was performed.10 197 198 Quantitative Real-Time Polymerase 199 Chain Reaction 200 Extracted RNA from livers and cells was subjected to 201 reverse-transcription and subsequent quantitative real-time 202 polymerase chain reaction (PCR) with the use of the CFX96 203 real-time PCR system (Bio-Rad, Hercules, CA). PCR primer 204 sequences are listed in Table 1. Genes were normalized to 205 18S RNA as an internal control. 206 207 208 Cell Isolation and Treatment Hepatocytes, hepatic stellate cells (HSCs), and Kupffer 209 cells were isolated from the mice as previously described.14 210 HSCs were isolated in a 2-step process: collagenase-pronase 211 perfusion of mouse livers followed by 8.2% Nycodenz 212 (Accurate Chemical and Scientific Corporation) 2-layer 213 discontinuous density gradient centrifugation. To ensure 214 the highest possible purity, we depleted contaminated liver 215 macrophages from HSC fractions by magnetic antibody cell 216 sorting (Miltenyi Biotec) using an antibody to F4/80 antigen Q14 217 (eBioscience) and CD11b-conjugated microbeads (Miltenyi 218 Biotec). Kupffer cells were isolated using magnetic antibody 219 cell sorting with antibody to F4/80 antigen (eBioscience) 220 and CD11b-conjugated microbeads. After cell attachment, 221 hepatocytes were serum-starved for 16 hours. The culture 222 media for Kupffer cells and HSCs were changed to 1% serum 223 for 16 hours followed by treatment with 200 mmol/L 224 palmitate, and/or 100 ng/mL LPS. Albumin-conjugated 225 palmitate was prepared as previously described.16 226 Apoptosis was examined using terminal deoxynucleotidyl 227 transferase–mediated deoxyuridine triphosphate nick-end 228 labeling staining. Lipid accumulation was assessed by Oil 229 red O staining. The lactate dehydrogenase (LDH) release 230 method was used for cell death quantification. LDH activity 231 was measured in cell culture supernatants and compared 232 with LDH activity of cells lysed in 2% Triton X-100, as sug- 233 gested by the manufacturer (Roche Molecular Diagnostics). 234

FLA 5.4.0 DTD
JCMGH190 proof
2 February 2017
1:15 pm
ce DVC

-

235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293

2017

Role of TRIF in Mouse NASH

3

Table 1.Sequence of Primers Used for Real-Time Quantitative PCR Gene

Forward

Reverse

18s

AGTCCCTGCCCTTTGTACACA

CGATCCGAGGGCCTCACTA

TNF

AGGGTCTGGGCCATAGAACT

CCACCACGCTCTTCTGTCTAC

IL1b

GGTCAAAGGTTTGGAAGCAG

TGTGAAATGCCACCTTTTGA

Collagen a1(I)

TAGGCCATTGTGTATGCAGC

ACATGTTCAGCTTTGTGGACC

a-SMA

GTTCAGTGGTGCCTCTGTCA

ACTGGGACGACATGGAAAAG

Timp1

AGGTGGTCTCGTTGATTTCT

GTAAGGCCTGTAGCTGTGCC

CXCL1

TGCACCCAAACCGAAGTC

GTCAGAAGCCAGCGTTCACC

CCL3

GTGGAATCTTCCGGCTGTAG

ACCATGACACTCTGCAACCA

CCL5

CCACTTCTTCTCTGGGTTGG

GTGCCCACGTCAAGGAGTAT

Bambi

TGAGCAGCATCACAGTAGCA

CGCCACTCCAGCTACTTCTT

IL10

TGTCAAATTCATTCATGGCCT

ATCGATTTCTCCCCTGTGAA

DGAT2

GAAGATGTCTTGGAGGGCTG

CGCAGCGAAAACAAGAATAA

Lipid Isolation and Measurement Liver extracts were prepared by homogenization in 0.25% sucrose with 1 mmol/L EDTA and extracted as previously described.10 Triglyceride was measured with the use of Triglyceride Reagent Set (Pointe Scientific, Canton, MI). Hepatocyte triglyceride accumulation was quantified by extraction of hepatocyte lipids from cell homogenates using chloroform/methanol (2:1).

Glucose and Insulin Tolerance Tests For glucose tolerance test, the baseline glucose levels were measured using mice that had fasted for 16 hours (0 min). Then, 2 g/kg glucose was administered to the mice via intraperitoneal injection, and glucose levels were measured at 15-minute intervals over a span of 2 hours after the glucose load. For the insulin tolerance test, the baseline glucose levels were measured after 4 hours of fasting. The blood glucose concentration was monitored every 15–30 minutes for 90 minutes after 0.5 U/kg of insulin was administered via intraperitoneal injection.

Statistical Analysis Differences between the 2 groups were compared using the Mann–Whitney U test or a 2-tailed unpaired Student t test. Differences between multiple groups were compared by 1-way analysis of variance using GraphPad Prism 7 software (GraphPad Software, Inc, La Jolla, CA). P values less than .05 were considered significant.

Results Distinct Roles of BM-Derived and Resident Liver Cells in TLR4-Mediated Hepatic Steatosis, Injury, Inflammation, and Fibrosis in CDAA Diet–Fed Mice Kupffer cells, resident liver macrophages, have been suggested to be major players for TLR4-mediated hepatic steatosis and inflammation.11 We previously reported that TLR4 expressed in HSCs plays a crucial role in HSC

activation and fibrosis.14 However, the responsible liver cells and the function of TLR4 in NASH-related fibrosis have not been well documented. To explore the responsible cell types for TLR4-mediated NASH and fibrosis, BM cells from wild-type or TLR4-/- mice were transplanted into wild-type or TLR4-/- recipient mice followed by feeding them a CDAA diet for 22 weeks to induce NASH and fibrosis. First, we assessed the efficiency of the replacement of recipient Kupffer cells with donor BM cells. We transplanted BM from GFP transgenic mice and isolated the total liver nonparenchymal cell fraction. The fluorescence-activated cell sorter analysis showed that approximately 94% of F4/ 80-positive cells were replaced with GFP-expressing BM-derived cells (Figure 1A), indicating a very high efficiency of the replacement of Kupffer cells. Then, we examined the efficiency of the engraftment of BM cells using spleen cells from the same set of chimeric mice fed a CDAA diet. Spleen cells from TLR4-/- mice transplanted with wild-type BM express similar TLR4 levels to the spleen cells from whole-body wild-type mice, and the cells from wildtype mice transplanted with TLR4-/- BM showed very low levels of TLR4, indicating a high efficiency of the engraftment of donor BM (Figure 1B). The chimeric mice containing wild-type BM showed similar levels of serum alanine aminotransferase (ALT) and hepatic tumor necrosis factor (TNF) expression, whereas the chimeric mice with TLR4-/- BM showed reduced ALT and hepatic TNF levels (Figure 1C–E). This result suggests that TLR4 mediates hepatocyte death likely through Kupffer cell–derived TNF. The histologic assessment of NAFLD activity score showed that wild-type recipients of TLR4-/- BM and TLR4-/- recipients of either wild-type or TLR4-/- BM showed reduced hepatic steatosis, suggesting that TLR4 signaling in both BM-derived cells and recipient cells contribute to hepatic steatosis (Figure 1C and F). Interestingly, TLR4-/- recipients of wild-type BM and wild-type recipients of TLR4-/- BM had similar levels of inflammatory cell infiltration and hepatocyte ballooning to whole-body wild-type mice (Figure 1C and F). This suggests that either wild-type

FLA 5.4.0 DTD
JCMGH190 proof
2 February 2017
1:15 pm
ce DVC

294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352

353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411

Yang et al

Cellular and Molecular Gastroenterology and Hepatology Vol.

-,

No.

-

412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470

web 4C/FPO

4

FLA 5.4.0 DTD
JCMGH190 proof
2 February 2017
1:15 pm
ce DVC

-

471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529

2017

Role of TRIF in Mouse NASH

5

530 531 532 -/TRIF mice showed reduced hepatic steatosis compared 533 with wild-type mice (Figure 2A). Given that systemic 534 endotoxin levels are increased in human NASH,5–7 we hy- 535 pothesize that translocated LPS is a ligand for TLR4 during 536 NASH development. To clarify whether TLR4 and TRIF 537 mediate lipid accumulation in hepatocytes, we treated pri- 538 mary hepatocytes, isolated from wild-type, TRIF-/-, and 539 TLR4-/- mice, with palmitic acids and/or LPS. Palmitic acids 540 induced lipid accumulation in all primary hepatocytes from 541 wild-type, TRIF-/-, and TLR4-/- mice, whereas LPS alone did 542 not increase lipid accumulation as assessed by Oil Red O 543 TRIF Promotes Hepatosteatosis but Inhibits staining (Figure 3A). When we combined the treatment with 544 Hepatic Inflammation and Fibrosis palmitic acids and LPS, only the wild-type hepatocytes 545 TLR4-mediated responses are regulated by the showed severe lipid accumulation, whereas TRIF-/- and 546 MyD88-dependent and the TRIF-dependent pathways. Our TLR4-/- hepatocytes did not (Figure 3A). Consistent with 547 previous study showed that MyD88 is a crucial adaptor hepatocyte lipid accumulation, hepatocyte triglyceride 548 protein for the development of NASH and fibrosis, and the levels were increased significantly by co-treatment with 549 function of the TRIF pathway still is unclear in NASH palmitate and LPS in wild-type hepatocytes, and was 550 fibrosis.10 To investigate the role of TRIF in the develop- reduced in TRIF-/- as well as TLR4-/- hepatocytes 551 ment of NASH, wild-type and TRIF-/- mice were subjected (Figure 3B). To examine the molecular mechanism of he- 552 to 22 weeks of CDAA diet feeding. TRIF-/- mice showed patocyte lipid accumulation potentiated by the TLR4- 553 much less hepatic steatosis than wild-type mice TRIF–mediated pathway, we measured messenger RNA 554 (Figure 2A). To our surprise, TRIF-/- mice presented more expression of diacylglycerol acyltransferase 2 (DGAT2), an 555 inflammatory cell infiltration along with higher serum ALT enzyme that converts diglyceride to triglyceride, in hepa- 556 levels and hepatic TNF messenger RNA expression than tocytes after treatment with palmitic acids and/or LPS. 557 wild-type mice (Figure 2A–D). The expression of inter- DGAT2 was up-regulated in wild-type, but not in TRIF-/-, 558 leukin (IL)10, an anti-inflammatory cytokine, is regulated hepatocytes (Figure 3C). Consistently, increased DGAT2 559 by the TRIF-IRF3–mediated pathway.12 TRIF-/- mice levels in wild-type livers were reduced in TRIF-/- livers 560 showed significantly lower IL10 expression than wild-type (Figure 3D). These results suggest that the TLR4–TRIF 561 mice (Figure 2D). This suggests that the reduced anti- pathway potentiates free fatty acid–induced lipid accumu- 562 inflammatory IL10 may be an underlying mechanism of lation in hepatocytes, at least in part through DGAT2 563 564 exacerbated liver inflammation and injury in TRIF-/- mice. induction. 565 Consistent with severe liver injury and inflammation in -/566 TRIF mice, these mice showed significant increases in 567 The TLR4–TRIF Pathway Induces Death After the fibrillar collagen deposition, HSC activation, and expression 568 of profibrogenic genes (collagen a1[I] and a-SMA) Sensitization of Hepatocytes With Palmitic Acids We next investigated whether the TLR4–TRIF pathway is 569 compared with wild-type mice (Figure 2E–G). These results indicate that the TRIF pathway contributes to hepatic involved in hepatocyte death. To examine the setting of fatty 570 steatosis, but negatively regulates hepatic injury, inflam- liver diseases, we examined the effect of TLR4 activation on 571 mation, and fibrosis. This also suggests that TRIF-mediated hepatocyte death in lipid-accumulated hepatocytes. After 24 572 IL10 may play a role as a negative regulator of liver hours of palmitate treatment, wild-type, TRIF-/-, and TLR4-/- 573 hepatocytes stored lipid droplets (Figure 3A). Hepatocyte 574 inflammation. 575 576 577 Figure 1. (See previous page). BM-derived and resident liver cells are required for TLR4-mediated hepatic steatosis, 578 inflammation, and fibrosis in the murine NASH model induced by CDAA diet. (A) Wild-type mice were transplanted with BM from b-actin promoter-driven GFP-Tg mice after whole-body irradiation. After 2 weeks of BMT, liposomal clodronate was Q15 579 injected. After 10 weeks of BMT, liver nonparenchymal cell fraction was separated and F4/80-positive GFP-expressing cells 580 were examined by fluorescence-activated cell sorter analysis. (B–I) The TLR4 BM chimeric mice were fed the CDAA diet for 22 581 weeks. (B) The successful engraftment of donor BM cells into TLR4 BM chimeric mice was determined by TLR4 messenger 582 RNA (mRNA) expression in spleen cells. (C) Hepatic inflammation and steatosis were evaluated by H&E staining and Oil Red O 583 staining, respectively. Original magnification,
100 for H&E, and
200 for Oil Red O. (D) ALT levels. (E) Hepatic TNF mRNA 584 levels were measured by quantitative PCR. (F) NAFLD activity score. (G) Liver sections were stained with Sirius Red and used 585 for immunohistochemistry for a-SMA. Original magnification,
100 for Sirius Red staining, and
200 for a-SMA staining. (H) Quantifications of Sirius red staining. (I) Hepatic fibrogenic genes (collagen a1[I], a-SMA) were determined by quantitative real- 586 time PCR. Similar results were obtained in 2 independent experiments. A representative result is shown. *P < .05, **P < .01. 587 WT, wild type. 588 BM or wild-type recipient cells are involved in TLR4mediated liver inflammation. Next, we examined CDAA diet–induced NASH fibrosis. The TLR4 BM chimeric mouse study showed paradoxic findings of fibrosis with hepatic steatosis and injury. The chimeric mice with wild-type resident cells (including HSCs) showed a similar degree of collagen production and a-SMA expression, whereas the chimeric mice with TLR4-/- resident cells had reduced fibrosis and HSC activation (Figure 1G–I). These findings suggest that resident cells, including HSCs, are more important than BM-derived cells in the development of TLR4-mediated NASH fibrosis.

TLR4 Signaling Potentiates Palmitic Acid–Induced Hepatocyte Lipid Accumulation Through TRIF

FLA 5.4.0 DTD
JCMGH190 proof
2 February 2017
1:15 pm
ce DVC

589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647

Yang et al

Cellular and Molecular Gastroenterology and Hepatology Vol.

-,

No.

-

648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706

web 4C/FPO

6

FLA 5.4.0 DTD
JCMGH190 proof
2 February 2017
1:15 pm
ce DVC

707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765

web 4C=FPO

-

2017

Role of TRIF in Mouse NASH

7

766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 -/Figure 3. The TLR4–TRIF signaling enhances palmitate-induced fat accumulation in hepatocytes. Wild-type (WT), TRIF , 793 -/and TLR4 hepatocytes were treated with 200 mmol/L palmitate and/or 100 ng/mL LPS for 24 hours. (A) Representative pictures of Oil Red O staining. Original magnification,
400. (B) Triglyceride (TG) concentrations in hepatocytes. (C) WT and 794 TRIF-/- hepatocytes were treated with 200 mmol/L palmitate and/or 100 ng/mL LPS for 12 hours. Messenger RNA (mRNA) 795 expression of DGAT2 was determined by quantitative real-time PCR. Similar results were obtained in 2 independent experi- 796 ments. A representative result is shown. (D) WT and TRIF-/- mice were fed a choline-supplemented amino acid–defined diet 797 (CS) or CDAA (CD) diet for 22 weeks. Hepatic DGAT2 mRNA expression was determined by quantitative real-time PCR. White 798 square, wild-type mice; black square, TRIF-/- mice; gray square, TLR4-/- mice. **P < .01. CONT, ___________; PA, Q17 799 ____________. 800 801 apoptosis was assessed by terminal deoxynucleotidyl the direct effect of the TLR4-TRIF–mediated signaling in 802 transferase–mediated deoxyuridine triphosphate nick-end hepatocytes and may be mediated through increased liver 803 labeling staining and measuring LDH released into the inflammation by the augmented production of inflammatory 804 culture supernatant. In palmitate-pretreated, lipid-accumu- cytokines from liver nonparenchymal cells. 805 lated wild-type hepatocytes, hepatocyte apoptosis and LDH 806 release were increased after LPS treatment, whereas these 807 -/events were not seen in TRIF-/- and TLR4-/- lipid- CXCL1 and CCL3 Are Produced in TRIF 808 accumulated hepatocytes (Figure 4A and B), indicating Kupffer Cells, HSCs, and Hepatocytes 809 TLR4 expressed on liver resident cells, including HSCs 810 that the TLR4–TRIF pathway positively regulates hepatocyte death in lipid-accumulated hepatocytes. These results and hepatocytes, play major roles in NASH-mediated 811 were inconsistent with the finding that TRIF-/- mice showed fibrosis compared with TLR4 on BM-derived cells, such as 812 increased liver injury after CDAA diet feeding. This suggests Kupffer cells (Figure 1). We hypothesize that the distinct 813 that increased liver injury in TRIF-/- mice is not caused by manners in cytokine/chemokine production among Kupffer 814 815 816 Figure 2. (See previous page). TRIF-/- mice showed severe inflammation and fibrosis but less steatosis in the murine Q22 817 NASH model induced by the CDAA diet. Wild-type (WT) and TRIF-/- mice were fed a choline-supplemented amino acid– 818 defined diet (CS) or CDAA (CD) diet for 22 weeks. (A) Liver sections were stained with H&E and Oil Red O. Original 819 magnification,
200 for H&E and Oil Red O staining. (B) Serum ALT levels. (C) NAFLD activity score. (D) Hepatic messenger Q16 820 RNA (mRNA) (TNF, IL10) expression was determined by quantitative real-time PCR. (E) Liver sections were stained with Sirius 821 Red and used for immunohistochemistry for a-SMA. Original magnification,
100 for Sirius Red staining, and
200 for a-SMA staining. (F) Quantification of Sirius Red staining. (G) Hepatic fibrogenic genes (collagen a1[I], a-SMA) were determined by 822 quantitative real-time PCR. White square, wild-type mice; black square, TRIF-/- mice. Similar results were obtained in 2 823 independent experiments. A representative result is shown. *P < .05, **P < .01. 824

FLA 5.4.0 DTD
JCMGH190 proof
2 February 2017
1:15 pm
ce DVC

825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883

web 4C=FPO

8

Yang et al

Cellular and Molecular Gastroenterology and Hepatology Vol.

-,

No.

-

884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 Figure 4. The TLR4–TRIF signaling promotes hepatocyte apoptosis in fat-accumulated hepatocytes. Primary hepato- 915 cytes were isolated from wild-type (WT), TRIF-/-, and TLR4-/- mice. Cells were treated with 200 mmol/L palmitate for 24 hours to 916 create fat-accumulated hepatocytes. Then, cells were treated with 100 ng/mL LPS for an additional 24 hours. (A) Repre- 917 sentative pictures of terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick-end labeling (TUNEL) 918 staining and (B) quantifications. Original magnification,
400. (C) Concentrations of LDH released to supernatants were 919 measured. Similar results were obtained in 2 independent experiments. A representative result is shown. White square, -/-/wild-type mice; black square, TRIF mice; gray square, TLR4 mice. *P < .05; **P < .01. CONT, ___________; HPF, Q18 920 921 high-power field; PA, ____________. 922 923 cells, HSCs, and hepatocytes may be the underlying up-regulated and showed higher production in TRIF-/- HSCs 924 mechanisms of increased liver inflammation in TRIF-/- mice. than wild-type HSCs (Figure 5C). Surprisingly, CXCL1, CCL3, 925 In immune cells, including macrophages, CXCL1 and CCL3 and CCL5 production were inhibited in MyD88-/- HSCs 926 production is dependent on MyD88, whereas CCL5 and IL10 (Figure 5D). We previously showed that HSC activation and 927 production are mediated through the TRIF-IRF3–dependent Bambi down-regulation requires MyD88.14 Expectedly, TRIF 928 pathway.12,17 We examined the role of TRIF in TLR4- deficiency did not prevent Bambi down-regulation and 929 mediated cytokine induction in Kupffer cells. Consistent Timp-1 up-regulation (Figure 5C). These results suggest that 930 with previous studies examining macrophages,17 TRIF-/- TRIF does not play a major role in TLR4-mediated signaling 931 Kupffer cells produced CXCL1 and CCL3 at similar levels to in HSCs and that TRIF may have an inhibitory effect on the 932 wild-type cells, whereas TRIF deficiency decreased the MyD88-dependent pathway in HSCs. We previously re- 933 LPS-induced production of CCL5 and IL10 in Kupffer cells ported that hepatocytes produce neutrophil-recruiting 934 (Figure 5A). In contrast, LPS stimulation induced CCL5 chemokines, such as CXCL1, in response to TLR ligands.18 935 production but did not increase CXCL1 and CCL3 expression In wild-type hepatocytes, LPS treatment increased the pro- 936 in MyD88-/- Kupffer cells (Figure 5B). This finding indicates duction of CXCL1 and CCL3. The increases in CXCL1 and 937 that TRIF-/- Kupffer cells have the capacity to produce CCL3 were prevented by MyD88 deficiency, but not by TRIF 938 CXCL1 and CCL3 upon TLR4 activation. Interestingly, TRIF-/- deficiency (Figure 5E and F). These results show that CXCL1 939 HSCs produced higher levels of CXCL1 and CCL3 than wild- and CCL3 production is not abolished by TRIF deficiency in 940 type HSCs (Figure 5C). CCL5 that usually is regulated all cell types and that TRIF-/- HSCs produce higher CXCL1, 941 through the TRIF-dependent pathway in immune cells, was CCL3, and CCL5 than the wild-type HSCs; these data 942

FLA 5.4.0 DTD
JCMGH190 proof
2 February 2017
1:15 pm
ce DVC

-

web 4C=FPO

943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001

2017

Role of TRIF in Mouse NASH

9

1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 Figure 5. CXCL1 and CCL3 are produced independently of TRIF in Kupffer cells, HSCs, and hepatocytes. (A and B) 1054 Primary Kupffer cells, (C and D) HSCs, and (E and F) hepatocytes were isolated from wild-type (WT) mice, (A, C, and E) TRIF-/1055 mice, and (B, D, and F) MyD88-/- mice. Cells then were treated with LPS for 6 hours. Messenger RNA (mRNA) expression of Q19 CXCL1, CCL5, CCL3, IL10, Bambi, and Timp-1 was determined by quantitative real-time PCR. Similar results were obtained in 1056 3 independent experiments. A representative result is shown. White square, wild-type mice; black square, TRIF-/- mice; gray 1057 Q20 1058 square, MyD88-/- mice. *P < .05, **P < .01. CONT, ____________; NS, not significant. 1059 1060

FLA 5.4.0 DTD
JCMGH190 proof
2 February 2017
1:15 pm
ce DVC

10

Cellular and Molecular Gastroenterology and Hepatology Vol.

further suggest that CXCL1, CCL3, and higher production of chemokines in HSCs may contribute to promoting liver inflammation in CDAA diet–fed TRIF-/- mice.

Increased Infiltration of Neutrophils and Macrophages in TRIF-/- Mice With NAFLD Based on the in vitro findings (Figure 5), we hypothesize that increased chemokine production from HSCs and MyD88-independent chemokine production in Kupffer cells and hepatocytes are major mechanisms of the overt inflammation and fibrosis by recruiting neutrophils and macrophages in CDAA diet–fed TRIF-/- mice. Because CXCL1 is a potent neutrophil-attracting chemokine and CCL3 enables recruitment of monocytes/macrophages,19,20 we examined hepatic CXCL1 and CCL3 expression and infiltration of neutrophils and macrophages in wild-type and TRIF-/- mice after 22 weeks of CDAA diet feeding. CXCL1 expression and neutrophil infiltration were exacerbated in TRIF-/- mice compared with wild-type mice (Figure 6A and B).

-,

No.

-

In addition, increased hepatic CCL3 expression and macrophage infiltration also were observed in TRIF-/- mice (Figure 6C and D). These results suggest that increased hepatic CXCL1 and CCL3 expression promotes neutrophil recruitment and macrophage infiltration, respectively, which augments liver inflammation and injury in TRIF-/mice.

Insulin Resistance Is Associated With the Degree of Hepatic Steatosis and Body Weight CDAA diet–fed TRIF-/- mice showed paradoxic results in regard to hepatic steatosis and injury/inflammation/fibrosis (Figure 2). A number of human studies have suggested that the severity of liver inflammation is associated with insulin resistance in NASH patients.21,22 To investigate whether liver inflammation and fibrosis are involved in insulin resistance, glucose and insulin tolerance tests were examined in CDAA diet–fed wild-type and TRIF-/- mice. Both glucose and insulin tolerance tests showed that insulin

web 4C=FPO

1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119

Yang et al

Figure 6. Increased CXCL1 and CCL3 levels accompanied by increased infiltration of neutrophils and macrophages in TRIF-/- mice. Wild-type (WT) and TRIF-/- mice were fed a choline-supplemented amino acid–defined diet (CS) or CDAA (CD) diet for 22 weeks. (A) Hepatic CXCL1 messenger RNA (mRNA) expression was determined by quantitative real-time PCR. (B) Liver sections were used for immunofluorescence for Ly6G and their quantifications. Original magnification,
200. (C) Hepatic CCL3 mRNA expression was determined by quantitative real-time PCR. (D) Liver sections were used for immunohistochemistry for F4/80 and their quantifications. Original magnification,
200. White square, wild-type mice; black square, TRIF-/mice. *P < .05, **P < .01.

FLA 5.4.0 DTD
JCMGH190 proof
2 February 2017
1:15 pm
ce DVC

1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178

-

web 4C=FPO

1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237

2017

Role of TRIF in Mouse NASH

sensitivity was improved in TRIF-/- mice compared with wild-type mice (Figure 7A and B). On the CDAA diet, the body and liver weight were slightly, but significantly, lower in TRIF-/- mice compared with wild-type mice (Figure 7C and D). These results suggest that hepatic steatosis and/or body weight (adipose tissue mass) are associated with insulin resistance, whereas hepatocyte injury, inflammation, and fibrosis are less likely to be involved in insulin resistance. This indicates a dissociation between insulin resistance and liver inflammation.

Discussion The contributions of TLR4 signaling and its activation by translocated gut-derived LPS to chronic liver diseases, including alcoholic liver disease, NAFLD, cirrhosis, and liver cancer, have been well established.8,23 Kupffer cells are believed to play crucial roles in TLR4-mediated alcoholic steatohepatitis and NASH development.11 Although we previously described the function of TLR4 in HSC activation and liver fibrosis,14 the importance of HSCs in TLR4mediated NASH development is poorly understood. The present study attempted to answer this question by using TLR4 wild-type and TLR4-/- BM chimeric mice. TLR4 uses both MyD88-dependent and TRIF-dependent pathways to induce TLR4’s biological responses. The importance of MyD88 is well accepted in NASH development, whereas TRIF-dependent IRF3 activation plays important roles in the development of alcoholic liver disease.10,12 The present

11

study investigated the contribution of the TLR4–TRIF pathway to NASH development. We showed the distinct function between BM-derived cells and resident liver cells, including hepatocytes and HSCs in TLR4-mediated steatosis, hepatocyte death, inflammation, and fibrosis. Because Kupffer cells are radioresistant cells, a standard method of generating BM chimeric mice replaces approximately 70% of Kupffer cells with BMderived cells. However, 30% of recipient-derived Kupffer cells may be enough to contribute to liver disease progression, which often leads to the misinterpretation of the results. The yield of Kupffer cell replacement with BM cells using our technology, which performs irradiation and BM transplantation in combination with Kupffer cell depletion, is approximately 95%.24 Although Kupffer cell–specific Cre transgenic mice targeting Clec4f were reported recently,25 our method still is one of the best models to study the distinct functions of Kupffer cells and HSCs. In conjunction with the data from TLR4 BM chimeric mice, TRIF-/- mice, and a series of in vitro experiments, our study suggests several interesting mechanisms. The TLR4 BM chimeric mouse experiment suggests that both BM-derived cells and resident cells are required for hepatosteatosis (Figure 1). TRIF-/- deficiency led to reducing lipid accumulation in hepatocytes, which is at least in part mediated through DGAT2 (Figures 2 and 3). It suggests that the TLR4–TRIF pathway in hepatocytes is required for lipid accumulation and that additional Kupffer cell–derived factors enhance hepatosteatosis. In terms of hepatocyte

Figure 7. TRIF signaling is associated with systemic insulin resistance in mice. (A) A glucose tolerance test (GTT) and (B) an insulin tolerance test (ITT) were performed on the wild-type (WT) and TRIF-/- mice fed with 22 weeks of the CDAA diet. Data represent means ± SEM; n ¼ 8 for each group. (C and D) Body weight and liver weight are shown. *P < .05; **P < .01.

FLA 5.4.0 DTD
JCMGH190 proof
2 February 2017
1:15 pm
ce DVC

1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296

12

web 4C=FPO

1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355

Yang et al

Cellular and Molecular Gastroenterology and Hepatology Vol.

damage, the TLR4 BM chimeric mouse study (Figure 1) suggests that TLR4 mediates hepatocyte damage through Kupffer cell–derived TNF. Although LPS-mediated hepatocyte death was decreased by TLR4 and TRIF deficiency (Figure 3), TRIF-/- mice showed increased ALT levels along with increased hepatic TNF levels (Figure 3). It appears that TLR4 on immune cells, but not hepatocytes, contribute to hepatocyte death indirectly, most likely through TNF production. The assessment of the NAFLD activity score using H&E staining showed similar levels of inflammatory cell infiltration in TLR4-/- recipients of wild-type bone marrow and wild-type recipients of TLR4-/- bone marrow

-,

No.

-

(Figure 1C and F). It is conceivable that either wild-type BM or wild-type recipient cells are involved in TLR4-mediated liver inflammation. In wild-type recipients of TLR4-/- BM, cytokines/chemokines produced from wild-type recipient cells, including HSCs and hepatocytes, might affect activation of TLR4-/- BM-derived immune cells, which play a role in liver inflammation. It also is possible that increased numbers of HSCs in wild-type recipients of TLR4-/- bone marrow have been determined as infiltrated inflammatory cells through H&E staining. Compared with the high-fat diet–induced fatty liver model, the CDAA diet model recapitulated human NASH

Figure 8. TRIF- and MyD88-dependent pathways control liver inflammation and fibrosis in NASH. High nutrient, cholinedeficient, or obese conditions affect the composition and the amount of intestinal bacteria. In the mouse NASH model, translocated LPS stimulates TLR4 on Kupffer cells, HSCs, and hepatocytes. (A) Activated TLR4 subsequently activates MyD88-dependent and TRIF-dependent pathways. Through the MyD88-dependent pathway, Kupffer cells produce CCL3 and CXCL1, and through the TRIF-dependent pathway Kupffer cells produce CCL5 and IL10. In hepatocytes, CCL3 and CXCL1 production is MyD88-dependent whereas CCL5 induction is TRIF-dependent. In contrast, all CCL3, CCL5, and CXCL1 induction is mediated through MyD88 in HSCs. TRIF might be involved in negative regulation of MyD88-dependent chemokine induction. Bambi down-regulation is MyD88-dependent. (B) In TRIF-/- conditions, Kupffer cells and hepatocytes can produce CCL3 and CXCL1, and HSCs produce higher levels of CCL3, CCL5, and CXCL1 and preserve the capacity to down-regulate Bambi. Because TRIF-/- Kupffer cells do not produce IL10, hepatic inflammatory and fibrogenic responses are exacerbated. (C) In MyD88-/- conditions, Kupffer cells, HSCs, and hepatocytes do not produce CXCL1 and CCL3. Bambi down-regulation does not occur in MyD88-/- HSCs. Thus, hepatic inflammatory and fibrogenic responses are reduced.

FLA 5.4.0 DTD
JCMGH190 proof
2 February 2017
1:15 pm
ce DVC

1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414

-

1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473

2017

Role of TRIF in Mouse NASH

pathology well because it induces inflammatory cell infiltration, HSC activation, and fibrosis in addition to hepatosteatosis.10 Thus, the CDAA diet model is one of the suitable models for studying NASH and its related HSC activation and fibrosis. The TLR4 BM chimeric mouse study showed that TLR4 expressed on the recipient cells including HSCs is required for NASH fibrosis, suggesting that TLR4 signaling directly contributes to HSC activation, which corroborates our previous study showing HSCs as the crucial target for TLR4-mediated fibrosis.14 Interestingly, TRIF-/- mice showed augmented liver fibrosis (Figure 2). This may be because the TLR4-mediated fibrogenic response, such as the up-regulation of Timp-1 and the down-regulation of Bambi, is not inhibited in TRIF-/- HSCs.14 Notably, HSCs produce much higher levels of CXCL1, CCL3, and CCL5 (Figures 5 and 8). Although CCL5 is produced through the TRIF-dependent pathway in immune cells, including Kupffer cells, TRIF-/- HSCs have a higher capacity to produce CCL5 than wild-type HSCs (Figures 5 and 8). The previous study showed that TRIF in osteoblasts and osteoclasts do not play a role and showed MyD88 as the only adaptor molecule that controls TLR4-mediated pathophysiological roles in those cells.26 It is conceivable that as the adaptor protein only MyD88, but not TRIF, is required for TLR4 signaling in HSCs (Figure 8). Given that TRIF-/- HSCs produce higher CXCL1, CCL3, and CCL5 (Figure 5), TRIF may negatively regulate the TLR4-MyD88–dependent pathway by unidentified mechanisms. In the present study, TRIF-/- mice showed overt liver inflammation induced by the CDAA diet compared with wild-type mice. It is possible that reduced IL10 production in TRIF-/- mice is one of the underlying mechanisms of exacerbated liver inflammation and injury because IL10 is a powerful anti-inflammatory cytokine that counterbalances overt inflammatory responses (Figure 8). Moreover, it has been reported that IL10-/- mice had increased liver inflammation but reduced steatosis after alcohol or HFD feeding, which corroborates with the liver finding (increased liver inflammation but reduced steatosis) in TRIF-/- mice.27 It also is possible that higher levels of CXCL1, CCL3, and CCL5 produced by TRIF-/- HSCs may be a mechanism of increased liver inflammation in TRIF-/- mice. Our findings corroborate a recent study that showed hepatocytes or HSC-derived CXCL1 as crucial for recruiting neutrophils in liver diseases.18,19,28 Although CCL5 production is decreased in TRIF-/- Kupffer cells and hepatocytes, these cells can produce similar levels of CXCL1 and CCL3 compared with wildtype cells. Thus, it is conceivable that increased production of CXCL1 and CCL3 recruit neutrophils and macrophages, respectively, which exacerbates liver inflammation in TRIF-/- mice (Figures 6 and 8). CCL5 produced from HSCs also can participate in immune cell recruitment. The present study showed an interesting finding related to TRIF-/- mice possessing more liver inflammation but less insulin resistance. Although there is a strong association between NASH degree and insulin resistance in human studies,21,22 our results suggest a dissociation between liver inflammation and insulin resistance. However, it is a noteworthy fact that there is an association of hepatic

13

steatosis and adipose tissue mass with insulin resistance because TRIF-/- mice showed reduced hepatosteatosis and body weight compared with wild-type mice. Another potential mechanism of the exacerbated liver inflammation and HSC activation in TRIF-/- mice may be mediated through the TLR3–TRIF pathway. TLR3 uses only the TRIF-dependent pathway. TLR3-mediated natural killer cell activation is a negative regulating mechanism of liver fibrosis by killing HSCs.29 It is suggested that increased HSC activation in TRIF-/- mice may be mediated through the reduction of TLR3-TRIF–dependent natural killer cell killing of activated HSCs. The role of TLR3 in the development of HFD-induced obesity and insulin resistance is controversial,30,31 suggesting the TLR4–TRIF pathway is a more consistent pathway for developing insulin resistance than is the TLR3–TRIF pathway. In summary, the present study showed that TLR4 and TRIF play distinct roles in different liver cells in NASH and its related fibrosis. TLR4 and TRIF promote hepatic steatosis. TLR4 directly acts on BM-derived immune cells and HSCs to promote liver inflammation and fibrosis whereas TRIF may have an inhibitory function in liver inflammation and fibrosis through the production of IL10. In addition, TRIF-independent production of CXCL1, CCL3, and CCL5 may contribute to enhanced liver inflammation and fibrosis in TRIF-/- mice (Figure 8). Moreover, we showed that hepatic steatosis and adipose tissue mass, but not hepatic inflammation and fibrosis, are associated with insulin resistance in the NASH mouse model. We suggest that a better understanding of the TLR4-TRIF–mediated pathophysiology in the liver is important for developing better management of fatty liver diseases.

References 1. Day CP. Non-alcoholic fatty liver disease: a massive problem. Clin Med (Lond) 2011;11:176–178. 2. Kneeman JM, Misdraji J, Corey KE. Secondary causes of nonalcoholic fatty liver disease. Therap Adv Gastroenterol 2012;5:199–207. 3. Sanyal AJ, Brunt EM, Kleiner DE, et al. Endpoints and clinical trial design for nonalcoholic steatohepatitis. Hepatology 2011;54:344–353. 4. Tiniakos DG, Vos MB, Brunt EM. Nonalcoholic fatty liver disease: pathology and pathogenesis. Annu Rev Pathol 2010;5:145–171. 5. Schnabl B, Brenner DA. Interactions between the intestinal microbiome and liver diseases. Gastroenterology 2014;146:1513–1524. 6. Alisi A, Manco M, Devito R, et al. Endotoxin and plasminogen activator inhibitor-1 serum levels associated with nonalcoholic steatohepatitis in children. J Pediatr Gastroenterol Nutr 2010;50:645–649. 7. Farhadi A, Gundlapalli S, Shaikh M, et al. Susceptibility to gut leakiness: a possible mechanism for endotoxaemia in non-alcoholic steatohepatitis. Liver Int 2008; 28:1026–1033. 8. Petrasek J, Csak T, Szabo G. Toll-like receptors in liver disease. Adv Clin Chem 2013;59:155–201.

FLA 5.4.0 DTD
JCMGH190 proof
2 February 2017
1:15 pm
ce DVC

1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 1520 1521 1522 1523 1524 1525 1526 1527 1528 1529 1530 1531 1532

14

1533 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560 1561 1562 1563 1564 1565 1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578 1579 1580 1581 1582 1583 1584 1585 1586 1587 1588 1589 1590 1591

Yang et al

Cellular and Molecular Gastroenterology and Hepatology Vol.

9. Csak T, Velayudham A, Hritz I, et al. Deficiency in myeloid differentiation factor-2 and toll-like receptor 4 expression attenuates nonalcoholic steatohepatitis and fibrosis in mice. Am J Physiol Gastrointest Liver Physiol 2011; 300:G433–G441. 10. Miura K, Kodama Y, Inokuchi S, et al. Toll-like receptor 9 promotes steatohepatitis by induction of interleukin1beta in mice. Gastroenterology 2010;139:323–334 e7. 11. Rivera CA, Adegboyega P, van Rooijen N, et al. Toll-like receptor-4 signaling and Kupffer cells play pivotal roles in the pathogenesis of non-alcoholic steatohepatitis. J Hepatol 2007;47:571–579. 12. Petrasek J, Dolganiuc A, Csak T, et al. Interferon regulatory factor 3 and type I interferons are protective in alcoholic liver injury in mice by way of crosstalk of parenchymal and myeloid cells. Hepatology 2011; 53:649–660. 13. Wang XA, Zhang R, She ZG, et al. Interferon regulatory factor 3 constrains IKKbeta/NF-kappaB signaling to alleviate hepatic steatosis and insulin resistance. Hepatology 2014;59:870–885. 14. Seki E, De Minicis S, Osterreicher CH, et al. TLR4 enhances TGF-beta signaling and hepatic fibrosis. Nat Med 2007;13:1324–1332. 15. Seki E, Tsutsui H, Nakano H, et al. Lipopolysaccharideinduced IL-18 secretion from murine Kupffer cells independently of myeloid differentiation factor 88 that is critically involved in induction of production of IL-12 and IL-1beta. J Immunol 2001;166:2651–2657. 16. Miura K, Yang L, van Rooijen N, et al. Toll-like receptor 2 and palmitic acid cooperatively contribute to the development of nonalcoholic steatohepatitis through inflammasome activation in mice. Hepatology 2013; 57:577–589. 17. Hirotani T, Yamamoto M, Kumagai Y, et al. Regulation of lipopolysaccharide-inducible genes by MyD88 and Toll/ IL-1 domain containing adaptor inducing IFN-beta. Biochem Biophys Res Commun 2005;328:383–392. 18. Roh YS, Zhang B, Loomba R, et al. TLR2 and TLR9 contribute to alcohol-mediated liver injury through induction of CXCL1 and neutrophil infiltration. Am J Physiol Gastrointest Liver Physiol 2015;309:G30–G41. 19. Bigorgne AE, John B, Ebrahimkhani MR, et al. TLR4dependent secretion by hepatic stellate cells of the neutrophil-chemoattractant CXCL1 mediates liver response to gut microbiota. PLoS One 2016; 11:e0151063. 20. Seki E, De Minicis S, Gwak GY, et al. CCR1 and CCR5 promote hepatic fibrosis in mice. J Clin Invest 2009; 119:1858–1870. 21. Loomba R, Abraham M, Unalp A, et al. Association between diabetes, family history of diabetes, and risk of nonalcoholic steatohepatitis and fibrosis. Hepatology 2012;56:943–951. 22. Choudhury J, Sanyal AJ. Insulin resistance and the pathogenesis of nonalcoholic fatty liver disease. Clin Liver Dis 2004;8:575–594, ix. 23. Seki E, Schwabe RF. Hepatic inflammation and fibrosis: functional links and key pathways. Hepatology 2015; 61:1066–1079.

-,

No.

-

1592 1593 1594 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620 1621 1622 1623 1624 1625 1626 1627 Received September 29, 2016. Accepted December 25, 2016. 1628 Correspondence 1629 Address correspondence to: Ekihiro Seki, MD, PhD, Division of Q1 1630 Gastroenterology, Department of Medicine, Cedars-Sinai Medical Center, 8700 Beverly Boulevard, DAVIS, Suite 2099, Los Angeles, California 90048. Q2 1631 e-mail: [email protected]; fax: (310) 423-0157. 1632 Acknowledgments 1633 The authors thank Ms Daisy Gomez (Department of Medicine, Cedars-Sinai 1634 Medical Center, Los Angeles, CA) for editing the manuscript. 1635 Ling Yang was responsible for the study concept and design, acquisition of data, analysis and interpretation of data, and drafting of the manuscript; 1636 Kouichi Miura was responsible for the study concept and design, acquisition 1637 of data, analysis and interpretation of data, and critical revision of the manuscript for important intellectual content; Bi Zhang was responsible for 1638 the study design, acquisition of data, and analysis and interpretation of data; 1639 Hiroshi Matsushita, Yoon Mee Yang, Shuang Liang, Jingyi Song, and Yoon Seok Roh were responsible for the acquisition and analysis of data; Ekihiro 1640 Seki was responsible for study supervision, the study concept and design, 1641 analysis and interpretation of data, writing of the manuscript, statistical analysis, and obtained funding. 1642 1643 Conflicts of interest Q3 1644 The authors disclose no conflicts. 1645 Funding 1646 This study was supported by National Institutes of Health grants R01AA02172, R01DK085252, and P42 ES010337 (E.S.); the American Liver Foundation Irwin 1647 M. Arias, MD, Postdoctoral Research Fellowship (Y.M.Y.); the American Liver 1648 Foundation Congressman John Joseph Moakley Postdoctoral Research Fellowship (Y.S.R.); and National Natural Science Foundation of China grants 1649 Q4 81370550, 81570530, and 30500658 (L.Y.). 1650 24. Inokuchi S, Tsukamoto H, Park E, et al. Toll-like receptor 4 mediates alcohol-induced steatohepatitis through bone marrow-derived and endogenous liver cells in mice. Alcohol Clin Exp Res 2011; 35:1509–1518. 25. Scott CL, Zheng F, De Baetselier P, et al. Bone marrow-derived monocytes give rise to self-renewing and fully differentiated Kupffer cells. Nat Commun 2016;7:10321. 26. Sato N, Takahashi N, Suda K, et al. MyD88 but not TRIF is essential for osteoclastogenesis induced by lipopolysaccharide, diacyl lipopeptide, and IL-1alpha. J Exp Med 2004;200:601–611. 27. Miller AM, Wang H, Bertola A, et al. Inflammationassociated interleukin-6/signal transducer and activator of transcription 3 activation ameliorates alcoholic and nonalcoholic fatty liver diseases in interleukin10-deficient mice. Hepatology 2011;54:846–856. 28. Chang B, Xu MJ, Zhou Z, et al. Short- or long-term high-fat diet feeding plus acute ethanol binge synergistically induce acute liver injury in mice: an important role for CXCL1. Hepatology 2015;62:1070–1085. 29. Jeong WI, Park O, Radaeva S, et al. STAT1 inhibits liver fibrosis in mice by inhibiting stellate cell proliferation and stimulating NK cell cytotoxicity. Hepatology 2006; 44:1441–1451. 30. Wu LH, Huang CC, Adhikarakunnathu S, et al. Loss of toll-like receptor 3 function improves glucose tolerance and reduces liver steatosis in obese mice. Metabolism 2012;61:1633–1645. 31. Ballak DB, van Asseldonk EJ, van Diepen JA, et al. TLR-3 is present in human adipocytes, but its signalling is not required for obesity-induced inflammation in adipose tissue in vivo. PLoS One 2015; 10:e0123152.

FLA 5.4.0 DTD
JCMGH190 proof
2 February 2017
1:15 pm
ce DVC