Tristetraprolin down-regulates IL-17 through mRNA destabilization

FEBS Letters 586 (2012) 41–46

journal homepage: www.FEBSLetters.org

Tristetraprolin down-regulates IL-17 through mRNA destabilization Hyun Hee Lee a,1,2, Nal Ae Yoon a,1, Mai-Tram Vo a, Chae Won Kim a, Je Moon Woo b, Hee Jeong Cha c, Young Woo Cho d, Byung Ju Lee a, Wha Ja Cho e,⇑, Jeong Woo Park a,⇑ a

Department of Biological Sciences, University of Ulsan, Ulsan 680-749, Republic of Korea Department of Opthalmology, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan 682-060, Republic of Korea c Department of Pathology, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan 682-060, Republic of Korea d Department of Anesthesia and Pain Medicine, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan 682-060, Republic of Korea e Biomedical Research Center, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan 682-060, Republic of Korea b

a r t i c l e

i n f o

Article history: Received 6 July 2011 Revised 16 November 2011 Accepted 17 November 2011 Available online 28 November 2011 Edited by Beat Imhof Keywords: IL-17 TTP Human T cell Gene regulation

a b s t r a c t An excess of interleukin 17 (IL-17) may contribute to chronic inflammatory disorders, but mechanisms that regulate IL-17 in immune cells are unclear. Here we report that tristetraprolin (TTP) inhibits IL-17 production in human T cell lines. Overexpression of TTP decreased the expression of IL-17. Conversely, TTP inhibition by siRNA increased IL-17 production. IL-17 mRNA contains eight AREs within its 30 UTR. TTP bound directly to the IL-17 mRNA 30 UTR at a location between the fourth and seventh AREs and enhanced decay of IL-17 transcripts. These results suggest that TTP could control IL-17-mediated inflammation. Ó 2011 Published by Elsevier B.V. on behalf of the Federation of European Biochemical Societies.

1. Introduction Interleukin-17 (IL-17) is a regulatory cytokine involved in the innate immune response against extracellular bacteria and fungi [1]. However, IL-17 also participates in the pathogenesis of inflammatory disease [2]. IL-17 is secreted by TH17 cells, macrophages, dendritic cells, natural killer cells, and cd-T cells [1]. In vitro, a combination of IL-6 and TGF-b induces IL-17 production, which IL-23 then stabilizes [3]. IL-17 levels increase significantly in chronic inflammatory diseases [2], while the use of IL-17-blocking antibodies may prevent development of those diseases or diminish their severity [4]. IL-17-blocking antibodies are currently in clinical trials for this use [5]. Many inflammatory cytokine and chemokine mRNAs are known to be unstable [6]. Their expression is modulated by posttranscriptional control, which is strongly dependent on AU-rich element (ARE)-mediated mechanisms [7]. The AREs may destabilize the inflammatory signaling mRNAs through specific binding to proteins that promote mRNA degradation [8]. Tristetraprolin (TTP) is one ARE-binding protein involved in inflammatory ⇑ Corresponding authors. Fax: +82 52 259 1694. E-mail addresses: [email protected] (W.J. Cho), [email protected], [email protected] (J.W. Park). 1 Hyun Hee Lee and Nal Ae Yoon contributed equally to this work. 2 Present address: Department of Biological Sciences, Dong-A University, Busan 604-714, Korea.

cytokine regulation [9]. TTP-knockout mice develop severe inflammatory arthritis and autoimmune dysfunction, which supports the role of TTP in limiting the inflammatory response [10]. In the present study, we investigated the role of TTP in human T cells and found that TTP overexpression decreased IL-17 production. On the other hand, TTP inhibition by siRNA increased IL-17 content in the cells. IL-17 mRNA contains several AREs in the 30 UTR by which TTP may promote its decay. Our results show that IL-17 mRNA is a physiological target of TTP and suggest that TTP may play a key role in preventing IL-17-mediated inflammatory diseases through the destabilization of IL-17 transcripts. 2. Materials and methods 2.1. Cells The human T cell lines, HuT 102 and Jurkat, were maintained in RPMI 1640 medium and Dulbecco’s modified Eagle’s medium, respectively. All cell lines were supplemented with 10% FBS (HyClone) at 37 °C in a humidified atmosphere of 5% CO2. The HuT 102 cells were stimulated with medium alone or with immobilized anti-CD3 and anti-CD28 Abs for 24 h and 48 h. Ab stimulations were performed by culturing cells in culture dishes that had been coated at 4 °C overnight with a suspension containing 1 lg/ ml anti-human CD3 mAb (R&D System) and 2 lg/ml anti-human CD28 mAb (R&D System) in PBS.

0014-5793/$36.00 Ó 2011 Published by Elsevier B.V. on behalf of the Federation of European Biochemical Societies. doi:10.1016/j.febslet.2011.11.021

42

H.H. Lee et al. / FEBS Letters 586 (2012) 41–46

2.2. Measurement of IL-17 production by ELISA IL-17 in the cell supernatants was analyzed using the Human IL17A ELISA Ready-SET-Go!Ò system according to the manufacturer’s instructions (eBioscience). 2.3. Plasmids and siRNAs The pcDNA6/V5-TTP construct has been described previously [11]. Full-length and deletion mutants of the human IL-17 30 UTR was PCR-amplified from the cDNA of HuT 102 cells using Taq polymerase (SunGenetics, Korea) and a set of primers (Table 1). Four oligonucleotides containing AUUUA motifs (ARE-1-2, ARE-3-7, ARE-4-7, and ARE-8) of the IL-17 30 UTR were synthesized at Integrated DNA Technologies (IDT) (Table 1). Mutant ARE-4-7 oligonucleotides in which AUUUA pentamers were substituted with AGCA were also synthesized. PCR products and the oligonucleotides were inserted into the XhoI/NotI sites of a psiCHECK2 Renilla/firefly dualluciferase expression vector (Promega). Small interfering RNAs (siRNAs) against human TTP (TTP-siRNA) (sc-36761) and control siRNA (scRNA) (sc-37007) were purchased from Santa Cruz Biotechnology. 2.4. Transfections and luciferase assay Cells (5 x 106) were transfected with plasmid constructs and siRNAs by electroporation at 1400 V for 30 ms using the Neon™ Transfection System (Invitrogen) according to the manufacturer’s instructions. Lysates of the transfected cells were mixed with luciferase assay reagent (Promega), and chemiluminescence was measured in a Wallac Victor 1420 Multilabel Counter (EG&G Wallac). Renilla luciferase activity of the psiCHECK2/IL-17 30 UTR was normalized to firefly luciferase in each sample.

mutant RNA probe in which four AUUUA pentamers were each substituted with AGCA was used as a negative control. Cytoplasmic extracts were prepared from HuT 102 cells using NE-PERÒ Nuclear and Cytoplasmic Extraction Reagent (Thermo Pierce Biotechnology Scientific). RNA EMSA was performed using the LightshiftÒ Chemoluminescent EMSA Kit (Thermo Pierce Biotechnology Scientific) according to the manufacturer’s instructions. For the supershift EMSA, anti-TTP antibody (ab36558, Abcam) or control antibody (I-5381, Sigma) was added to the reaction mixture. 2.6. SDS–PAGE analysis and immunoblotting Proteins were resolved by SDS–PAGE, transferred to Hybond-P membranes (GE Healthcare Bio-Sciences Corp.), and probed with the appropriate dilution of anti-V5 antibody (20-783-70389, GenWay). Immunoreactivity was detected using the ECL detection system (GE Healthcare Bio-Sciences Corp.). 2.7. Quantitative real-time PCR For RNA kinetic analysis, we used actinomycin D and assessed IL17 mRNA expression by quantitative real-time PCR (qRT-PCR) using the ABI Prism 7900 HT to monitor the increase in SYBR Green dye fluorescence over time (QIAGEN). PCR primer pairs were as follows: qIL-17: ACTACAACCGATCCACCTCAC, ACTTTGCCTCCCAGATCACAG; qGAPDH: ATCTTCAAGCCATCCTGTGTGC, TGCGCTTGTCACATTTTTCTTG. TTP mRNA expression was determined by qRT-PCR using PCR primers: qTTP: ACTACAACCGATCCACCTCAC, ACTTTGCCTCCCAGATCACAG. 2.8. Statistics For statistical comparisons, P values were determined using Student’s t-test.

2.5. Electrophoretic mobility shift assay (EMSA) 3. Results The biotinylated RNA probes for wild-type (Oligo-ARE-4-7, 50 -CCUGUAUUUAUUUGAGCUAUUUAAGGAUCUAUUUAUGUUUAAGUAUUUAGAAAA-30 ) and mutant (Oligo-ARE-4-7/m4-7, 50 -CCUGUAGCAUUUGAGCUAGCAAGGAUCUAGCAUGUUUAAGUAGCAGAAAA30 ) were synthesized by Samchully Pharm. Co., Ltd. (Korea). A

3.1. TTP down-regulates the IL-17 expression in human T cell lines Analysis of the 1346 bp human IL-17 mRNA 30 UTR revealed the presence of eight ARE motifs (Fig. 3A). To determine the effect of

Table 1 PCR primers and Oligonucleotides used in this study. Name (forward and reverse)

Sequences (50 ? 30 )

Full-ARE Frag-DARE-1-2 Frag-DARE-3-7 Frag-DARE-8 Oligo-ARE-1/2

CCGCTCGAGGAGCTCTGGGGAGCCCACACT, ATAAGAATGCGGCCGCGGGCGAAAATGGTTACGATGTG. TAAGGGCTTTAAGTTATATGCCCTGAGATAACT, AGTTATCTCAGGGCATATAACTTAAAGCCCTTA GGCTTGGGAATTTTATTGAAAAAGGTGAAAAAGCAC, GTGCTTTTTCACCTTTTTCAATAAAATTCCCAAGCCC CTACTTTCATATGTATTAAATTTTGCAATTTGTTG, CAACAAATTGCAAAATTTAATACATATGAAAGTAG CGAGTTTAAGGGCTTTAAGTTATTTATGTATTTAATATGCCCTGAGATAACTTTGGGGC, GGCCGCCCCAAAGTTATCTCAGGGCATATTAAATACATAAATAACTTAAAGCCCTTAAAC TCGAGCTTGGGAATTTTATTATTTAAAAGGTAAAACCTGTATTTATTTTGAGCTATTTAAGGATCTATTTATGTTTAAGTATTTAGAAAAAGGTGAGC, GGCCGCTCACCTTTTTCTAAATACTTAAACATAAATAGATCCTTAAATAGCTCAAATAAATACAGGTTTTACCTTTTAAATAATAAAATTCCCAAGC TCGAGACCTGTATTTATTTGAGCTATTTAAGGATCTATTTATGTTTAAGTATTTAGAAAGC, GGCCGCTTTCTAAATACTTAAACATAAATAGATCCTTAAATAGCTCAAATAAATACAGGTC TCGAGGATTAAACCTACTTTCATATGTATTAATTTAAATTTTGCAATTTGTTGAGGTTTTACAAGGC, GGCCGCCTTGTAAAACCTCAACAAATTGCAAAATTTAAATTAATACATATGAAAGTAGGTTTAATCC TCGAGACCTGTAGCATTTGAGCTATTTAAGGATCTATTTATGTTTAAGTATTTAGAAAGC, GGCCGCTTTCTAAATACTTAAACATAAATAGATCCTTAAATAGCTCAAATGCTACAGGTC TCGAGACCTGTATTTATTTGAGCTAGCAAGGATCTATTTATGTTTAAGTATTTAGAAAGC, GGCCGCTTTCTAAATACTTAAACATAAATAGATCCTTGCTAGCTCAAATAAATACAGGTC TCGAGACCTGTATTTATTTGAGCTATTTAAGGATCTAGCATGTTTAAGTATTTAGAAAGC, GGCCGCTTTCTAAATACTTAAACATGCTAGATCCTTAAATAGCTCAAATAAATACAGGTC TCGAGACCTGTATTTATTTGAGCTATTTAAGGATCTATTTATGTTTAAGTAGCAGAAAGC, GGCCGCTTTCTGCTACTTAAACATAAATAGATCCTTAAATAGCTCAAATAAATACAGGTC TCGAGACCTGTAGCATTTGAGCTAGCAAGGATCTAGCATGTTTAAGTAGCAGAAAGC, GGCCGCTTTCTGCTACTTAAACATGCTAGATCCTTGCTAGCTCAAATGCTACAGGTC

Oligo-ARE-3-7 Oligo-ARE-4-7 Oligo-ARE-8 Oligo-ARE-4-7(4 m) Oligo-ARE-4-7(5 m) Oligo-ARE-4-7(6 m) Oligo-ARE-4-7(7 m) Oligo-ARE-4-7(all m)

Underlined sequences, wild-type and mutant AREs. Mutations (bold characters) were introduced to the AREs in the Oligo-ARE-4-7.

43

H.H. Lee et al. / FEBS Letters 586 (2012) 41–46

qRT-PCR. TTP overexpression in these cells was confirmed using Western blots (Fig. 1A). While the IL-17 mRNA was stable until 2 h after actinomycin D treatment in empty vector-transfected cells (HuT 102/pcDNA), the half-life was significantly reduced to less than 2 h in TTP-transfected cells (HuT 102/TTP) (Fig. 2). This shows that TTP overexpression decreases IL-17 expression through destabilization of IL-17 mRNA.

TTP on IL-17 expression, we transiently transfected HuT 102 cells with pcDNA6/V5-TTP (HuT 102/TTP). As a negative control, HuT 102 cells were transfected with an empty pcDNA6/V5 vector (HuT 102/pcDNA). Overexpression of TTP in HuT 102 cells was confirmed by Western blots (Fig. 1A). In a parallel experiment, IL-17 expression was analyzed in HuT 102 cells transfected with pcDNA6/V5-TTP (HuT 102/TTP) and pcDNA6/V5 (HuT 102/pcDNA) using ELISA (Fig. 1B) and quantitative real-time PCR (qRT-PCR) (Fig. 1C). TTP overexpression significantly reduced IL-17 expression (Fig. 1B and C). To test the effect of TTP down-regulation on IL-17 expression, we treated Jurkat cells with TTP-specific siRNA. This treatment significantly decreased TTP level (Fig. 1D and F) but increased IL-17 expression (Fig. 1D and E), while treatment with non-specific siRNA (scRNA) did not affect endogenous expression of either TTP or IL-17. Collectively, these results indicate that TTP down-regulates IL-17 expression in human T cells.

3.3. TTP overexpression decreases the expression of luciferase mRNA containing the IL-17 30 UTR We wished to confirm that the IL-17 30 UTR is required for TTP to destabilize the IL-17 mRNA. We transfected HuT 102 cells with a luciferase reporter gene linked to a IL-17 30 UTR fragment containing all eight AREs in the plasmid psiCHECK (psiCHECK2/IL-17 30 UTR Full). When HuT 102 cells were transfected to overexpress TTP (Fig. 1A), the luciferase activity was sharply inhibited as compared to that of HuT 102 cells transfected with pcDNA6/V5 (Fig. 3B). Thus we confirmed that the 30 UTR of IL-17 mRNA is involved in the TTP-mediated down-regulation of IL-17.

3.2. TTP destabilizes IL-17 mRNA

**

24

Rel. IL-17 mRNA level

IL-17(pg/ml)

GAPDH

16 12 8 4

β-actin

0

0.4

P TT

N

2/

D ut

H

10

ut

2/

10

pc

p

F Rel. TTP mRNA level

16 8

TT

N cD

t

Hu

Hu

24

P

A6

H

IL-17 (pg/ml)

Jurkat/siTTP

1.6

2/ 10

**

1.2

0.8

0.4

0.0

0

Ju rk

at -s

iR

N

t/s Ju

rk a

/s at rk Ju

A-

cR

TP iT

N A cR /s at rk Ju

N

A

Jurkat/scRNA

Jurkat/Mock W.B

0.6

2/

32

β-actin

0.8

0 t1

*

40

TTP

1.0

0.0

E

D

1.2

0.2

A6

TTP

*

1.4

20

IL-17

W.B

C

TT P

HuT 102/TTP

HuT 102/pcDNA6

B

TTP

RT-PCR

A

HuT 102/Mock

We measured the half-life of IL-17 mRNA in HuT 102 cells transfected with pcDNA6/V5-TTP or the empty pcDNA6/V5 vector by

Fig. 1. TTP inhibits IL-17 expression in human T cells. (A, B, C) HuT 102 cells were transfected with pcDNA6/V5-TTP or pcDNA6/V5 and (D, E, F) Jurkat cells with TTP-siRNA (siTTP) or control-siRNA (scRNA). (A, D) Expression of TTP in HuT 102 and Jurkat cells was determined by Western blot analysis. b-actin was detected as loading control. Expression of IL-17 was measured by ELISA (B, E) and qRT-PCR (C, F). Results shown on the graph represent the mean ± S.D. of three independent experiments (⁄P < 0.05 and ⁄⁄ P < 0.01).

H.H. Lee et al. / FEBS Letters 586 (2012) 41–46

Rel. IL-17 mRNA remaining

44

3.4. An ARE cluster (ARE 4-7) within the IL-17 30 UTR is involved in TTPmediated mRNA destabilization

1.2 1.0 0.8

*** 0.6 0.4

Hut102/pcDNA 0.2

Hut102/TTP

0.0 0

0.5

1

2

Times after actinomycin D Treatment (hrs) Fig. 2. TTP destabilizes IL-17 mRNA. HuT 102 cells were transfected with pcDNA6/ V5-TTP or pcDNA6/V5. Expression of IL-17 mRNA in HuT 102 cells was determined by quantitative real-time PCR at indicated times after the addition of 5 lg/ml actinomycin D. The expression levels obtained in Hut102/pcDNA and Hut102/TTP at time point 0 were set to 1, respectively. Data shown on the graph represent the mean ± S.D. of three independent experiments (⁄⁄⁄P < 0.001).

To identify AREs within the IL-17 30 UTR that are required for TTP activity, we linked luciferase reporter genes to various deletion and point mutant constructs of the IL-17 30 UTR (Fig. 3A). While TTP decreased the luciferase activity of the reporter gene cloned upstream of IL-17 30 UTR Full (containing all eight AREs) by 68%, less reporter gene inhibition was observed for FragDARE-1/2 (containing ARE3ARE8, 64%), Frag-DARE-8 (containing ARE1ARE7, 51%), and Frag-DARE-3-7 (containing ARE1, ARE2, and ARE8, 33%) (Fig. 3C). These results showed that the IL-17 30 UTR region containing ARE3ARE7 is required for TTP to down-regulate IL-17. To confirm that the regulatory effect of TTP requires ARE3ARE7, we prepared the following oligonucleotide fragments of the IL-17 30 UTR region: Oligo-ARE-1-2 (containing ARE1 and ARE2), Oligo-ARE-3-7 (containing ARE3ARE7), Oligo-ARE-4-7

A

B

C

Fig. 3. AREs within the IL-17 mRNA 30 UTR are essential for the inhibitory effect of TTP. (A) Schematic representation of the luciferase reporter constructs used in this study. White circles represent the wild-type (w) ARE motif, AUUUA, and black circles represent the mutated (m) motif, AGCA. (B) Inhibition by TTP overexpression of the luciferase reporter containing the IL-17 30 UTR. The HuT 102 cells were cotransfected with luciferase reporters containing the full-length IL-17 30 UTR (IL-17 30 UTR Full) and with pcDNA/ V5-TTP. Renilla luciferase activity was normalized to firefly activity. The luciferase values obtained from cells cotransfected with the luciferase construct and pcDNA6/V5 were set to 100. Results shown on the graph represent the mean ± S.D. of three independent experiments (⁄P < 0.05). (C) Mapping of the sequence in IL-17 mRNA 30 UTR required for TTP inhibition of luciferase activity. HuT 102 cells were cotransfected with 0.5 lg of a luciferase reporter construct as described in (A), and with pcDNA6/V5-TTP. After normalizing luciferase activity, TTP-induced inhibition of luciferase activity observed with each construct was compared to inhibition obtained with the empty vector, pcDNA6/V5. Results shown on the graph represent the mean ± S.D. of three independent experiments (⁄P < 0.05; ⁄⁄P < 0.01).

45

H.H. Lee et al. / FEBS Letters 586 (2012) 41–46

TTP(µg) Cyt.ext Probe

3 5 IgG 1 + + + + + WT WT WT WT WT

+ + WT Mut

single-mutation variants of Oligo-ARE-4-7 (Oligo-ARE-4-7/m4, Oligo-ARE-4-7/m5, Oligo-ARE-4-7/m6, Oligo-ARE-4-7/m7), in which each AUUUA motif was replaced with AGCA. As a negative control, we also prepared one quadruple-mutant (Oligo-ARE-4-7/ m4-7) in which all four AUUUA motifs were substituted with AGCA. The quadruple-mutant Oligo-ARE-4-7/m4-7 did not respond to TTP. However, no single ARE mutation affected the response to TTP (Fig. 3C). Thus, a cluster of ARE-4-7 within the IL-17 30 UTR was required for TTP to destabilize the IL-17 mRNA. 3.5. TTP binds to the ARE cluster (ARE 4-7) within the IL-17 mRNA 30 UTR

Fig. 4. TTP binds directly to AREs within the IL-17 mRNA 30 UTR. An RNA EMSA was performed by mixing cytoplasmic extracts containing 4 lg of total protein from HuT 102 cells with 10 fmol of biotinylated wild-type (Oligo-ARE-4-7) or mutant (Oligo-ARE-4-7/m4-7) probe. Anti-TTP and control antibody were added to the reaction mixtures. Arrows indicate the position of the TTP-containing band.

(containing ARE4ARE7), and Oligo-ARE-8 (containing ARE8) (Fig. 3A). While TTP inhibited Oligo-ARE-3-7 and Oligo-ARE-4-7 by 47% and 42% inhibition, respectively, Oligo-ARE-1-2 and Oligo-ARE-8 resisted the destabilizing effect of TTP (26% and 25% inhibition, respectively) (Fig. 3C). To identify the ARE motif(s) most critically involved in the response to TTP, we prepared four

A

To determine whether TTP interacts directly with ARE-4-7 of the IL-17 30 UTR, we performed an RNA EMSA using a biotinylated RNA probe containing the wild-type or mutant ARE-4-7 UTR. This RNA probe was identical to the oligonucleotide (Oligo-ARE-4-7) used for the luciferase assay. A quadruple-mutant Oligo-ARE-4-7/ m4-7 was used as a negative control. In cytoplasmic extracts of HuT 102 cells, RNA EMSA analysis revealed an RNA-binding protein for the wild-type probe but not for the mutant probe (Fig. 4). This RNA-protein complex was reduced by preincubation of the reaction mixture with an anti-TTP antibody. Thus, TTP interacted directly with the Oligo-ARE-4-7 containing the ARE cluster (ARE4-7) in the IL-17 mRNA 30 UTR. 3.6. Stimulation of HuT 102 cells increases TTP level but decreases IL17 level TTP level has been reported to be induced following T cell receptor-mediated stimulation [12,13]. Thus, it is possible that

B

2.0

Media

α CD3+CD28

Med ia

0

24

48

0

24

48

hr TTP β-actin

Rel. TTP mRNA level

α CD3+CD28

*

1.5

1.0

0.5

0.0

24hr

48hr

Hours after sitimulation

15

D Media α CD3+CD28

1.5

* Rel. IL-17 mRNA level

IL-17 (pg/ml)

C

10

5

Media α CD3+CD28

**

1.0

0.5

0.0

0 24hr

Hours after sitimulation

48hr

24hr

48hr

Hours after sitimulation

Fig. 5. Stimulation of T cells decreases IL-17 production. HuT 102 cells were either unstimulated (media) or stimulated for 24 h and 48 h with anti-CD3 and anti-CD28 Abs. Expression of TTP in HuT 102 cells was determined by (A) Western blot analysis and (B) qRT-PCR. The IL-17 level in HuT 102 cells was determined by (C) ELISA and (D) qRTPCR. Results shown on the graph represent the mean ± S.D. of three independent experiments (⁄P < 0.05; ⁄⁄P < 0.01).

46

H.H. Lee et al. / FEBS Letters 586 (2012) 41–46

stimulation of T cells reduces the IL-17 level. To verify this, we analyzed the level of TTP and IL-17 in HuT 102 cells at 24 h and 48 h after stimulation with anti-CD3 and anti-CD28 Abs. Consistent with the previous report, stimulation of HuT 102 cells induced increased expression of TTP at 24 h and 48 h (Fig. 5A and B). However, there was no change in the level of IL-17 at 24 h after stimulation. At later time after stimulation, at 48 h, the IL-17 level was decreased (Fig. 5C and D). This result suggests that stimulation of HuT 102 cells induces TTP expression but decreases IL-17 level at 48 h after stimulation.

4. Discussion The cytokine IL-17 is a prominent mediator of inflammation and inflammatory disease [1]. Until now, the mechanism for IL17 down-regulation was unclear. Here we demonstrate that TTP suppresses IL-17 expression in the human T cells. We found that TTP promoted IL-17 mRNA degradation through binding to a cluster of ARE motifs within the IL-17 30 UTR. Our deletion and mutation analysis showed that the region containing ARE4 through ARE7 is essential for the response to TTP. Evidence shows that TTP enhances the decay of ARE-containing cytokine genes such as tumor necrosis factor-a (TNF-a) [9], granulocyte-macrophage colony stimulating factor (GM-CSF) [14], IL-10 [15], IL-2 [13] and IL-23 [16] and that TTP-mediated decay of AREcontaining cytokine mRNAs exerts control over an inflammatory response [9,10]. TTP-deficient mice develop a systemic inflammatory syndrome caused by cytokine overproduction [9,10]. Strong inflammatory stimuli such as LPS activate p38 MAPK, which in turn deactivates control by TTP [17]. In this situation, a change in p38 MAPK signaling is required to restore post-transcriptional control of IL-17 expression. Elevated expression of TTP has been reported in T cell receptorstimulated T cells [12,13]. Consistent with this, we found that stimulation of HuT 102 cells with anti-CD3/anti-CD28 for 24 h increased TTP level. However, interestingly, we observed that stimulation of HuT 102 cells for 24 h did not decrease IL-17 level. This coincides with previous report that stimulation of HuT 102 cells does not affect IL-17 production [18]. It is unclear why TTP induced at 24 h did not down-regulate the IL-17 level. One possibility is that p38 MAPK activated by TcR stimulation [19] phosphorylates TTP and inhibits its activity [17]. At later time after stimulation, IL-17 level was decreased, indicating the change in p38 MAPK signaling pathway leading to restoration of TTP activity. It has been shown that TGF-b is produced by activated T cells [20] and that it inhibits p38 MAPK and enhances the mRNA-destabilizing activity of TTP [21]. Thus one may hypothesize that TGF-b produced at later time of stimulation inhibits p38 MAPK activity and leads to TTP activation. Further study is required to determine whether TGF-b influences the destabilizing effect of TTP on IL-17 mRNA. In conclusion, this study confirmed that IL-17 contains ARE motifs within its 30 UTR, and that TTP destabilizes IL-17 mRNA by direct binding to an ARE cluster containing ARE4 through ARE7. Because IL-17 over-expression may contribute to chronic inflammatory disease, the inhibition of IL-17 production by enhancing TTP expression and activity may have important clinical implications.

Acknowledgments This work was supported by the Research Fund of the University of Ulsan (2008-0063). References [1] Iwakura, Y., Nakae, S., Saijo, S. and Ishigame, H. (2008) The roles of IL-17A in inflammatory immune responses and host defense against pathogens. Immunol Rev 226, 57–79. [2] Ouyang, W., Kolls, J.K. and Zheng, Y. (2008) The biological functions of Thelper 17 cell effector cytokines in inflammation. Immunity 28, 454–467. [3] Wilson, N.J., Boniface, K., Chan, J.R., McKenzie, B.S., Blumenschein, W.M., Mattson, J.D., Basham, B., Smith, K., Chen, T., Morel, F., Lecron, J.C., Kastelein, R.A., Cua, D.J., McClanahan, T.K., Bowman, E.P. and de Waal Malefyt, R. (2007) Development, cytokine profile and function of human interleukin 17producing helper T cells. Nat Immunol 8, 950–957. [4] Komiyama, Y., Nakae, S., Matsuki, T., Nambu, A., Ishigame, H., Kakuta, S., Sudo, K. and Iwakura, Y. (2006) IL-17 plays an important role in the development of experimental autoimmune encephalomyelitis. J Immunol 177, 566–573. [5] van den Berg, W.B. and Miossec, P. (2009) IL-17 as a future therapeutic target for rheumatoid arthritis. Nat Rev Rheumatol 5, 549–553. [6] Anderson, P. (2008) Post-transcriptional control of cytokine production. Nat Immunol 9, 353–359. [7] Stoecklin, G. and Anderson, P. (2006). Posttranscriptional mechanisms regulating the inflammatory response. Adv Immunol 89, 1-37. development of. [8] Shyu, A.B. and Wilkinson, M.F. (2000) The double lives of shuttling mRNA binding proteins. Cell 102, 135–138. [9] Carballo, E., Lai, W.S. and Blackshear, P.J. (1998) Feedback inhibition of macrophage tumor necrosis factor-alpha production by tristetraprolin. Science 281, 1001–1005. [10] Taylor, G.A., Carballo, E., Lee, D.M., Lai, W.S., Thompson, M.J., Patel, D.D., Schenkman, D.I., Gilkeson, G.S., Broxmeyer, H.E., Haynes, B.F. and Blackshear, P.J. (1996) A pathogenetic role for TNF alpha in the syndrome of cachexia, arthritis, and autoimmunity resulting from tristetraprolin (TTP) deficiency. Immunity 4, 445–454. [11] Lee, H.H., Vo, M.T., Kim, H.J., Lee, U.H., Kim, C.W., Kim, H.K., Ko, M.S., Lee, W.H., Cha, S.J., Min, Y.J., Choi, D.H., Suh, H.S., Lee, B.J., Park, J.W. and Cho, W.J. (2010) Stability of the LATS2 tumor suppressor gene is regulated by tristetraprolin. J Biol Chem 285, 17329–17337. [12] Raghavan, A., Robison, R.L., McNabb, J., Miller, C.R., Williams, D.A. and Bohjanen, P.R. (2001) HuA and tristetraprolin are induced following T cell activation and display distinct but overlapping RNA binding specificities. J Biol Chem 276, 47958–47965. [13] Ogilvie, R.L., Abelson, M., Hau, H.H., Vlasova, I., Blackshear, P.J. and Bohjanen, P.R. (2005) Tristetraprolin down-regulates IL-2 gene expression through AUrich element-mediated mRNA decay. J Immunol 174, 953–961. [14] Carballo, E., Lai, W.S. and Blackshear, P.J. (2000) Evidence that tristetraprolin is a physiological regulator of granulocyte-macrophage colony-stimulating factor messenger RNA deadenylation and stability. Blood 95, 1891–1899. [15] Stoecklin, G., Tenenbaum, S.A., Mayo, T., Chittur, S.V., George, A.D., Baroni, T.E., Blackshear, P.J. and Anderson, P. (2008) Genome-wide analysis identifies interleukin-10 mRNA as target of tristetraprolin. J Biol Chem 283, 11689–11699. [16] Qian, X., Ning, H., Zhang, J., Hoft, D.F., Stumpo, D.J., Blackshear, P.J. and Liu, J. Posttranscriptional regulation of IL-23 expression by IFN-gamma through tristetraprolin. J Immunol 186, 6454-64. [17] Mahtani, K.R., Brook, M., Dean, J.L., Sully, G., Saklatvala, J. and Clark, A.R. (2001) Mitogen-activated protein kinase p38 controls the expression and posttranslational modification of tristetraprolin, a regulator of tumor necrosis factor alpha mRNA stability. Mol Cell Biol 21, 6461–6469. [18] Liu, X.K., Lin, X. and Gaffen, S.L. (2004) Crucial role for nuclear factor of activated T cells in T cell receptor-mediated regulation of human interleukin17. J Biol Chem 279, 52762–52771. [19] Zhang, J., Salojin, K.V., Gao, J.X., Cameron, M.J., Bergerot, I. and Delovitch, T.L. (1999) P38 mitogen-activated protein kinase mediates signal integration of TCR/CD28 costimulation in primary murine T cells. J Immunol 162, 3819–3829. [20] Kehrl, J.H., Wakefield, L.M., Roberts, A.B., Jakowlew, S., Alvarez-Mon, M., Derynck, R., Sporn, M.B. and Fauci, A.S. (1986) Production of transforming growth factor beta by human T lymphocytes and its potential role in the regulation of T cell growth. J Exp Med 163, 1037–1050. [21] Lee, W.H., Lee, H.H., Vo, M.T., Kim, H.J., Ko, M.S., Im, Y.C., Min, Y.J., Lee, B.J., Cho, W.J. and Park, J.W. (2011) Casein Kinase 2 Regulates the mRNA-destabilizing Activity of Tristetraprolin. J Biol Chem 286, 21577–21587.