Triose phosphate isomerase from the blood fluke Schistosoma mansoni: Biochemical characterisation of a potential drug and vaccine target

FEBS Letters 587 (2013) 3422–3427

journal homepage: www.FEBSLetters.org

Triose phosphate isomerase from the blood fluke Schistosoma mansoni: Biochemical characterisation of a potential drug and vaccine target Veronika L. Zinsser a, Edward Farnell b, David W. Dunne b, David J. Timson a,⇑ a b

School of Biological Sciences, Queen’s University Belfast, Medical Biology Centre, 97 Lisburn Road, Belfast BT9 7BL, UK Department of Pathology, University of Cambridge, Cambridge CB2 1QP, UK

a r t i c l e

i n f o

Article history: Received 13 August 2013 Revised 4 September 2013 Accepted 11 September 2013 Available online 23 September 2013 Edited by Judit Ovádi Keywords: Schistosomiasis Bilharzia Blood fluke Vaccine target Glycolytic enzyme

a b s t r a c t The glycolytic enzyme triose phosphate isomerase from Schistosoma mansoni is a potential target for drugs and vaccines. Molecular modelling of the enzyme predicted that a Ser-Ala-Asp motif which is believed to be a helminth-specific epitope is exposed. The enzyme is dimeric (as judged by gel filtration and cross-linking), resistant to proteolysis and highly stable to thermal denaturation (melting temperature of 82.0 °C). The steady-state kinetic parameters are high (Km for dihydroxyacetone phosphate is 0.51 mM; Km for glyceraldehyde 3-phosphate is 1.1 mM; kcat for dihydroxyacetone phosphate is 7800 s1 and kcat for glyceraldehyde 3-phosphate is 6.9 s1). Structured summary of protein interactions: SmTPI and SmTPI bind by cross-linking study (View interaction) SmTPI and SmTPI bind by molecular sieving (View interaction) Ó 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

1. Introduction Schistosomiasis (bilharzia) is a neglected tropical disease which affects more than 200 million humans, primarily in the developing world [1]. It results from infection by parasitic worms from the genus Schistosoma. Current control relies largely on the anthelminthic drug praziquantel (PZQ). In some countries with high rates of infection, mass drug administration schemes are being applied to populations to reduce overall levels of infection and transmission [2]. There have been several reports of reduced efficacy of this drug and resistance can be induced in experimentally infected animals treated with PZQ, although both of these effects are species dependant [3,4]. While resistance is not currently considered a major threat, the emergence of resistance to the drugs of choice in other parasitic infections (e.g., of Fasciola spp. towards triclabendazole) suggest that, in time, selective pressures will result in the emergence of clinically significant resistance. Furthermore, whilst treatment with PZQ is effective in controlling morbidity and transmission, total elimination from an individual is rare due to lower susceptibility to PZQ in developing schistosomes (somules) [3]. Consequently, considerable efforts are being made to identify vaccines and new drugs to combat the disease. ⇑ Corresponding author. Fax: +44 (0)28 9097 5877. E-mail address: [email protected] (D.J. Timson).

In recent years, there has been renewed interest in targeting metabolic enzymes in the treatment of infectious diseases [5]. Although the high levels of sequence and structural similarity between the host and pathogen enzymes make the design of specific inhibitors challenging, the essential nature of key metabolic enzymes means that their inhibition will be highly detrimental to the pathogen. A key enzyme in glycolysis is triose phosphate isomerase EC 5.3.1.1; TPI). The splitting of fructose 1,6-bisphosphate results in two three carbon monophosphorylated carbohydrates, glyceraldehyde 3-phosphate and dihydroxyacetone phosphate. While glyceraldehyde 3-phosphate can proceed in the glycolytic pathway, dihydroxyacetone phosphate cannot. TPI catalyses the conversion of dihydroxyacetone phosphate into glyceraldehyde 3-phosphate, thus enabling these three carbon atoms to be processed in the glycolytic pathway. Without this reaction, there would be no net production of ATP by glycolysis and, thus, for many organisms no means of synthesising ATP under anaerobic conditions. In humans hereditary deficiency of TPI can result in disease [6,7]. The pathology of disease arises largely from misfolding of the enzyme or its failure to dimerise and consequent loss of enzymatic activity [8–10]. The main, detrimental effect on the cell is the build-up of dihydroxyacetone phosphate, which appears to be toxic when present in higher than normal concentrations [11,12]. Inhibition of TPI with b-carbolines causes similar outcomes to TPI deficiency [13]. Thus, it seems likely that selective

0014-5793/$36.00 Ó 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.febslet.2013.09.022

V.L. Zinsser et al. / FEBS Letters 587 (2013) 3422–3427

inhibition of pathogen TPI would result in similar problems for the organism and thus represents a potential therapeutic strategy. There is also considerable interest in TPI from Schistosoma species as a vaccine target [14–17]. Interestingly, this glycolytic enzyme is not only found in the cytoplasm of cells; it is also secreted [18–20]. Its role as a secreted protein is unclear, although in some pathogenic microbes it has a role in the recognition of cell surface and extracellular matrix glycoproteins [21–24]. Experimental trials are encouraging, with vaccination of several different experimental animals against Schistosoma TPI reducing the level and duration of infection [25–30]. This approach has also been adopted in other parasites. Monoclonal antibodies raised against TPI have been shown to reduce the growth of the protozoan Trypanosoma cruzi, the tick Rhipicephalus (Boophilus) microplus and the tapeworm Taenia solium [31–33]. This strengthens the argument that TPI is a potential vaccine target in a variety of pathogens. To advance work in drug and vaccine discovery, fundamental biochemical information on the enzyme is desirable. Here, we report the biochemical characterisation of TPI from Schistosoma mansoni. 2. Materials and methods 2.1. Expression and purification of SmTPI Total RNA was extracted from the cercariae of a Puerto Rican strain of S. mansoni as previously described [34]. cDNA was produced using Superscript II RT (Life Technologies) and random hexamers (Promega, UK) from 1 lg total RNA according to the manufacturer’s instructions. SmTPI (GeneDB accession Smp_003990) was amplified using PCR to generate full length CDS with restriction sites (Primer 1 TATCTAGAGATGTCTGGATCTCGC (XbaI); Primer 2 ATCTCGAGTCAACGTTGTCTGG (XhoI)). PCR produced a product of 780 bp (Supplementary Fig. S1) which matched the size of the predicted gene model Smp_003990. The SmTPI amplicon was cloned into the pGEX GST fusion protein bacterial expression system. Expression of proteins alongside a GST fusion partner has been demonstrated to increase solubility of co-expressed fusion partners and the high affinity of GST for glutathione Sepharose allows stringent washing with high salt and detergent to remove contaminating bacterial proteins [35]. For these reasons it is routinely used over other commonly used expression systems for the production of enzymes and proteins for serological studies [36,37]. Subsequent restriction digestion of the vector-insert construct with XbaI and XhoI revealed successful insertion of the 780 bp PCR product (Fig. S1). Sequencing of the construct showed that the sequence of SmTPI was identical to that of the gene model Smp_003990 except for a synonymous mutation (C ? T) at position 495 (Fig. S2A), which did not result in modification of the translated protein sequence (Fig. S2B). pGEX-KG-SmTPI constructs were transformed into TG2 Escherichia coli cells for GST-fusion protein expression. Expression and purification were performed as previously described [37]. Briefly, cultures of transformed E. coli (4 l) were produced and fusion protein production induced at an OD600 of 0.4–0.8 for 3 h with 1 mM IPTG at 37 °C. Cells were lysed by three passages through a French press cell at 10 000 psi and fusion protein isolated from lysates using an AKTAprime with a Glutathione Sepharose 4B (GS4B; 5 ml) column (GE Healthcare). Eluted proteins were reattached to GS4B and washed with PBS plus 1% (v/v) Triton X-100 (pH 7.4) and PBS plus 1 M NaCl (pH 7.4). SmTPI was separated from the GST fusion partner by on column digestion with 30 U/mg fusion protein thrombin (GE healthcare) in either PBS or PBS plus 0.1% (v/v) Tween 20. Free GST and thrombin were removed from the final preparation by incubation at 4 °C for 30 min with 10% (v/v) GS4B and 1 ll/U thrombin p-aminobenzamidine agarose (Sigma), respectively.

3423

2.2. Molecular modelling The sequence of SmTPI (XP_002571861) was submitted to the Phyre2 protein modelling server (www.sbg.bio.ic.ac.uk/phyre2/) using the intensive mode [38]. Two copies of the resulting, monomeric model were aligned with the two subunits in human TPI (PDB: 2JK2 [39]) and combined into a single pdb file. This structure was solvated and energy minimised using YASARA (www.yasara. org/minimizationserver.htm) [40]. 2.3. Analytical methods Crosslinking was carried out using bis(sulphosuccinimidyl) suberate (BS3) [41] and limited proteolysis with chymotrypsin and subtilisin as previously described [42]. Protein melting temperatures were determined by thermal scanning fluorimetry (TSF) [43] as previously described [42]. Analytical gel filtration was carried out using a Sephacryl 300 (Sigma) column of total volume (Vt) 49.5 ml, equilibrated in buffer G (50 mM Tris–HCl, 17 mM Tris-base, 150 mM sodium chloride, pH 7.4 [44]). Proteins were applied (volumes 6250 ll) and resolved in buffer G at a flow rate of 1 ml min1. Fractions (1 ml) were collected and protein detected by measuring A280nm and 10% SDS–PAGE. Elution volumes (Ve) for SmTPI and standards (b-galactosidase (116 kDa), bovine serum albumin (66.2 kDa), chymotrypsinogen A (25 kDa), and Ribonuclease A (13.7 kDa) were measured. The void volume (V0) was estimated to be 17 ml by measuring Ve for blue dextran. These values were used to calculate the partition coefficient, Kav according to Kav = (Ve  V0)/(Vt  V0). 2.4. Enzyme kinetics Measurement of the rate of isomerisation of both dihydroxyacetone phosphate and glyceraldehyde 3-phosphate was based on published methods [45,46] as described previously for Fasciola hepatica TPI [42]. 3. Results 3.1. SmTPI is a dimer and is predicted to have a similar overall fold to mammalian TPI SmTPI can be expressed in, and purified from, E. coli as a GST-fusion. The GST moiety can be successfully cleaved, leaving purified SmTPI (Fig. 1a). The protein is a dimer as judged by protein–protein crosslinking and analytical gel filtration (Fig. 1b and c). The presence of ligands did not affect the pattern of crosslinking, suggesting that they do not induce conformational changes which can be detected by this method (Fig. 1b). A homology model of dimeric SmTPI was constructed (Supplementary data). The protein is predicted to have the typical b-barrel fold seen in TPI from other species (Fig. 2a). The amino acid sequence has 64% identity and 75% similarity to the human enzyme; the predicted overall fold is highly similar to the human enzyme (PDB: 2JK2 [39]) with a route mean squared deviation (rmsd) of 0.701 Å over 3156 equivalent atoms. It is also highly similar to two insect TPI enzymes – Tenebrio molitor (PDB 2I9E; rmsd = 0.929 Å over 3112 equivalent atoms) and R. microplus (3TH6; rmsd = 0.983 Å over 3146 equivalent atoms) [47,48]. Bioinformatics analysis has identified a tripeptide motif (SXD/E, where X is any amino acid) present in parasitic helminths, which is not present in free living ones and it has been suggested that this motif may form part of a unique epitope not present in the host enzyme [17]. In SmTPI, the sequence comprises Ser-157, Ala-158 and Asp-159 and is predicted to extend an a-helix on the surface of the protein (Fig. 2).

3424

V.L. Zinsser et al. / FEBS Letters 587 (2013) 3422–3427

(a)

M L F E* B* E B

(b)

62 49 38 28

GST-SmTPI SmTPI GST

M -

+ A P D G

116 66 45 35 25

14

(SmTPI)2 SmTPI

18

6 3

(c) M C

23 24 25

Fig. 1. Expression, purification and dimerisation of SmTPI. (a) The purification of SmTPI was followed by 10% SDS–PAGE. The masses of molecular mass markers (M) are shown to the left of the gel in kDa. The GST-SmTPI fusion was the major band in the following expression and cell lysis (L); the majority of the protein bound to the glutathione resin and was not present in the flow through (F); SmTPI could be eluted by thrombin (E⁄ in the presence of tween; E in the absence of tween); this left GST bound to the bead (B⁄ in the presence of tween and B in the absence). (b) SmTPI (25 lM) in the absence of crosslinker () ran as a single band of approximately 26 kDa. Following reaction with BS3 (800 lM, +) a second band corresponding to approximately twice the monomeric molecular mass was observed. The amount and migration of this band were unchanged in the presence of the ligands (10 mM): arsenate ions (A); phosphate ions (P); dihydroxyacetone phosphate (D); glyceraldehyde 3-phosphate (G). The masses of molecular mass markers (M) are shown in kDa. (c) Elution of proteins in analytical gel filtration of SmTPI was monitored by absorbance and resulted in a single peak (Ve = 24 ml; left graph). SDS–PAGE (centre) demonstrated that this peak contained SmTPI. M, Molecular mass markers with masses in kDa (25 and 35 kDa markers are shown); C, SmTPI (30 lM; indicated by an arrow); 23–25, elution volumes of the corresponding fractions. A standard curve was used to estimate the molecular mass of SmTPI (see Section 2; right). The arrow indicates the Kav of SmTPI (0.215).

TPI enzymes from some unicellular parasites have a reactive cysteine in the dimer interface. Compounds have been identified which react with this cysteine and inactive the enzyme, but do not react with mammalian TPI [49–53]. In SmTPI the structurally equivalent residue to this reactive cysteine (Cys-14 in Entamoeba histolytica TPI; 1M6J [50]; overall protein sequence similarity 66%) is Met-15. In Giardia lamblia TPI modification of another cysteine residue (Cys-222) by reagents which react with sulfhydryls results in inactivation of the enzyme [54–56]. This residue is conserved in SmTPI (Cys-221; overall similarity 68%) and is, thus, a potential site for the design of inhibitors. 3.2. SmTPI shows high stability to proteolysis and thermal denaturation SmTPI was not noticeably affected by chymotrypsin under the experimental conditions tested (Fig. 3a). Subtilisin (at concentrations greater than 360 nM) was able to digest SmTPI; however few discrete fragments were detected (Fig. 3b). Ligands had little effect on the extent of digestion (Fig. 3c). SmTPI has a remarkably high melting temperature (82.0 ± 0.7 °C; Fig. 3d). Values for human metabolic enzymes determined under similar conditions are typically in the range 45–60 °C [57,58]. The measured melting temperature was unaffected by the addition of either substrate (data not shown). 3.3. SmTPI has high turnover numbers and Michaelis constants SmTPI exhibited Michaelis–Menten kinetics is both directions (Fig. 4). The Michaelis constants for dihydroxyacetone phosphate and glyceraldehyde 3-phosphate were 0.51 ± 0.06 and

1.1 ± 0.2 mM, respectively. Turnover numbers were high; for dihydroxyacetone phosphate a value of 7800 ± 180 s1 was determined and for glyceraldehyde 3-phosphate it was 6.9 ± 0.3 s1. 4. Discussion Like previously characterised TPI enzymes, SmTPI is dimeric, stable and has rapid reaction kinetics. The predicted structure is highly similar to the enzymes from potential mammalian hosts; thus, discovery of compounds which target SmTPI specifically will be challenging. Subtle differences in the surface structure, for example, the Ser-Ala-Asp tripeptide, presumably account for the ability of some immunoglobulins to differentiate between the parasite and human enzymes. The location of this peptide near the surface of the protein (Fig. 2b) is consistent with this hypothesis. SmTPI is remarkably stable to both proteolysis and thermal denaturation, even in comparison with TPI from some other species. Plasmodium falciparum TPI (amino acid similarity 60%) can be completely digested by subtilisin in 15 min at a TPI:protease ratio of 100:1 [59], whereas SmTPI remains partly undigested at similar ratios after 30 min (Fig. 3b). In contrast TPI from T. cruzi and T. brucei (66% and 68% similarity, respectively) were resistant to degradation (TPI:subtilisin of 100:1) over a period of hours with the T. brucei being particularly resistant [60]. However, despite this resistance to proteolysis, the melting temperature for T. brucei TPI is 53.1 °C (by CD spectroscopy) nearly 30 K below that measured for SmTPI [49]. The melting temperature of human TPI was estimated as 66.2 °C by differential scanning calorimetry (DSC) [61]. The precise molecular causes and biological significance of SmTPI’s thermal stability remain to be discovered. It has been shown that

V.L. Zinsser et al. / FEBS Letters 587 (2013) 3422–3427

3425

(a)

N C

N C

(b)

Human TPI

Ser-Ala-Asp mof SmTPI Fig. 2. Predicted structure of SmTPI. (a) The overall fold of SmTPI is predicted to be a dimer of two b-barrel containing monomers (yellow and blue); the SXD motif is shown in purple in both monomers. (b) A close up of the SXD motif in SmTPI compared to the structurally equivalent region from the human enzyme (2JK2 [39]). SmTPI is shown in yellow and purple, with purple representing residues (Ser-AlaAsp) for which the side chains are also shown. Human TPI is shown in light green.

alteration of a glutamate to glutamine in Leishmania mexicana TPI (66% similarity) increased the melting temperature by 26 K [62]. The structurally equivalent residue in SmTPI is Gln-65. However,

(a) 116 66 45 35 25 18 14

[Chymotrypsin]/nM M

(c) 116 66 45 35 25 18 14

M

Fig. 4. Steady-state enzyme kinetics of SmTPI. The initial rate of reaction catalysed by SmTPI with was measured as a function of dihydroxyacetone phosphate and glyceraldehyde 3-phosphate concentration. Each point represents the mean of three separate determinations and the error bars the standard deviations of these means.

this is not sufficient to explain completely SmTPI’s high melting temperature. F. hepatica TPI (80% similarity) also has a glutamine at this position, but this enzyme has a melting temperature (measured under the same conditions as SmTPI) of 67.0 °C [42].

(b) 116 66 45 35 25 18 14

[Sublisin] = 630 nM - D G A P

[Sublisin]/nM M

(d)

Fig. 3. Thermal and proteolytic stability of SmTPI. (a) Exposure of SmTPI (30 lM) to chymotrypsin (concentrations indication above the gel) for 30 min at 37 °C resulted in little digestion detectable by 15% Tris–tricine SDS–PAGE. (b) SmTPI (30 lM) resisted digestion by subtilisin up to 90 nM (at 37 °C for 30 min); at higher concentrations digestion could be detected by 15% SDS–PAGE. (c) Digestion of SmTPI (30 lM) was not affected by the absence () or presence of the ligands (10 mM): dihydroxyacetone phosphate (D), glyceraldehyde 3-phosphate (G), phosphate ions (P), arsenate ions (A). In (a), (b) and (c), the masses of molecular mass markers (M) are shown in kDa. (d) First derivative of the melting curve of SmTPI (1.8 lM) in the absence of ligands. The peak in this curve represents the maximum gradient in the melting curve and, thus, the Tm.

3426

V.L. Zinsser et al. / FEBS Letters 587 (2013) 3422–3427

The steady-state kinetic parameters for SmTPI are similar to those recorded for the enzyme from other species. Schistosoma japonicum TPI (92% similarity) has a Km for glyceralderhyde 3phosphate of 410 lM, just under half the value for SmTPI [63]. For F. hepatica TPI this value is 660 lM and its Km for dihydroxyacetone phosphate is 2300 lM, approximately four times that for SmTPI. The human enzyme has Km values for both substrates in the hundreds of micromolar range [64]. This suggests that it would be difficult to discover compounds which discriminate between the active sites of the human and parasite TPI enzymes. Nevertheless, it may be possible to exploit relatively minor differences. This approach has been successful in other species. P. falciparum TPI dimerization can be disrupted by peptides which mimic the dimer interface [65]. Dithiodianiline and phenazine inactivate T. cruzi TPI through modifications of the dimer interface [66,67]. Thus, it may be possible to discover reagents which selectively disrupt the homodimerisation of SmTPI or otherwise disrupt its enzymatic function. Acknowledgements We thank Prof. Aaron Maule (School of Biological Sciences, Queen’s University, Belfast) for access to qPCR machines. E.F. and D.W.D. thank the Welcome Trust (Grant #RG61087) for funding. The funding bodies had no role in the design or implementation of this research, the analysis of data therefrom or the decision to publish. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.febslet.2013.09.022. References [1] Gryseels, B., Polman, K., Clerinx, J. and Kestens, L. (2006) Human schistosomiasis. Lancet 368, 1106–1118. [2] Humphries, D., Nguyen, S., Boakye, D., Wilson, M. and Cappello, M. (2012) The promise and pitfalls of mass drug administration to control intestinal helminth infections. Curr. Opin. Infect. Dis. 25, 584–589. [3] Wang, W., Wang, L. and Liang, Y.S. (2012) Susceptibility or resistance of praziquantel in human schistosomiasis: a review. Parasitol. Res. 111, 1871– 1877. [4] Fallon, P.G. and Doenhoff, M.J. (1994) Drug-resistant schistosomiasis: resistance to praziquantel and oxamniquine induced in Schistosoma mansoni in mice is drug specific. Am. J. Trop. Med. Hyg. 51, 83–88. [5] Srinivasan, V. and Morowitz, H.J. (2006) Ancient genes in contemporary persistent microbial pathogens. Biol. Bull. 210, 1–9. [6] Orosz, F., Olah, J. and Ovadi, J. (2009) Triosephosphate isomerase deficiency: new insights into an enigmatic disease. Biochim. Biophys. Acta 1792, 1168–1174. [7] Orosz, F., Olah, J. and Ovadi, J. (2006) Triosephosphate isomerase deficiency: facts and doubts. IUBMB Life 58, 703–715. [8] Daar, I.O., Artymiuk, P.J., Phillips, D.C. and Maquat, L.E. (1986) Human triosephosphate isomerase deficiency: a single amino acid substitution results in a thermolabile enzyme. Proc. Natl. Acad. Sci. USA 83, 7903–7907. [9] Seigle, J.L., Celotto, A.M. and Palladino, M.J. (2008) Degradation of functional triose phosphate isomerase protein underlies sugarkill pathology. Genetics 179, 855–862. [10] Ralser, M., Heeren, G., Breitenbach, M., Lehrach, H. and Krobitsch, S. (2006) Triose phosphate isomerase deficiency is caused by altered dimerization – not catalytic inactivity – of the mutant enzymes. PLoS ONE 1, e30. [11] Olah, J., Orosz, F., Puskas, L.G., Hackler Jr, L., Horanyi, M., Polgar, L., Hollan, S. and Ovadi, J. (2005) Triosephosphate isomerase deficiency: consequences of an inherited mutation at mRNA, protein and metabolic levels. Biochem. J. 392, 675–683. [12] Hrizo, S.L., Fisher, I.J., Long, D.R., Hutton, J.A., Liu, Z. and Palladino, M.J. (2013) Early mitochondrial dysfunction leads to altered redox chemistry underlying pathogenesis of TPI deficiency. Neurobiol. Dis. 54, 289–296. [13] Bonnet, R., Pavlovic, S., Lehmann, J. and Rommelspacher, H. (2004) The strong inhibition of triosephosphate isomerase by the natural beta-carbolines may explain their neurotoxic actions. Neuroscience 127, 443–453. [14] Shoemaker, C., Gross, A., Gebremichael, A. and Harn, D. (1992) CDNA cloning and functional expression of the Schistosoma mansoni protective antigen triose-phosphate isomerase. Proc. Natl. Acad. Sci. USA 89, 1842–1846.

[15] Harn, D.A., Gu, W., Oligino, L.D., Mitsuyama, M., Gebremichael, A. and Richter, D. (1992) A protective monoclonal antibody specifically recognizes and alters the catalytic activity of schistosome triose-phosphate isomerase. J. Immunol. 148, 562–567. [16] Wright, M.D., Davern, K.M. and Mitchell, G.F. (1991) The functional and immunological significance of some schistosome surface molecules. Parasitol. Today 7, 56–58. [17] Chen, B. and Wen, J.F. (2011) The adaptive evolution divergence of triosephosphate isomerases between parasitic and free-living flatworms and the discovery of a potential universal target against flatworm parasites. Parasitol. Res. 109, 283–289. [18] Guillou, F., Roger, E., Mone, Y., Rognon, A., Grunau, C., Theron, A., Mitta, G., Coustau, C. and Gourbal, B.E. (2007) Excretory–secretory proteome of larval Schistosoma mansoni and Echinostoma caproni, two parasites of Biomphalaria glabrata. Mol. Biochem. Parasitol. 155, 45–56. [19] Wilson, R.A. (2012) Proteomics at the schistosome-mammalian host interface: any prospects for diagnostics or vaccines? Parasitology 139, 1178–1194. [20] Braschi, S., Curwen, R.S., Ashton, P.D., Verjovski-Almeida, S. and Wilson, A. (2006) The tegument surface membranes of the human blood parasite Schistosoma mansoni: a proteomic analysis after differential extraction. Proteomics 6, 1471–1482. [21] Karkowska-Kuleta, J., Kedracka-Krok, S., Rapala-Kozik, M., Kamysz, W., Bielinska, S., Karafova, A. and Kozik, A. (2011) Molecular determinants of the interaction between human high molecular weight kininogen and Candida albicans cell wall: identification of kininogen-binding proteins on fungal cell wall and mapping the cell wall-binding regions on kininogen molecule. Peptides 32, 2488–2496. [22] Furuya, H. and Ikeda, R. (2011) Interaction of triosephosphate isomerase from Staphylococcus aureus with plasminogen. Microbiol. Immunol. 55, 855–862. [23] Furuya, H. and Ikeda, R. (2009) Interaction of triosephosphate isomerase from the cell surface of Staphylococcus aureus and a-(1 ? 3)mannooligosaccharides derived from glucuronoxylomannan of Cryptococcus neoformans. Microbiology 155, 2707–2713. [24] Pereira, L.A., Bao, S.N., Barbosa, M.S., da Silva, J.L., Felipe, M.S., de Santana, J.M., Mendes-Giannini, M.J. and de Almeida Soares, C.M. (2007) Analysis of the Paracoccidioides brasiliensis triosephosphate isomerase suggests the potential for adhesin function. FEMS Yeast Res. 7, 1381–1388. [25] Zhu, Y., Lu, F., Dai, Y., Wang, X., Tang, J., Zhao, S., Zhang, C., Zhang, H., Lu, S. and Wang, S. (2010) Synergistic enhancement of immunogenicity and protection in mice against Schistosoma japonicum with codon optimization and electroporation delivery of SjTPI DNA vaccines. Vaccine 28, 5347–5355. [26] Dai, Y., Zhu, Y., Harn, D.A., Wang, X., Tang, J., Zhao, S., Lu, F. and Guan, X. (2009) DNA vaccination by electroporation and boosting with recombinant proteins enhances the efficacy of DNA vaccines for Schistosomiasis japonica. Clin. Vaccine Immunol. 16, 1796–1803. [27] Da’dara, A.A., Li, Y.S., Xiong, T., Zhou, J., Williams, G.M., McManus, D.P., Feng, Z., Yu, X.L., Gray, D.J. and Harn, D.A. (2008) DNA-based vaccines protect against zoonotic schistosomiasis in water buffalo. Vaccine 26, 3617–3625. [28] Zhu, Y., Si, J., Harn, D.A., Xu, M., Ren, J., Yu, C., Liang, Y., Yin, X., He, W. and Cao, G. (2006) Schistosoma japonicum triose-phosphate isomerase plasmid DNA vaccine protects pigs against challenge infection. Parasitology 132, 67–71. [29] Zhu, Y., Si, J., Harn, D.A., Yu, C., Liang, Y., Ren, J., Yin, X., He, W. and Hua, W. (2004) The protective immunity of a DNA vaccine encoding Schistosoma japonicum Chinese strain triose-phosphate isomerase in infected BALB/C mice. Southeast Asian J. Trop. Med. Public Health 35, 518–522. [30] Zhu, Y., Si, J., Ham, D.A., Yu, C., He, W., Hua, W., Yin, X., Liang, Y., Xu, M. and Xu, R. (2002) The protective immunity produced in infected C57BL/6 mice of a DNA vaccine encoding Schistosoma japonicum Chinese strain triose-phosphate isomerase. Southeast Asian J. Trop. Med. Public Health 33, 207–213. [31] Victor, S.A., Yolanda, M.F., Araceli, Z.C., Lucia, J. and Abraham, L. (2013) Characterization of a monoclonal antibody that specifically inhibits triosephosphate isomerase activity of Taenia solium. Exp. Parasitol. 134, 495–503. [32] Saramago, L., Franceschi, M., Logullo, C., Masuda, A., Vaz Ida, S., Farias, S.E. and Moraes, J. (2012) Inhibition of Enzyme Activity of Rhipicephalus (Boophilus) microplus triosephosphate isomerase and BME26 cell growth by monoclonal antibodies. Int. J. Mol. Sci. 13, 13118–13133. [33] Cortes-Figueroa, A.A., Perez-Torres, A., Salaiza, N., Cabrera, N., EscalonaMontano, A., Rondan, A., Aguirre-Garcia, M., Gomez-Puyou, A., Perez-Montfort, R. and Becker, I. (2008) A monoclonal antibody that inhibits Trypanosoma cruzi growth in vitro and its reaction with intracellular triosephosphate isomerase. Parasitol. Res. 102, 635–643. [34] Fitzpatrick, J.M., Peak, E., Perally, S., Chalmers, I.W., Barrett, J., Yoshino, T.P., Ivens, A.C. and Hoffmann, K.F. (2009) Anti-schistosomal intervention targets identified by lifecycle transcriptomic analyses. PLoS Negl. Trop. Dis. 3, e543. [35] Harper, S. and Speicher, D.W. (2011) Purification of proteins fused to glutathione S-transferase. Methods Mol. Biol. 681, 259–280. [36] Fitzsimmons, C.M., McBeath, R., Joseph, S., Jones, F.M., Walter, K., Hoffmann, K.F., Kariuki, H.C., Mwatha, J.K., Kimani, G., Kabatereine, N.B., Vennervald, B.J., Ouma, J.H. and Dunne, D.W. (2007) Factors affecting human IgE and IgG responses to allergen-like Schistosoma mansoni antigens: molecular structure and patterns of in vivo exposure. Int. Arch. Allergy Immunol. 142, 40–50. [37] Fitzsimmons, C.M., Jones, F.M., Stearn, A., Chalmers, I.W., Hoffmann, K.F., Wawrzyniak, J., Wilson, S., Kabatereine, N.B. and Dunne, D.W. (2012) The Schistosoma mansoni tegumental-allergen-like (TAL) protein family: influence

V.L. Zinsser et al. / FEBS Letters 587 (2013) 3422–3427

[38] [39]

[40]

[41]

[42]

[43]

[44] [45] [46]

[47]

[48]

[49]

[50]

[51]

[52]

[53]

[54]

of developmental expression on human IgE responses. PLoS Negl. Trop. Dis. 6, e1593. Kelley, L.A. and Sternberg, M.J. (2009) Protein structure prediction on the web: a case study using the Phyre server. Nat. Protoc. 4, 363–371. Rodriguez-Almazan, C., Arreola, R., Rodriguez-Larrea, D., Aguirre-Lopez, B., de Gomez-Puyou, M.T., Perez-Montfort, R., Costas, M., Gomez-Puyou, A. and Torres-Larios, A. (2008) Structural basis of human triosephosphate isomerase deficiency: mutation E104D is related to alterations of a conserved water network at the dimer interface. J. Biol. Chem. 283, 23254–23263. Krieger, E., Joo, K., Lee, J., Lee, J., Raman, S., Thompson, J., Tyka, M., Baker, D. and Karplus, K. (2009) Improving physical realism, stereochemistry, and sidechain accuracy in homology modeling: four approaches that performed well in CASP8. Proteins 77 (Suppl. 9), 114–122. Partis, M.D., Griffiths, D.G., Roberts, G.C. and Beechey, R.D. (1983) Crosslinking of protein by x-maleimido alkanoyl N-hydroxysuccinimido esters. J. Protein Chem. 2, 263–277. Zinsser, V.L., Hoey, E.M., Trudgett, A. and Timson, D.J. () Triose phosphate isomerase from the liver fluke Fasciola hepatica. Biochimie, http://dx.doi.org/ 10.1016/j.biochi.2013.08.014. in press. Ericsson, U.B., Hallberg, B.M., Detitta, G.T., Dekker, N. and Nordlund, P. (2006) Thermofluor-based high-throughput stability optimization of proteins for structural studies. Anal. Biochem. 357, 289–298. Durst, R.A. and Staples, B.R. (1972) Tris/tris–HCl: a standard buffer for use in the physiologic pH range. Clin. Chem. 18, 206–208. Plaut, B. and Knowles, J.R. (1972) PH-dependence of the triose phosphate isomerase reaction. Biochem. J. 129, 311–320. Lambeir, A.M., Opperdoes, F.R. and Wierenga, R.K. (1987) Kinetic properties of triose-phosphate isomerase from Trypanosoma brucei brucei. A comparison with the rabbit muscle and yeast enzymes. Eur. J. Biochem. 168, 69–74. Moraes, J., Arreola, R., Cabrera, N., Saramago, L., Freitas, D., Masuda, A., da Silva Vaz Jr., I., Tuena de Gomez-Puyou, M., Perez-Montfort, R., Gomez-Puyou, A. and Logullo, C. (2011) Structural and biochemical characterization of a recombinant triosephosphate isomerase from Rhipicephalus (Boophilus) microplus. Insect Biochem. Mol. Biol. 41, 400–409. Knobeloch, D., Schmidt, A., Scheerer, P., Krauss, N., Wessner, H., Scholz, C., Kuttner, G., von Rintelen, T., Wessel, A. and Hohne, W. (2010) A coleopteran triosephosphate isomerase: X-ray structure and phylogenetic impact of insect sequences. Insect Mol. Biol. 19, 35–48. Cabrera, N., Hernandez-Alcantara, G., Mendoza-Hernandez, G., Gomez-Puyou, A. and Perez-Montfort, R. (2008) Key residues of loop 3 in the interaction with the interface residue at position 14 in triosephosphate isomerase from Trypanosoma brucei. Biochemistry 47, 3499–3506. Rodriguez-Romero, A., Hernandez-Santoyo, A., del Pozo Yauner, L., Kornhauser, A. and Fernandez-Velasco, D.A. (2002) Structure and inactivation of triosephosphate isomerase from Entamoeba histolytica. J. Mol. Biol. 322, 669–675. Tellez-Valencia, A., Avila-Rios, S., Perez-Montfort, R., Rodriguez-Romero, A., Tuena de Gomez-Puyou, M., Lopez-Calahorra, F. and Gomez-Puyou, A. (2002) Highly specific inactivation of triosephosphate isomerase from Trypanosoma cruzi. Biochem. Biophys. Res. Commun. 295, 958–963. Maithal, K., Ravindra, G., Balaram, H. and Balaram, P. (2002) Inhibition of Plasmodium falciparum triose-phosphate isomerase by chemical modification of an interface cysteine. Electrospray ionization mass spectrometric analysis of differential cysteine reactivities. J. Biol. Chem. 277, 25106–25114. Garza-Ramos, G., Cabrera, N., Saavedra-Lira, E., Tuena de Gomez-Puyou, M., Ostoa-Saloma, P., Perez-Montfort, R. and Gomez-Puyou, A. (1998) Sulfhydryl reagent susceptibility in proteins with high sequence similarity – triosephosphate isomerase from Trypanosoma brucei, Trypanosoma cruzi and Leishmania mexicana. Eur. J. Biochem. 253, 684–691. Enriquez-Flores, S., Rodriguez-Romero, A., Hernandez-Alcantara, G., la MoraDe, De., la Mora, I., Gutierrez-Castrellon, P., Carvajal, K., Lopez-Velazquez, G.

[55]

[56]

[57]

[58]

[59]

[60]

[61]

[62]

[63]

[64]

[65]

[66]

[67]

3427

and Reyes-Vivas, H. (2008) Species-specific inhibition of Giardia lamblia triosephosphate isomerase by localized perturbation of the homodimer. Mol. Biochem. Parasitol. 157, 179–186. Enriquez-Flores, S., Rodriguez-Romero, A., Hernandez-Alcantara, G., OriaHernandez, J., Gutierrez-Castrellon, P., Perez-Hernandez, G., de la Mora, I., Castillo-Villanueva, A., Garcia-Torres, I., Mendez, S.T., Gomez-Manzo, S., Torres-Arroyo, A., Lopez-Velazquez, G. and Reyes-Vivas, H. (2011) Determining the molecular mechanism of inactivation by chemical modification of triosephosphate isomerase from the human parasite Giardia lamblia: a study for antiparasitic drug design. Proteins 79, 2711–2724. Hernandez-Alcantara, G., Torres-Larios, A., Enriquez-Flores, S., Garcia-Torres, I., Castillo-Villanueva, A., Mendez, S.T., de la Mora, I., Gomez-Manzo, S., TorresArroyo, A., Lopez-Velazquez, G., Reyes-Vivas, H. and Oria-Hernandez, J. (2013) Structural and functional perturbation of Giardia lamblia triosephosphate isomerase by modification of a non-catalytic, non-conserved region. PLoS ONE 8, e69031. McCorvie, T.J., Liu, Y., Frazer, A., Gleason, T.J., Fridovich-Keil, J.L. and Timson, D.J. (2012) Altered cofactor binding affects stability and activity of human UDP-galactose 40 -epimerase: implications for type III galactosemia. Biochim. Biophys. Acta 1822, 1516–1526. McCorvie, T.J., Gleason, T.J., Fridovich-Keil, J.L. and Timson, D.J. (2013) Misfolding of galactose 1-phosphate uridylyltransferase can result in type I galactosemia. Biochim. Biophys. Acta 1832, 1279–1293. Ray, S.S., Balaram, H. and Balaram, P. (1999) Unusual stability of a multiply nicked form of Plasmodium falciparum triosephosphate isomerase. Chem. Biol. 6, 625–637. Reyes-Vivas, H., Martinez-Martinez, E., Mendoza-Hernandez, G., LopezVelazquez, G., Perez-Montfort, R., Tuena de Gomez-Puyou, M. and GomezPuyou, A. (2002) Susceptibility to proteolysis of triosephosphate isomerase from two pathogenic parasites: characterization of an enzyme with an intact and a nicked monomer. Proteins 48, 580–590. Olah, J., Orosz, F., Keseru, G.M., Kovari, Z., Kovacs, J., Hollan, S. and Ovadi, J. (2002) Triosephosphate isomerase deficiency: a neurodegenerative misfolding disease. Biochem. Soc. Trans. 30, 30–38. Williams, J.C., Zeelen, J.P., Neubauer, G., Vriend, G., Backmann, J., Michels, P.A., Lambeir, A.M. and Wierenga, R.K. (1999) Structural and mutagenesis studies of Leishmania triosephosphate isomerase: a point mutation can convert a mesophilic enzyme into a superstable enzyme without losing catalytic power. Protein Eng. 12, 243–250. Sun, W., Liu, S., Brindley, P.J. and McManus, D.P. (1999) Bacterial expression and characterization of functional recombinant triosephosphate isomerase from Schistosoma japonicum. Protein Expr. Purif. 17, 410–413. Dabrowska, A., Kamrowska, I. and Baranowski, T. (1978) Purification, crystallization and properties of triosephosphate isomerase from human skeletal muscle. Acta Biochim. Pol. 25, 247–256. Singh, S.K., Maithal, K., Balaram, H. and Balaram, P. (2001) Synthetic peptides as inactivators of multimeric enzymes: inhibition of Plasmodium falciparum triosephosphate isomerase by interface peptides. FEBS Lett. 501, 19–23. Alvarez, G., Martinez, J., Aguirre-Lopez, B., Cabrera, N., Perez-Diaz, L., GomezPuyou, M.T., Gomez-Puyou, A., Perez-Montfort, R., Garat, B., Merlino, A., Gonzalez, M. and Cerecetto, H. () New chemotypes as Trypanosoma cruzi triosephosphate isomerase inhibitors: a deeper insight into the mechanism of inhibition. J. Enzyme Inhib. Med. Chem., http://dx.doi.org/10.3109/ 14756366.2013.765415. in press. Olivares-Illana, V., Rodriguez-Romero, A., Becker, I., Berzunza, M., Garcia, J., Perez-Montfort, R., Cabrera, N., Lopez-Calahorra, F., de Gomez-Puyou, M.T. and Gomez-Puyou, A. (2007) Perturbation of the dimer interface of triosephosphate isomerase and its effect on Trypanosoma cruzi. PLoS Negl. Trop. Dis. 1, e1.