Trithorax-group protein ASH1 methylates histone H3 lysine 36

Gene 397 (2007) 161 – 168 www.elsevier.com/locate/gene

Trithorax-group protein ASH1 methylates histone H3 lysine 36 Yujiro Tanaka a,⁎, Zen-ichiro Katagiri a , Koji Kawahashi a , Dimitris Kioussis b , Shigetaka Kitajima a a

Genome Structure and Expression, School of Biomedical Science, and Biochemical Genetics, Medical Research Institute, Tokyo Medical and Dental University, 1-5-45 Yushima, Bunkyoku, Tokyo 113-8650, Japan b Molecular Immunology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK Received 12 August 2006; received in revised form 5 March 2007; accepted 24 April 2007 Available online 1 May 2007

Abstract Drosophila discs absent, small, or homeotic-1 (ASH1) is a member of trithorax-group proteins that play essential roles in epigenetic regulation of Hox genes. Drosophila ASH1 genetically interacts with trithorax and has been reported to methylate histone H3 lysine 4 (K4) as well as H3 K9 and H4 K20. The function of mammalian ASH1, by contrast, has remained largely unknown. Here we report a histone lysine scanning mutation assay using recombinant core histones and in vitro reconstituted nucleosomes to identify targets of mammalian methyltransferases by fluorographic, Western blot, and mass spectrometric analyses. The assay reproduced specificities of previously known histone methyltransferases and further revealed unexpectedly that mammalian ASH1 mono- or di-methylates histone H3 K36 but not any other lysine residues of recombinant unmodified mammalian histones. Under the same experimental condition, lysine to arginine substitution of histone H3 at position 36 abolished the methyltransferase activity of Drosophila ASH1, suggesting that K36 is their specific target. We also demonstrate that native ASH1 proteins, consisting of the carboxy-terminal domains including the catalytic site, retain the specificity for K36. Taken together, our data suggest that ASH1 subfamily of SET domain proteins have K36-specific methyltransferase activities evolutionarily conserved from flies to mammals. © 2007 Elsevier B.V. All rights reserved. Keywords: Epigenetic regulation; Histone lysine methyltransferase; Chromatin structure; SET domain

1. Introduction Covalent modifications of histones by acetylation, methylation, phosphorylation, and ubiquitilation play important roles in dynamic regulation of gene expression. Mono-, di-, or trimethylation of core histone lysine residues is mediated by sitespecific methyltransferases harbouring SET (Su(var)3-9, E(z), and trithorax) domain (Rea et al., 2000). Methylation of histone H3 lysine 4 (K4), K36, and K79 is associated with actively transcribed genes, whereas methylation of histone H3 K9 and K27 as well as histone H4 K20 occurs in silent genes. In addition, multiple histone modifications are partly inter-dependent and have been suggested to constitute ‘histone codes’ that dictate gene activities through conformational changes of nucleosomes and/or recruitment of adapter proteins (Strahl and Allis, 2000; Jenuwein and Allis, 2001). Abbreviations: ASH1, discs absent, small, or homeotic-1; SET, Su(var)3-9, E(z), and trithorax; K4 and K36, lysine 4 and 36, RNAPII, RNA polymerase II. ⁎ Corresponding author. Tel.: +81 3 5803 5823; fax: +81 3 5803 0248. E-mail address: [email protected] (Y. Tanaka). 0378-1119/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2007.04.027

Methylation of histone H3 K36 was first demonstrated in Saccharomyces cerevisiae in which Set2 is the only enzyme to catalyse the reaction (Strahl et al., 2002). Set2 directly interacts with late elongating RNA polymerase II (RNAPII) complexes through CTD phosphorylated at Ser-2 (Li et al., 2002), and mutations in SET2 enhance basal expression of GAL4 (Landry et al., 2003) and render yeasts resistant to 6azauracil, an inhibitor of transcription elongation (Kizer et al., 2005; Morillon et al., 2005). Set1 in S. cerevisiae, by contrast, methylates K4 (Roguev et al., 2001; Briggs et al., 2001) and associates through Paf1 with RNAPII phosphorylated at Ser-5 that is located proximal to the promoter (Krogan et al., 2003). Mammalian MLL1, which has a SET domain very similar to Set1 (Milne et al., 2002; Nakamura et al., 2002), also associates via Menin with RNAPII phosphorylated at Ser-5 located in the 5′ end of genes (Hughes et al., 2004). These observations led to a suggestion that differential methylation of K4 and K36 is associated with different stages of transcription cycle. However, K36 methylation is not always linked to transcription elongation since K36 methylation is found in the promoter (Morillon et al.,

162

Y. Tanaka et al. / Gene 397 (2007) 161–168

2005) and human NSD1, that methylates histone H3 K36 and histone H4 K20, is recruited to nuclear receptor complexes at the promoter (Rayasam et al., 2003). Mammals have multiple proteins that share high homology with yeast Set2 in their methyltransferase domains, including NSD1, WHSC1 (MMSET, NSD2), WHSC1L1 (NSD3), and ASH1 (Glaser et al., 2006). The ash1 gene has been identified first by genetic screens of Drosophila melanogaster defective in imaginal discs late in development (Shearn et al., 1971). Cloning of Drosophila ash1 gene has revealed multiple domains such as a SET domain, a PHD zinc finger, and a BAH domain that could be involved in chromatin regulation (Tripoulas et al., 1996). Mouse and human ash1 genes have also been cloned by us (AF247132) and others (Nakamura et al., 2000). Mammalian ASH1 differs from its fly homologue in the N-terminal region and additionally has a Bromodomain as illustrated in Fig. 1A. Recently, Beisel et al. have shown that Drosophila ASH1 methylates histone H3 K4 and K9 as well as histone H4 K20 (Beisel et al., 2002), whereas Byrd and Shearn reported that histone H3 K4 but not other lysine is methylated by ASH1 in vitro and K4 methylation is specifically reduced in ash1 mutant flies in vivo (Byrd and Shearn, 2003). Nevertheless, primary structures of ASH1 from insects, fish, and mammals are all highly homologous to each other and to those of NSD1 and Set2 that are known to methylate K36 (Supplementary Fig. 1). To elucidate molecular functions of mammalian ASH1, we set out to identify the target lysine residue(s) of its methyltransferase domain. Here we provide evidence that histone H3 K36, but not histone H3 K4 and K9 nor histone H4 K20, is methylated by mammalian and Drosophila ASH1. Our finding provides novel insight into the function of ASH1 through its K36-specific methyltransferase activity. Implications for mechanistic roles of ASH1 in gene regulation will be discussed in the context of multi-dimensional trx-G protein complexes.

2. Materials and methods 2.1. Construction of expression vectors Mono-cistronic vectors for mouse core histones were constructed by cloning each NdeI–BamHI PCR fragment amplified from I.M.A.G.E. clones 5150365 (H2A.1), 5036910 (H2B.2), 2076773 (H3.1), 1446370 (H4.1) into the same sites of pET24a (Novagen). Bi-cistronic vectors for H2A/H2B and H3/ H4 pairs were then derived by subcloning BglII–BamHI fragments of H2B and H4 into BamHI sites of pET24a-H2A and pET24a-H3 vectors, respectively. QuikChange Site-Directed Mutagenesis Kit (Stratagene) was used to introduce lysine to arginine substitutions of histone H3 at positions 4, 9, 27, 36, 37, and 79 and histone H4 at position 20. In addition to confirmation by sequencing the plasmids, mass spectrometric analysis of K4R and K36R mutants showed the absence of spectra corresponding to MARTK4QTAR and KSAPATGGVK36KPHR, respectively. Cloning of mouse ASH1 SET domain (1954–2285) is described elsewhere (Y.T. and D.K.). Coding sequences for SET domains of human MLL1 (3631–3970), human NSD1 (1728–2092), and Drosophila ASH1 (1201–1531) were obtained by RT-PCR and cloned into BamHI and NotI sites of pGEX6P-1 (Amersham). Mutation in the catalytic histidine of ASH1 SET domain was introduced as above. Expression vectors for SUV39H1 and G9a were kind gifts from Dr. Shinkai (Kyoto Univ., Japan), and Drosophila NAP1 expression vector was a kind gift from Dr. Kadonaga (Univ. California, USA). Oligonucleotides used for PCR cloning and site-directed mutagenesis are listed in Table 1. Eukaryotic expression vectors for human ASH1 were constructed by using full-length ash1 cDNA isolated from HeLa cells (8892 bp) and pCI-neo vector (Promega) as will be described elsewhere together with expression vectors for ASH1ΔC (1– 2050) and ASH1ΔN (1833–2964). The MLL1 expression vectors were kind gifts from Dr. Seto (Aichi Cancer Center

Fig. 1. Alignment of SET domains from Set2/ASH1 family proteins. (A) A schematic representation of the mouse Ash1 protein. An N-terminal region similar to human SET oncoprotein-binding protein (SEB) is indicated by a grey box, and a SET histone methyltransferase domain, a Bromodomain, a plant homeodomain (PHD)-like zinc finger, and a Bromo-adjacent homology (BAH) domain are shown in filled boxes. (B) Recombinant core histones were purified by column chromatography and reconstituted into nucleosomes in the presence of NAP1 by a salt dialysis method. Digestion with different amounts of micrococcal nuclease revealed the formation of mono-, di-, and tri-nucleosomes (indicated by +1, +2, and +3). Marker (M) was a 123 bp ladder. (C) Recombinant histone octamers with or without DNA in solution or as nucleosomes were treated with ASH1 SET domain and analysed by SDS-PAGE followed by CBB staining (CBB) and fluorography (Fluo). ASH1 preferentially methylates histone H3 in the context of nucleosomes. (D) Substitution of histidine 2113 with lysine in the ASH1 SET domain rendered the protein catalytically inactive, suggesting that the methyltransferase activity is accounted for by the ASH1 SET domain but not by other contaminating activities.

Y. Tanaka et al. / Gene 397 (2007) 161–168

163

Table 1 Oligonucleotide sequences for PCR and site-directed mutagenesis Gene

Forward

Reverse

H2A.1 H2B.2 H3.1 H4.1 MLL NSD1 WHSC1 K4R K9R K27R K36R K37R K79R K20R H2113K

CATATGTCTGGACGCGGAAAGCA CATATGCCTGAGCCCGCCAAG CATATGGCTCGTACTAAGCAGAC GCATATGTCTGGCAGAGGAAAGGGT TTCCATGGGATCCGAACCTAAAACAGTGGAAGAAGAG GGATCCGCTTTTCATCGTGAATGCCTGAAC GGATCCGCCTTCCACCCTGACTGCCTGA ATGGCTCGTACTAGGCAGACCGCTCGCAA AGCAGACCGCTCGCAGGTCCACCGGTGGCAA AAGGCCGCCCGCAGGAGCGCCCCGG ACCGGCGGCGTGAGGAAGCCTCACCGCTA GGCGGCGTGAAGAGGCCTCACCGCTAC GATCGCGCAGGACTTCAGGACCGACCTGCGCTTC CAAGCGCCATCGCAGAGTCTTGCGTGACAAC AATGAGGCCAGATTCATCAACAAAAGCTGTGACCCAAATTGTGAA

GGATCCTTACTTCCCCTTGGCCTTGTG GGATCCTCACTTGGAGCTGGTGTACT GGATCCTTACGCCCTCTCCCCGCGA GGATCCTAGCCTCCGAAGCCGTAG TTGCGGCCGCTTAGTTTAGGAACTTTCCGGC GCGGCCGCTACGTGGCAATGGGTTGATTCTTTG GCGGCCGCTATGAAAGGGTCGTCGAGGTCTTTG TTGCGAGCGGTCTGCCTAGTACGAGCCAT TTGCCACCGGTGGACCTGCGAGCGGTCTGCT CCGGGGCGCTCCTGCGGGCGGCCTT TAGCGGTGAGGCTTCCTCACGCCGCCGGT GTAGCGGTGAGGCCTCTTCACGCCGCC GAAGCGCAGGTCGGTCCTGAAGTCCTGCGCGATC GTTGTCACGCAAGACTCTGCGATGGCGCTTG TTCACAATTTGGGTCACAGCTTTTGTTGATGAATCTGGCCTCATT

Research Institute, Japan) and Dr. Hess (Univ. of Pennsylvania School of Medicine, USA). 2.2. Expression and purification of recombinant human histones Recombinant histones were produced according to Kadonaga's method (Levenstein and Kadonaga, 2002) with the following modifications. Escherichia coli BL21 (DE3) cells were transformed with core histone expression vectors and grown to OD600 = 0.6 at 37 °C at which time IPTG was added to 0.4 mM (final concentration). Cells were incubated for further 3 h at 37 °C, collected by centrifugation at 10,000 rpm for 5 min at 4 °C in MX-300 (TOMY, Japan), and resuspended in 30 mM Tris–HCl (pH 8.0), 1 mM EDTA, 20% sucrose, and left for 10 min on ice. Cells were then resuspended in ice-cold H2O, incubated for 30 min, and resuspended again in 20 mM Tris– HCl (pH 7.9), 0.5 M NaCl, 0.2 mM EDTA, 0.1 mg/ml lysozyme, 1% β-mercaptoethanol, 1 mM PMSF, and 1 mM DTT. After incubation for 10 min on ice, solutions were frozen at − 80 °C for 30 min, thawed, and insoluble inclusion bodies were collected by centrifugation at 15,000 rpm for 10 min using a JA-25.50 rotor in Avanti HP-25 (Beckman). Pellets were dissolved in 0.25 N HCl by Dounce homogenizer, incubated for 30 min at − 20 °C, and cleared by centrifugation at 10,000 rpm for 10 min at 4 °C in MX-300. Supernatants were neutralized with 0.25 volumes of 1 N KOH and 1 M Hepes–KOH (pH 7.6), filtered through 0.22 μm filters (Millipore), and subjected to chromatography using an HS cation exchange column on BioCAD Perfusion Chromatography Workstation (BioRad). Briefly, samples were applied to the column in a buffer containing 10 mM Hepes–KOH (pH 7.6), 1 mM DTT, and 100 mM NaCl, washed with 5 column volumes of the same buffer, and eluted with a linear gradient from 0.1 to 2.0 M NaCl over 30 column volumes. Peak fractions were pooled and dialysed against 10 mM Hepes–KOH (pH 7.6), 1 mM DTT, 100 mM NaCl, 0.01% Nonidet P-40, and 10% glycerol, and subsequently concentrated by Vivaspin (MCF 30 KDa, Sartorius).

2.3. In vitro reconstitution of nucleosomes Recombinant His-tagged Drosophila NAP1 was expressed in Sf9 cells according to Kadonaga's protocol (Levenstein and Kadonaga, 2002). After binding to Ni-NTA agarose and elution with imac-200, proteins were diluted with 20 mM Tris–HCl (pH7.9), filtrated through 0.22 μm membranes, and applied to an HQ anion exchange column (BioRad) pre-equilibrated with 20 mM Tris–HCl (pH7.6), 100 mM NaCl, and 1 mM DTT. HisNAP1 was then eluted by a linear gradient of 0.1 to 1 M NaCl, and peak fractions were dialysed against 10 mM Hepes–KOH (pH7.6), 10 mM KCl, 1.5 mM MgCl2, 1 mM DTT, 0.1 M NaCl, 0.01% Nonidet P-40, and 10% glycerol followed by concentration using Vivaspin 20 (Sartorius). Recombinant core histones (7.5 μg each) were mixed with 15 μg supercoiled pBluescript DNA, 60 μg His-NAP1 in 10 mM Tris–HCl (pH7.6), 1 mM DTT, 1 mM EDTA, 10 mg BSA, 2.5 M NaCl, and 0.05% Nonidet P-40. Solutions were dialysed sequentially against 2, 1.5, 1, 0.5, 0.4, 0.3, 0.2, 0.1, and 0.05 M NaCl in the same buffer over a period of 2 days, and snap-frozen in liquid nitrogen in aliquots. Nucleosome assembly was assessed by digestion with micrococcal nuclease in 10 mM Hepes–KOH (pH7.6), 10 mM KCl, 1.5 mM MgCl2, 1 mM DTT, and 10% glycerol for 10 min at 25 °C. Reaction was stopped by addition of 0.2 volumes of 4% SDS and 100 mM EDTA, extracted with phenol and chloroform, ethanol precipitated, and analysed by agarose gel electrophoresis. 2.4. Methyltransferase assay In vitro methyltransferase reaction was carried out in 25 μl reaction mixtures containing 4 μg of core histones (1 μg each), 5 μl GST-SET domain proteins bound to Glutathione– Sepharose beads (1–10 μg proteins), 50 mM Tris–HCl (final pH in a range from 8 to 10), 0.04 mM ZnCl2, 1 mM MgCl2, 1 mM DTT, and 50 μM (62.5 nCi) S-adenosyl-[methyl-14C]-lmethionine, with or without 1 μg DNA for 1–2 h at 37 °C or 30 °C (for Drosophila ASH1). DNA was supplied only in reactions for ASH1 and as a mixture of DNA and histones rather

164

Y. Tanaka et al. / Gene 397 (2007) 161–168

than nucleosomes unless otherwise specified. Samples were then separated by 16% SDS-polyacrylamide gel electrophoresis and stained with Coomassie Brilliant Blue R-250, and fluorography was performed using BAS-2500 image analyser (Fuji Film, Japan).

are preferred targets of mammalian ASH1. The observed methyltransferase activity was dependent on the recombinant ASH1 SET domain and not on any contaminating activity in the protein preparation, because a mutation in the conserved histidine of the ASH1 SET domain (H2113K) abrogated the methyltransferase activity for nucleosomal histones (Fig. 1D).

2.5. Mass spectrometry 3.2. Mammalian ASH1 methylates histone H3 K36 Methyltransferase assay was carried out as above using cold S-adenosyl-l-methionine, and proteins were separated by SDSPAGE. After CBB staining, bands containing histone H3 were excised and incubated sequentially with either H2O (3 times), acetonitrile, 100 mM NH4HCO3, 100% and acetonitrile, or 50% acetonitrile in 50 mM NH4HCO3, 2:5 mixture of 30% (w/v) propionic anhydride in methanol and 50 mM NH4HCO3 (30 min on ice), 50% methanol in 50 mM NH4HCO3 (4 washes), 50 mM NH4HCO3 (3 washes), 100 mM NH4HCO3 (3 washes), and acetonitrile. Subsequently, samples were digested with either 1 pmol Arginine-C endopeptidase or 1–5 pmol trypsin in 0.1% TFA and 10 mM NH4HCO3. Samples digested with Arginine-C endopeptidase were concentrated using ZipTip C18 hydrophobic columns (Millipore) by washing with 0.1% TFA and eluting with 70% acetonitrile and 0.1% TFA. Peptides were co-crystallized with alpha-cyano-4-hydroxy cinnamic acid on a sample plate and analysed by Voyager MALDI-ToF mass spectrometer (Applied Biosystems).

To determine the target lysine of mammalian ASH1, we generated a series of histone H3 and H4 mutants bearing lysine to arginine substitutions at one of the positions known to be methylated by SET domain proteins, and carried out histone methyltransferase assays using mixtures of core histones and DNA. The N-terminal tails of histone H3 and H4 consist of many charged residues, and therefore we preserved the net charge of mutant histones by substituting lysine with arginine. As shown in Fig. 2A, methylation of histone H3 by mammalian ASH1 was completely abolished for the K36R mutant but not for the K4R, K9R, K27R, K37R, or K79R mutants. Since K36R mutant histones could be methylated by MLL1 (data not shown), protein misfolding cannot be the reason why ASH1 failed to methylate K36R. In contrast to Drosophila ASH1, mammalian ASH1 did not methylate histone H4 and was not

2.6. Western blot analysis After SDS-PAGE, histones were blotted onto PVDF membranes (Immobilion P, Millipore) by semi-dry or wet transfer methods. Membranes were then blocked with 5% skim milk in TBST (20 mM Tris–HCl, pH7.5, 135 mM NaCl, 0.1% Tween-20), incubated sequentially with anti-dimethyl histone H3 antibodies (Abcam and Upstate) and HRP-conjugated antirabbit immunoglobulin antibodies. Native histones from calf thymus (Roche) were used as positive controls. Western Blotting Luminol Reagent (Santa Cruz, USA) and West Femto Maximum Sensitivity Substrate (PIERCE, UK) were used to visualise antigenic proteins. 3. Results 3.1. Nucleosomes reconstituted from recombinant mouse histones are efficient targets of mammalian ASH1 Our preliminary experiments suggested that mammalian ASH1 can methylate histone H3 but only when provided with DNA (data not shown). To test if ASH1 is a nucleosomespecific methyltransferase, we prepared mammalian recombinant core histones and reconstituted nucleosomes in vitro (Fig. 1B). Subsequently, we compared histone octamers (without DNA), a mixture of histone octamers and DNA, and reconstituted nucleosomes for their potential to be methylated by mammalian ASH1. As depicted in Fig. 1C, mammalian ASH1 methylated histone H3 in nucleosomes more efficiently than those in a mixture with DNA, suggesting that nucleosomes

Fig. 2. Histone lysine scanning mutation analysis. (A) A panel of histone mutants was generated by substituting lysine with arginine at histone H3 K4, K9, K27, K36, K37 and K79, and histone H4 K20. Purified core histones were incubated with SET domains from ASH1. ASH1 methylated all but K36R mutant histones suggesting that K36 is the target of ASH1. (B) Schematic illustration of ASH1 and its deletion mutants. (C) Western blot analysis using anti-FLAG antibodies for stable HeLa cell lines expressing either one of FMLL1, F-ASH1, F-ASH1ΔC, or F-ASH1ΔN. Only F-MLL1 (⁎) and FASH1ΔN (⁎⁎) were detected at predicted molecular sizes. (D) Histone methyltransferase assay for anti-FLAG immunoprecipitates from mock or FASH1ΔN stable cell lines. The F-ASH1ΔN protein complex can methylate wildtype histone H3 but fails completely to methylate K36R suggesting that K36 is the only target of F-ASH1ΔN.

Y. Tanaka et al. / Gene 397 (2007) 161–168

affected by the K20R mutation of histone H4. Similar analysis for SUV39H1, G9a, and NSD1 revealed methyltransferase specificities identical to those reported previously by others

165

(Rea et al., 2000; Tachibana et al., 2001; Rayasam et al., 2003), suggesting that the lysine scanning mutation analysis is a sufficiently reliable method to determine the enzyme specificity.

Fig. 3. Identification of lysine residues methylated by ASH1. (A) Recombinant histones untreated (rec) or treated with ASH1 SET domain in reaction buffers at pH 9, 10, 11 were analysed along with native histones from calf thymus (nat). Shown are Ponceau staining of the membrane and Western blot using an antibody against histone H3 di-methylated at K36 (H3-K36dm). (B) Control histone H3 or those treated with ASH1 were digested with Arginine-C endopeptidase and subjected to MALDI-ToF mass spectrometry. Indicated above the control spectra are positions of peptides derived from histone H3. Samples treated with ASH1 gave rise to an additional spectrum corresponding to di-methylated peptide 27–40. (C) Control and ASH1-treated histone H3 were first acylated by propionic acid and then digested with trypsin. A parental spectrum corresponding to propionylated peptide 27–40 is indicated above the control. ASH1-treated samples gave rise to two additional spectra each corresponding to propionylated–mono-methylated and di-methylated peptide 27–40.

166

Y. Tanaka et al. / Gene 397 (2007) 161–168

The observation that the mutation of K36 completely blocked the methyltransferase activity of mammalian ASH1 allows us to conclude that K36 is the only target of mammalian ASH1. To test if native ASH1 proteins in vivo are also specific for K36, we first raised polyclonal antibodies against the carboxyterminal end of mammalian ASH1 to purify the enzyme complexes from a human erythroleukaemia cell line K562. The antibodies, however, could not detect ASH1 proteins of a predicted molecular weight by Western blot analysis (data not shown). Therefore, to facilitate purification of ASH1 proteins from mammalian cells, we next constructed eukaryotic expression vectors for ASH1 with a FLAG-tag attached to its aminoterminal end (F-ASH1 in Fig. 2B). Subsequently, HeLa cells, which express relatively low levels of endogenous ash1 transcripts, were transfected stably with either FLAG-tagged ASH1 or MLL1 as a control, and subjected to Western blot analysis. As depicted in Fig. 2C, anti-FLAG antibodies revealed F-MLL1 (marked by an asterisk) but not F-ASH1, suggesting that ASH1 proteins may be very low in amount and/or posttranslationally processed into smaller polypeptides like MLL1. To test such a possibility, we constructed expression vectors for truncated ASH1 proteins consisting of either amino-terminal 2050 amino acids (F-ASH1ΔC) or carboxy-terminal 1132 amino acids (F-ASH1ΔN) as illustrated in Fig. 2B. Western blot analysis of HeLa cells transfected stably with these vectors showed that FASH1ΔN (double asterisk in Fig. 2C) but not F-ASH1ΔC can be expressed as polypeptides with predicted molecular weight, suggesting that the amino-terminal part may regulate stability and/or processing of ASH1 proteins. F-ASH1ΔN, that can be expressed at high levels in HeLa cells, contains all sequence motifs including the SET domain that are not only evolutionarily conserved but also sufficient for specific transactivation of target genes (Y. T., unpublished). Thus, we purified F-ASH1ΔN protein complexes by anti-FLAG beads and carried out in vitro histone methyltransferase assay using either wildtype histone H3 or K36R. As shown in Fig. 2D, only those HeLa cells which were transfected with F-ASH1ΔN expression vectors contained a methyltransferase activity for histone H3. In addition, K36R could not be methylated by immunoprecipitates from HeLa cells expressing F-ASH1ΔN, supporting the hypothesis that ASH1 is specific for histone H3 lysine 36. 3.3. Mammalian ASH1 di-methylates histone H3 K36 Lysine ε-amino groups could be mono-, di-, or trimethylated, which could trigger different biological consequences (Santos-Rosa et al., 2002; Kuzmichev et al., 2004). To determine the order of K36 methylation by mammalian ASH1, recombinant core histones were first subjected to Western blot analysis using methyl-K36-specific antibodies. Fig. 3A shows that the polyclonal antibody reacted with native histones (positive control) but not with unmodified recombinant histone H3. Histone H3 treated with mammalian ASH1 at pH9, 10, and 11 was also recognised by the antibody, suggesting that ASH1 di-methylates histone H3. To further identify methylated lysine residues, we carried out mass spectrometric analysis of peptide fragments derived from

Fig. 4. Histone lysine scanning mutation assay for Drosophila ASH1. Methyltransferase activity of Drosophila ASH1 was measured using a panel of histone mutants carrying lysine to arginine substitutions at position 4, 9, 27, 36, and 37 of histone H3. Drosophila ASH1 methylated wildtype and all but K36R mutant histones suggesting that K36 is its specific target.

methylated recombinant histone H3. Control and ASH1-treated histone H3 were digested with Arginine-C endopeptidase and subjected to MALDI-ToF analysis. As shown in Fig. 3B, Arginine-C digestion produced several histone H3-derived spectra. K36 is contained in the peptide 27–40 (m/z 1433.8341). ASH1-treated samples but not controls gave rise to an additional mono-isotopic peak at m/z 1461.8220 that is consistent with di-methylated peptides. Propionylation and trypsinisation also produced robust histone-derived spectra as illustrated in Fig. 3C. In ASH1-treated samples, parental monoisotopic peak at m/z 1602.6588 as well as propionylated + mono-methylated (m/z 1616.8940) and di-methylated (m/z 1575.0187) species could be detected. Note that di-methylation but not mono-methylation of lysine inhibits propionylation. Taken together, these data are consistent with mono- or dimethylation of K36 by mammalian ASH1. 3.4. Histone H3 K36 is the specific target of Drosophila ASH1 Having established that mammalian ASH1 is specific for histone H3 K36, we next examined if Drosophila ASH1 targets the same lysine residue in our in vitro experimental condition. To this end, we subcloned a region of Drosophila ASH1 SET domain corresponding to that of mammalian ASH1 into a GSTfusion expression vector. Fig. 4 shows a histone lysine scanning mutation assay using the Drosophila ASH1, and demonstrates that a substitution of histone H3 lysine 36 with arginine abolishes the methyltransferase activity of Drosophila ASH1. By contrast, mutations in lysine 4 or 9, that have been previously reported to be methylated by Drosophila ASH1 (Beisel et al., 2002; Byrd and Shearn, 2003), did not affect the methyltransferase activity. We observed no methylation of histone H4 that has been shown to be methylated also by Drosophila ASH1 (Beisel et al., 2002). Taken together, these data are consistent with our result of mammalian ASH1 and support the notion that ASH1 is a methyltransferase specific for histone H3 K36. 4. Discussion It has been previously reported that Drosophila ASH1 methylates histone H3 K4 and K9 as well as histone H4 K20 (Beisel et al., 2002), whereas another group found that it is only

Y. Tanaka et al. / Gene 397 (2007) 161–168

the methylation of histone H3 K4 which is reduced in the ash1 mutant flies (Byrd and Shearn, 2003). Added to such a controversy is our current finding that mammalian ASH1 methylates histone H3 K36 but not any other lysine residues under in vitro experimental conditions. We substantiated our conclusion by histone lysine mutation assays (Fig. 2) and direct identification of methylated lysine 36 by Western blot (Fig. 3A) and mass spectrometric analyses (Fig. 3B, C). Single mutation in the histone H3 K36 also abolished the methyltransferase activity of Drosophila ASH1 in our hands (Fig. 4), strongly suggesting that K36 is the only target of Drosophila ASH1. Consistent with our finding that ASH1 does not methylate H4 K20, Drosophila ASH1 has been shown to play a minor role, if any, in methylation of H4 K20 in vivo, since mutations in the CG3307, a homologue of mammalian PR-SET7, abolishes H4 K20 methylation in larva (Nishioka et al., 2002). It is of note that neither of the previous studies have formally ruled out K36 methylation by Drosophila ASH1. Thus, K36 methylation by ASH1 was not assessed in Sauer's report. Shearn's group, on the other hand, analysed levels of dimethyl-K36 in ash1 mutant flies and found no reduction. However, Drosophila has another candidate of K36 methyltransferase, i.e. Mes-4, a homologue of NSD1, and therefore defects in the ash1 alone may not have caused global reduction in K36 methylation. Also of note is that the recombinant ASH1 SET domain (149 amino acids) had rather weak methyltransferase activities even for K4 in their study, whereas our deletion analysis shows that the minimal size of the catalytically active mammalian ASH1 SET domain is 257 amino acids including both pre-SET and post-SET domains (Y. T., manuscript in preparation). Drosophila ASH1 used in the current study was 331 amino acids in length including both preand post-SET domains. Under our specific experimental conditions, therefore, these data are most consistent with the hypothesis that ASH1 specifically targets histone H3 K36. However, given precedence such as EZH2 that alters its target specificity depending on components of its multi-protein complex (Kuzmichev et al., 2004), an ultimate test for the physiological target(s) of mammalian ASH1 may require isolation of ASH1 complexes from cells and/or determination of histone methylation of specific ASH1 target genes in vivo. As a first step towards such a direction, we have shown that ASH1ΔN proteins containing carboxy-terminal SET, Bromo, PHD, and BAH domains exhibit a strong preference for K36. In the current study, we succeeded for the first time in detecting mono- and di-methylated forms of K36 by mass spectrometric analysis after treatment with mammalian ASH1. Although mammalian cells contain mono-, di-, and trimethylated forms of K36, very little is known about the pattern of K36 methylation in vivo. The presence of multiple K36 methyltransferases in mammals as suggested by the current study raises an intriguing possibility that mono-, di-, or trimethylation of K36 might be mediated by distinct enzymes. In the yeast, di-methylation of K36 by Set2 has been shown to play a role in negative regulation of transcription elongation (Strahl et al., 2002; Landry et al., 2003; Kizer et al., 2005; Morillon et al., 2005). By contrast, several lines of evidence in both flies and mammals suggest that ASH1 may be involved in gene

167

activation by interacting with trithorax-group protein complexes. For instance, intercrossing ash1 and trithorax mutant flies enhances penetrance of homeotic phenotypes caused by reduced expression of select Hox genes (Tripoulas et al., 1996). Also, Drosophila discs small, absent, or homeotic-2 (ash2) interacts genetically with both ash1 and trithorax (Shearn, 1989), where mammalian homologues of trithorax form distinct multi-protein complexes containing ASH2 (Wysocka et al., 2003; Hughes et al., 2004). Since ASH1 is preferentially expressed in immature haematopoietic stem cell populations for which MLL1 is known to play an essential role (Park et al., 2002), it is tempting to speculate that in mammals differential methylation of K4 and K36 during transcription elongation is regulated by distinct trithorax-group protein complexes represented by MLL and ASH1 subfamily proteins. Elucidating molecular functions of ASH1, therefore, may facilitate our understanding of the biological function of MLL family proteins that are frequently involved in chromosomal translocations in human leukaemia and cancers. For instance, it is now possible to assess if K36 methylation has any impact on regulation of Hox genes by MLL1 in the context of both normal haematopoiesis and leukaemogenesis. Acknowledgements We thank Drs. Kadonaga and Fyodorov for reagents and advice for in vitro reconstitution of nucleosomes, Dr. Shinkai for expression vectors for SUV39H1 and G9a expression vectors, Dr. Seto and Dr. Hess for MLL expression vectors. This work was supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, Sports, Culture and Technology of Japan to S. K. (1713030). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.gene.2007.04.027. References Beisel, C., Imhof, A., Greene, J., Kremmer, E., Sauer, F., 2002. Histone methylation by the Drosophila epigenetic transcriptional regulator Ash1. Nature 419, 857–862. Briggs, S.D., et al., 2001. Histone H3 lysine 4 methylation is mediated by Set1 and required for cell growth and rDNA silencing in Saccharomyces cerevisiae. Genes Dev. 15, 3286–3295. Byrd, K.N., Shearn, A., 2003. ASH1, a Drosophila trithorax group protein, is required for methylation of lysine 4 residues on histone H3. Proc. Natl. Acad. Sci. U. S. A. 100, 11535–11540. Glaser, S., et al., 2006. Multiple epigenetic maintenance factors implicated by the loss of Mll2 in mouse development. Development 133, 1423–1432. Hughes, C.M., et al., 2004. Menin associates with a trithorax family histone methyltransferase complex and with the Hoxc8 locus. Mol. Cell 13, 587–597. Jenuwein, T., Allis, C.D., 2001. Translating the histone code. Science 293, 1074–1080. Kizer, K.O., Phatnani, H.P., Shibata, Y., Hall, H., Greenleaf, A.L., Strahl, B.D., 2005. A novel domain in Set2 mediates RNA polymerase II interaction and couples histone H3 K36 methylation with transcriptional elongation. Mol. Cell. Biol. 25, 3305–3316.

168

Y. Tanaka et al. / Gene 397 (2007) 161–168

Krogan, N.J., et al., 2003. The Paf1 complex is required for histone H3 methylation by COMPASS and Dot1p: linking transcriptional elongation to histone methylation. Mol. Cell 11, 721–729. Kuzmichev, A., Jenuwein, T., Tempst, P., Reinberg, D., 2004. Different Ezh2containing complexes target methylation of histone H1 or nucleosomal histone H3. Mol. Cell 14, 183–193. Landry, J., et al., 2003. Set2-catalyzed methylation of histone H3 represses basal expression of GAL4 in Saccharomyces cerevisiae. Mol. Cell. Biol. 23, 5972–5978. Levenstein, M.E., Kadonaga, J.T., 2002. Biochemical analysis of chromatin containing recombinant Drosophila core histones. J. Biol. Chem. 277, 8749–8754. Li, J., Moazed, D., gygi, S.P., 2002. Association of the histone methyltransferase Set2 with RNA polymerase II plays a role in transcription elongation. J. Biol. Chem. 277, 49383–49388. Milne, T.A., et al., 2002. MLL targets SET domain methyltransferase activity to Hox gene promoters. Mol. Cell 10, 1107–1117. Morillon, A., Karabetsou, N., Nair, A., Mellor, J., 2005. Dynamic lysine methylation on histone H3 defines the regulatory phase of gene transcription. Mol. Cell 18, 723–734. Nakamura, T., et al., 2000. huASH1 protein, a putative transcription factor encoded by a human homologue of the Drosophila ash1 gene, localizes to both nuclei and cell–cell tight junctions. Proc. Natl. Acad. Sci. U. S. A. 97, 7284–7289. Nakamura, T., et al., 2002. ALL-1 is a histone methyltransferase that assembles a supercomplex of proteins involved in transcriptional regulation. Mol. Cell 10, 1119–1128. Nishioka, K., et al., 2002. PR-Set7 is a nucleosome-specific methyltransferase that modifies lysine 20 of histone H4 and is associated with silent chromatin. Mol. Cell 1201–1213. Park, I.-K., et al., 2002. Differential gene expression profiling of adult murine hematopoietic stem cells. Blood 15, 488–498.

Rayasam, G.V., et al., 2003. NSD1 is essential for early post-implantation development and has a catalytically active SET domain. EMBO J. 22, 3153–3163. Rea, S., et al., 2000. Regulation of chromatin structure by site-specific histone H3 methyltransferases. Nature 406, 593–599. Roguev, A., et al., 2001. The Saccharomyces cerevisiae Set1 complex includes an Ash2 homologue and methylates histone 3 lysine 4. EMBO J. 20, 7137–7148. Santos-Rosa, H., et al., 2002. Active genes are tri-methylated at K4 of histone H3. Nature 419, 407–411. Shearn, A., Rice, T., Garen, A., Gehring, W., 1971. Imaginal disc abnormalities in lethal mutants of Drosophila. Proc. Natl. Acad. Sci. U. S. A. 68, 2594–2598. Shearn, A., 1989. The ash-1, ash-2, and trithorax genes of Drosophila melanogaster are functionally related. Genetics 121, 517–525. Strahl, B.D., Allis, C.D., 2000. The language of covalent histone modifications. Nature 403, 41–45. Strahl, B.D., et al., 2002. Set2 is a nucleosomal histone H3-selective methyltransferase that mediates transcriptional regulation. Mol. Cell. Biol. 22, 1298–1306. Tachibana, M., Sugimoto, K., Fukushima, T., Shinkai, Y., 2001. Set domaincontaining protein, G9a, is a novel lysine-preferring mammalian histone methyltransferase with hyperactivity and specific selectivity to lysines 9 and 27 of histone H3. J. Biol. Chem. 25309–25317. Tripoulas, N., LaJeunesse, D., Gildea, J., Shearn, A., 1996. The Drosophila ash1 gene product, which is localized at specific sites on polytene chromosomes, contains a SET domain and a PHD finger. Genetics 143, 913–928. Wysocka, J., Myers, M.P., Laherty, C.D., Eisenman, R.N., Herr, W., 2003. Human Sin3 deacetylase and trithorax-related Set1/Ash2 histone H3-K4 methyltransferase are tethered together selectively by the cell-proliferation factor HCF-1. Genes Dev. 17, 896–911.