- Email: [email protected]
TROMB, a new retrotransposon of the gypsy–Ty3 group from the fly Megaselia scalaris
Gene 255 (2000) 51–57 www.elsevier.com/locate/gene
TROMB, a new retrotransposon of the gypsy–Ty3 group from the fly Megaselia scalaris Garnet Suck, Walther Traut * Institut fu¨r Biologie, Medizinische Universita¨t zu Lu¨beck, D-23538 Lu¨beck, Germany Received 17 April 2000; received in revised form 28 June 2000; accepted 3 July 2000 Received by M. Schartl
Abstract We describe TROMB, a new LTR retrotransposon, from the phorid fly Megaselia scalaris. Three full-length copies (4226, 4160 and 4129 bp) and a truncated one (319 bp) have been isolated. The target site consensus is TATAT, with a 4 bp target site duplication TATA. The LTRs are short (142 bp) and contain a TATA-box and a polyadenylation signal. The isolated copies are degenerate to different degrees and presumably inactive. The polyprotein coding sequence contains scattered stop codons and deletions/insertions at non-homologous positions. The consensus sequence among the three full-length copies, however, has an uninterrupted open reading frame and, presumably, represents the original sequence of the active element. Southern hybridization experiments showed TROMB to be present at a low copy number in two wild-type strains of M. scalaris and absent in a related species, M. abdita. The order of domains in the polyprotein coding region, the target site specificity for AT-rich sequences, and the protein sequence similarity to blastopia, mdg3 and micropia place TROMB in the gypsy–Ty3 group of LTR retrotransposons. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Blastopia; mdg3; Micropia; Transposable element
1. Introduction LTR retrotransposons are the most complex transposable elements. They resemble retrovirus organization and gene content. The distinguishing feature is the infectiousness of retroviruses. Retrotransposons, except for rare cases of horizontal transfer (Jordan et al., 1999), cannot actively leave the cell line once invaded and enter other cells. Three fates are possible: transposition, excision (a recombination event between its 3∞ and 5∞ LTR, leaving ‘solo LTRs’ behind) or mutation (Promislow et al., 1999). The phorid fly Megaselia scalaris has a peculiar system of primary sex determination. Male sexual develAbbreviations: aa, amino acid(s); bp, base pair(s); CO, core protein(s); IN, integrase; IR, inverted repeat; kb, kilobase(s) or 1000 bp; LTR, long terminal repeat; NC, nucleocapsid; ORF, open reading frame; PBS, minus strand primer binding site; PCR, polymerase chain reaction; pos, position(s); PPT, polypurine tract (=plus strand priming site); PR, protease; pt, putative tether; RH, ribonuclease H; RT, reverse transcriptase; u, unidentified protein. * Corresponding author. Tel.: +49-451-5004100; fax: +49-451-5004815. E-mail address: [email protected] ( W. Traut)
opment is triggered by the Maleness factor, M (Mainx, 1964). M can alter its location in the genome; it displays a transposon-like behaviour with a low frequency of transposition (Traut and Willhoeft, 1990; Traut, 1994). Since the location of M defines the functional Y chromosome, strains with recently created Y chromosomes, e.g. ‘Except1’, and strains such as ‘Wien’ and ‘Florida’ with old Y chromosomes, coexist. Our interest in the sex determination of M. scalaris prompted an investigation of the yet unknown transposable elements in this species. In this paper, we describe a new low-copy retrotransposon, TROMB, of the gypsy–Ty3 group.
2. Materials and methods 2.1. Animals We studied M. scalaris Loew wild-type strains ‘Wien’ (provided by R. Springer, Wien, Austria) and ‘Florida’ (provided by A. Handler, Gainesville, FL) and a strain, ‘Except1’, with a new Y chromosome derived from chromosome 3 ( Traut and Willhoeft, 1990). M. abdita
0378-1119/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S0 3 7 8 -1 1 1 9 ( 0 0 ) 0 0 31 1 - 5
52
G. Suck, W Traut / Gene 255 (2000) 51–57
Schmitz was a gift from U. Schmidt-Ott (Go¨ttingen, Germany). Megaselia was cultured as described by Willhoeft and Traut (1990). Samples of 200 to 800 female and male flies were used for DNA isolation according to Blin and Stafford (1976). 2.2. Genomic library Genomic DNA was isolated from the anterior half of male pupae (see Beye et al., 1998), partially digested with Sau3AI, ligated into sCos-1 ( Evans et al., 1989) and packaged using the GigapackIII Gold Kit (Stratagene) according to the manufacturer’s protocol. The library consisted of 2.4×104 clones, had an average insert size of 34 kb and represented about 2.5 genome equivalents (Megaselia genome size 3.3×108 bp; Traut and Willhoeft, 1990). 2.3. Sequencing and sequence comparison We used the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Applied Biosystems) and an ABI Prism Model 377 automated sequencer according to the manufacturer’s protocol (Applied Biosystems, Foster City, CA). Sequencing was performed by primer walking, each position was determined at least twice. Primers were custom synthesized by MWG Biotech ( Ebersberg, Germany). Sequence assembly, translation and alignment were done with ASSEMBLE, SEQUENCE (programs written by W.T.) and CLUSTALW ( Thompson et al., 1994), using the default parameters and manual correction. Similarity was defined as the fraction of positives in the BLOSUM 62 matrix (Henikoff and Henikoff, 1992). Database searches were performed with BLASTP and TBLASTN, using default parameters. 2.4. Probes Probe pMSW2482 was generated by inverse PCR (Ochman et al., 1990) on circularized genomic EcoRI fragments of M. scalaris. Primers 2420f9 (5∞ GAATTTCAAACTAAAGAAAGCC 3∞) and 2420r9 (5∞ TTACTTCGATCAATTTGTATGG 3∞) for inverse PCR were defined on the basis of a previously detected malespecific fragment of M. scalaris. The 459 bp Int1 probe was generated by standard PCR on cosmid pMSW2506 DNA. Forward primer REF (5∞ GACGACAAATGGTTCAAAGC 3∞) and reverse primer REB (5∞ TAGCTTCATGTTATCGGAGG 3∞) were defined from the TROMB sequence contained in cosmid pMSW2506. PCR conditions were: 30 s initial denaturation at 94°C, 40 cycles with 30 s denaturing at 94°C, 1 min annealing at 56°C, 1 min extension at 72°C and a final 5 min extension step at 72°C.
3. Results and discussion 3.1. General description We detected the LTR of an unknown retrotransposon adjacent to a male-specific region in a cloned genomic sequence of M. scalaris, pMSW2482 ( EMBL accession number AJ277434), generated by inverse PCR as described in Section 2.4. Using this clone as a probe, we screened a cosmid library of M. scalaris and obtained 26 positives among 2.4×104 clones screened. Four of the positives were isolated: pMSW2506, pMSW2514, pMSW2515 and pMSW2509. They contained copies of a new retrotransposon, termed TROMB (transposon of Megaselia, blastopia-related ). The sequences of the four copies TROMB-Ms1, TROMB-Ms2, TROMB-Ms3 and TROMB-Ms4 were deposited in the databank ( EMBL accession numbers AJ277430, AJ277431, AJ277432 and AJ277433). TROMB-Ms1 turned out to be the Y-chromosomal copy and contained the complete sequence of the probe. Three copies, TROMB-Ms1, TROMB-Ms2 and TROMB-Ms3, are full-length retrotransposons of 4226, 4160 and 4129 bp, respectively, bounded at both ends by LTRs. TROMB-Ms4 is a truncated copy of 319 bp, with only one LTR and some adjacent retrotransposon sequence left. None of the copies contained a continuous open reading frame (ORF ) of the retrotransposon polyprotein. The ORFs are disrupted by stop codons, frameshifts, and deletions/insertions. When the sequences of the three full-length retrotransposons were aligned, however, the consensus sequence represented a reconstructed continuous ORF ( EMBL accession number ds42596, sequence alignment). Remaining nucleotide ambiguities at five positions (pos. 2066, 2101, 2286, 3800 and 3819 of the consensus sequence) were resolved by selecting the nucleotide that produced the best similarity to blastopia (Frommer et al., 1994). 3.2. LTRs All copies of TROMB have LTRs of 142 bp. The TROMB LTR is relatively short, other known LTRs have sizes from 77 bp up to 3.6 kb (Boeke and Stoye, 1997). The LTR sequence is well conserved among the TROMB copies. LTRs differ from one copy to another at six positions altogether (these are mutations that had occurred before insertion) and at four positions between the two LTRs of the same copies (these are mutations that had occurred after insertion). In the truncated element TROMB-Ms4, six more positions are affected. The LTRs are bounded by the 3 bp inverted repeat TGT/ACA ( Fig. 1, IR). This is a subset of the TG… /…CA motif which is also found in most vertebrate
G. Suck, W Traut / Gene 255 (2000) 51–57
53
Fig. 1. 5∞ LTR (upper case) and flanking sequence ( lower case) of the TROMB consensus sequence. Functional sites are underlined.
retrovirus LTRs and in some Drosophila retrotransposons (Bingham and Zachar, 1989). Among the functional elements commonly found in LTRs, the CAATbox is missing in the TROMB LTR. A putative TATAbox with similarity to the consensus sequence (Corden et al., 1980) is found at pos. 32 to 38 (all LTR positions according to Fig. 1). At pos. 49 to 56, a sequence is found with similarity to an initiator element containing a typical Drosophila core sequence, TCAT (Arkhipova, 1995), but considered dubious by us because of the short distance (11 bp instead of ~25 bp) from the putative TATA-box. There is a polyadenylation signal at pos. 83 to 88. A putative RNA termination signal conforming to the consensus TTGX (Lankenau et al., 1988) is present at pos. 115 to 118.
The minus strand primer binding site (PBS) following the 5∞ LTR is a putative tRNAPro PBS (Peters and Dahlberg, 1979) consisting of the sequence TGGGGGCTCAACCG (Figs. 1 and 2, PBS). The putative plus strand priming site (Fig. 2, PPT ), CAGAATGGCCGAT, is similar (10 of 13 positions identical ) to that defined in blastopia (Frommer et al., 1994). With one exception, the copies of TROMB are flanked by a target site duplication, TATA. The exception is an AATA sequence flanking the 5∞ end of TROMB-Ms1 (which may be an error in the duplication process or else a mutation introduced later). The consensus integration site sequence in TROMB is TATAT, which is similar to the YRYRYR consensus in gypsy elements (Dej et al., 1998).
Fig. 2. Organization of TROMB (A) and deviations of TROMB-Ms1 (B), TROMB-Ms2 (C ), TROMB-Ms3 (D) from the consensus TROMB sequence. Putative protein coding domains: CO, core proteins; NC, nucleocapsid; PR, protease-like protein; u, unidentified protein; RT, reverse transcriptase-like protein; pt, putative tether; RH, RNase H-like protein; IN, integrase-like protein. PPT, polypurine tract (=plus strand priming site); PBS, minus strand primer binding site; 3 deletion/insertion; * mutation to in-frame stop codon; ( synonymous mutation; , non-synonymous mutation and mutation in non-coding regions.
54
G. Suck, W Traut / Gene 255 (2000) 51–57
3.3. Protein domains The ORF of the consensus TROMB sequence encodes a putative retrotransposon polyprotein of 1308 aa. Using this sequence in a BLASTP and TBLASTN databank search including the Drosophila genome database, three LTR retrotransposons of the gypsy–Ty3 group, blastopia (Frommer et al., 1994; EMBL accession number Z27119), mdg3 (Avedisov and Ilyin, 1995; EMBL accession number X95908), and micropia (Lankenau et al., 1988; EMBL accession number X14037), received the highest scores. In pairwise alignments with the full aa sequences of the retrotransposons, TROMB shares 36, 33 and 27% identity and 56, 53 and 46% similarity to blastopia, mdg3 and micropia, respectively. Sequence comparison among the four retrotransposons revealed the presence of a typical set of protein domains (Fig. 2A) in the arrangement known from the gypsy–Ty3 group. Protein domain borders are defined on the basis of those published for blastopia (Frommer et al., 1994). When single protein domains of TROMB are compared with the homologous ones of blastopia, mdg3 and micropia, identities (similarities) range from 8% (24%) to 55% (76%) ( Table 1). Conservation is weaker on the 5∞ side of the polyprotein coding sequence (CO, NC, PR, u) than on the 3∞ side (RT, pt, RH, IN ). The nucleocapsid domain (Fig. 2, NC ) contains two zinc fingers (Fig. 3; aa pos. 268 to pos. 301) of the CCHC type, consistent with the CX CX HX C consen2 4 4 sus sequence (Covey, 1986). CCHC-boxes occur in most retrovirus and some retrotransposon nucleocapsid proteins (for a review see Doolittle et al., 1989). Mutagenesis experiments revealed a key role for these zinc finger domains in nucleocapsid function. They are required for packaging genomic RNA, establishing normal core morphology and the production of infectious viral particles (for a review see Darlix et al., 1995; Tanchou et al., 1998). The number of CCHC zinc fingers differs among retrotransposons. Blastopia and mdg3, like TROMB, have two zinc fingers. Other members of the gypsy–Ty3 group have one ( gypsy) or no (Ty3) CCHC-box (for a review see Doolittle et al., 1989). Table 1 Identity (similarity) between protein domains of TROMB and those of blastopia, mdg3 and micropia Domain
aa
Blastopia (%)
Mdg3 (%)
Micropia (%)
CO NC PR u RT pt RH IN
258 52 113 55 244 55 182 349
22 29 22 24 45 49 42 43
21 33 20 31 41 55 45 32
8 (25) 37 (52) 22 (44) 11 (24) 41 (60) 29 (55) 35 (58) 29 (49)
(43) (37) (41) (42) (70) (64) (61) (64)
(37) (56) (41) (49) (68) (76) (66) (50)
The integrase domain possesses a different zinc finger motif (aa pos. 970 to pos. 1008, Fig. 4). It is an HHCC zinc finger, compatible with the HX HX CX C 3–7 23–32 2 consensus sequence (Bushman et al., 1993). The HHCC motif is close to the DDE signature (aa pos. 1038 to pos. 1133, Fig. 4), which is widely distributed among transposable elements (for a review see Polard and Chandler, 1995). By site-directed mutagenesis experiments, the HHCC zinc finger domain and the DDE domain (a putative catalytic centre) together have been shown to be essential for integrase function (for a review see Brown, 1997). 3.4. Copy number EcoRI-restricted genomic DNA of females and males from wild-type strains ‘Wien’ and ‘Florida’ were hybridized with Int1, a probe whose sequence was derived from the integrase region of TROMB. The probe was designed to detect EcoRI fragments reaching from the last EcoRI site in TROMB to the first one outside TROMB, thus encompassing a constant segment from the 3∞ end of TROMB and a variable stretch of adjacent region. The probe detected 12, 14, nine and 13 fragments, respectively in DNA from ‘Wien’ females, ‘Wien’ males, ‘Florida’ females and ‘Florida’ males (Fig. 5). This gives a minimum estimate of the copy numbers in the two Megaselia strains. According to the signal intensities, some bands may represent more than one fragment. Two fragments in ‘Wien’ (or three if the 3.0 kb band in ‘Wien’ is a double band) and four in ‘Florida’ are malespecific, i.e. derived from the Y chromosome. This is roughly proportional to the fraction of Y-chromosomal DNA in the genome (three chromosomes in the haploid set), and indicates that there is no obvious clustering of TROMB in the Y chromosome. According to its size, the male-specific 1.1 kb fragment represents the Y-chromosomal TROMB-Ms1. In a similar experiment with genomic DNA from another Megaselia species, M. abdita, the probe did not detect any fragment (not shown). No sex-specific difference was seen in Southern hybridization to genomic DNA of ‘Except1’, a strain with a new Y chromosome (not shown). Hence, we did not detect an association of TROMB with the Maleness factor M. Two fragments (1.2 and 2.8 kb) from ‘Florida’ with stronger signals in the female lane are probably derived from the X chromosome. The result shows that TROMB is a low copy transposon in M. scalaris. In this respect it is similar to mdg3 with five to 18 copies (Belyaeva et al., 1984), blastopia with about 20 copies (Frommer et al., 1994), and micropia with 16 to 32 copies (Lankenau, 1993) in Drosophila melanogaster. In contrast, micropia is a high copy transposon in Drosophila hydei, but only with respect to the Y chromosome which harbours 50 to 100 copies. The X chromosome and the autosomes together contain only two to 11 copies (Lankenau et al., 1988).
G. Suck, W Traut / Gene 255 (2000) 51–57
55
Fig. 3. Alignment of putative retrotransposon nucleocapsid proteins containing the CCHC zinc finger motif. Positions with identical aa in all four proteins are printed inversely; those with similar aa are shaded.
Fig. 4. N-terminal segment of TROMB, blastopia, mdg3 and micropia integrases containing a HHCC zinc finger and the DDE signature to show identities (inverse) and similarities (shaded).
The three copies of TROMB found in the M. scalaris Y chromosome of the ‘Wien’ strain correlate to the low degree of Y chromosome differentiation in that strain ( Willhoeft and Traut, 1990). The fragment patterns of the two strains ‘Wien’ and ‘Florida’ are almost completely different (Fig. 5); only one fragment (1.1 kb) is possibly identical in the two strains. The different patterns are due to different integration sites of TROMB and/or to genomic differences resulting in restriction fragment length polymorphism. Data have been collected from 24 random single copy probes which were hybridized to EcoRI- or HindIIIrestricted DNA of the two M. scalaris strains (Sylvia Kuhn, Garnet Suck and Walther Traut, unpublished). The majority of fragments that were detected in the ‘Wien’ strain (34 of 45 fragments) are different from those in the ‘Florida’ strain. The result shows sufficient restriction fragment length polymorphism to explain the different band patterns between the two strains with the TROMB probe, but does not exclude transposition events. 3.5. Intragenomic evolution Fig. 5. TROMB in Megaselia scalaris strains ‘Wien’ and ‘Florida’. The Int1 probe was hybridized to EcoRI-restricted genomic DNA from female and male flies. Arrowheads point to Y-chromosomal fragments.
None of the three full-length copies studied has the coding capacity for the full set of proteins required for transposition. The coding region is interrupted at vari-
56
G. Suck, W Traut / Gene 255 (2000) 51–57
ous positions by stop codons, frameshifts and larger deletions of several base pairs. It is clear that these copies can no longer be active transposons, though they may still be transposable in trans. In retroviruses and LTR retrotransposons, frameshifting between gag and pol is a regular process (for a review see Capy et al., 1998). But in TROMB the consensus coding sequence for the polyprotein is free of frameshifts as well as stops; it has one continuous ORF. TROMB shares this property with blastopia, mdg3 and micropia. Each of the three copies of TROMB has its own set of stop codons, frameshifts and deletions/insertions besides synonymous and non-synonymous mutations at non-homologous positions ( Fig. 2). They include mutations before and after insertion. As shown for mutations in the LTRs (see Section 3.2), some of the mutations have probably arisen by mutational decay of the elements after insertion. Others have occurred before insertion, as the variation in the fraction of synonymous mutations in the polyprotein, 34, 27 and 62%, respectively in TROMB-Ms1, TROMB-Ms2 and TROMBMs3, indicates. 3.6. Classification The order of domains in the putative polyprotein coding sequence — the integrase is 3∞ of the reverse transcriptase — puts TROMB into the gypsy–Ty3 group, one of the two major groups (Ty1–copia/gypsy–Ty3) of LTR retrotransposons. Comparison of the reconstructed TROMB polyprotein sequence with that of other LTR retrotransposons revealed TROMB to be most closely related to three members of that group: blastopia, mdg3 and micropia (see Section 3.3). According to more recent data, some members of either group, e.g. SIRE-1 from soybean and gypsy from Drosophila, can no longer be considered genuine retrotransposons. The presence of env-like ORFs makes it possible that they are retroviruses (for a review see Peterson-Burch et al., 2000); gypsy in fact possesses infective properties ( Kim et al., 1994). According to the classification scheme proposed by Capy et al. (1998), the PR–RT–RH–IN order of protein domains in the polyprotein sequence, the minus strand priming by a tRNA primer and the missing env place TROMB — as well as blastopia, mdg3 and micropia — in the Ty3 superfamily of LTR retrotransposons. When a phylogenetic tree was constructed with aa alignments of the combined reverse transcriptase, RNaseH and integrase domains according to Malik and Eickbush (1999) of TROMB, mdg3, blastopia and micropia using Ty3 as an outgroup, TROMB formed the last branchpoint with blastopia (not shown).
Acknowledgements We thank Heidemarie Riechers, Sylvia Kuhn and Katja Andruleit for help with DNA sequencing,
Angelika Poleksic and Jan Meyer for Southern hybridization, and Dieter Weichenhan for providing sCos-1, for helpful advice in cosmid library construction and critical reading of the manuscript.
References Arkhipova, I.R., 1995. Promoter elements in Drosophila melanogaster revealed by sequence analysis. Genetics 139, 1359–1369. Avedisov, S.N., Ilyin, Yu.V., 1995. Retrotransposon mdg3 of Drosophila: general structure and functional domains of the full-length copy. Dokl. Biochem. 344, 160–163. Belyaeva, E.S., Ananiev, E.V., Gvozdev, V.A., 1984. Distribution of mobile dispersed genes (mdg-1 and mdg-3) in the chromosomes of Drosophila melanogaster. Chromosoma 90, 16–19. Beye, M., Poch, A., Burgtorf, C., Moritz, R.F., Lehrach, H., 1998. A gridded genomic library of the honeybee (Apis mellifera): a reference library system for basic and comparative genetic studies of a hymenopteran genome. Genomics 49, 317–320. Bingham, P.M., Zachar, Z., 1989. Retrotransposons and the FB transposon from Drosophila melanogaster. In: Berg, D.E., Howe, M.M. ( Eds.), Mobile DNA. American Society for Microbiology, Washington, DC, pp. 485–502. Blin, N., Stafford, D.W., 1976. A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res. 3, 2303–2308. Boeke, J.D., Stoye, J.P., 1997. Retrotransposons, endogenous retroviruses, and the evolution of retroelements. In: Coffin, J.M., Hughes, S.H., Varmus, H.E. ( Eds.), Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 343–435. Brown, P.O., 1997. Integration. In: Coffin, J.M., Hughes, S.H., Varmus, H.E. (Eds.), Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 161–203. Bushman, F.D., Engelman, A., Palmer, I., Wingfield, P., Craigie, R., 1993. Domains of the integrase protein of human immunodeficiency virus type 1 responsible for polynucleotidyl transfer and zinc binding. Proc. Natl. Acad. Sci. USA 90, 3428–3432. Capy, P., Bazin, C., Higuet, D., Langin, T., 1998. Dynamics and Evolution of Transposable Elements. Springer, Austin, TX. Corden, J., Wasylyk, B., Buchwalder, A., Sassone-Corsi, P., Kedinger, C., Chambon, P., 1980. Promoter sequences of eukaryotic proteincoding genes. Science 209, 1406–1414. Covey, S.N., 1986. Amino acid sequence homology in gag region of reverse transcribing elements and the coat protein gene of cauliflower mosaic virus. Nucleic Acids Res. 14, 623–633. Darlix, J.L., Lapadat-Tapolsky, M., de Rocquigny, H., Roques, B.P., 1995. First glimpses at structure–function relationships of the nucleocapsid protein of retroviruses. J. Mol. Biol. 254, 523–537. Dej, K.J., Gerasimova, T., Corces, V.G., Boeke, J.D., 1998. A hotspot for the Drosophila gypsy retroelement in the ovo locus. Nucleic Acids Res. 26, 4019–4025. Doolittle, R.F., Feng, D.F., Johnson, M.S., McClure, M.A., 1989. Origins and evolutionary relationships of retroviruses. Q. Rev. Biol. 64, 1–30. Evans, G.A., Lewis, K., Rothenberg, B.E., 1989. High efficiency vectors for cosmid microcloning and genomic analysis. Gene 79, 9–20. Frommer, G., Schuh, R., Jackle, H., 1994. Localized expression of a novel micropia-like element in the blastoderm of Drosophila melanogaster is dependent on the anterior morphogen bicoid. Chromosoma 103, 82–89. Henikoff, S., Henikoff, J.G., 1992. Amino acid substitution matrices from protein blocks. Proc. Natl. Acad. Sci. USA 89, 10 915–10 919. Jordan, I.K., Matyunina, L.V., McDonald, J.F., 1999. Evidence for the recent horizontal transfer of long terminal repeat retrotransposon. Proc. Natl. Acad. Sci. USA 96, 12 621–12 625.
G. Suck, W Traut / Gene 255 (2000) 51–57 Kim, A., Terzian, C., Santamaria, P., Pelisson, A., Purd’homme, N., Bucheton, A., 1994. Retroviruses in invertebrates: the gypsy retrotransposon is apparently an infectious retrovirus of Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 91, 1285–1289. Lankenau, D.H., 1993. The retrotransposon family micropia in Drosophila species. In: McDonald, J.F. (Ed.), Transposable Elements and Evolution. Kluwer Academic, Amsterdam, pp. 232–241. Lankenau, D.H., Huijser, P., Jansen, E., Miedema, K., Hennig, W., 1988. Micropia: a retrotransposon of Drosophila combining structural features of DNA viruses, retroviruses and non-viral transposable elements. J. Mol. Biol. 204, 233–246. Mainx, F., 1964. The genetics of Megaselia scalaris LOEW (Phoridae): a new type of sex determination in Diptera. Am. Natur. 98, 415–430. Malik, H.S., Eickbush, T.H., 1999. Modular evolution of the integrase domain in the Ty3/Gypsy class of LTR retrotransposons. J. Virol. 73, 5186–5190. Ochman, H., Medhora, M.M., Garza, D., Hartl, D.L., 1990. Amplification of flanking sequences by inverse PCR. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. ( Eds.), PCR Protocols. A Guide to Methods and Applications. Academic Press, San Diego, pp. 219–227. Peters, G., Dahlberg, J.E., 1979. RNA-directed DNA synthesis in Moloney murine leukemia virus: interaction between the primer tRNA and the genome RNA. J. Virol. 31, 398–407.
57
Peterson-Burch, B.D., Wright, D.A., Laten, H.M., Voytas, D.F., 2000. Retroviruses in plants. Trends Genet. 16, 151–152. Polard, P., Chandler, M., 1995. Bacterial transposases and retroviral integrases. Mol. Microbiol. 15, 13–23. Promislow, D.E., Jordan, I.K., McDonald, J.F., 1999. Genomic demography: a life-history analysis of transposable element evolution. Proc. R. Soc. London, Ser. B: Biol. Sci. 266, 1555–1560. Tanchou, V., Decimo, D., Pechoux, C., Lener, D., Rogemond, V., Berthoux, L., Ottmann, M., Darlix, J.L., 1998. Role of the N-terminal zinc finger of human immunodeficiency virus type 1 nucleocapsid protein in virus structure and replication. J. Virol. 72, 4442–4447. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Traut, W., 1994. Sex determination in the fly Megaselia scalaris, a model system for primary steps of sex chromosome evolution. Genetics 136, 1097–1104. Traut, W., Willhoeft, U., 1990. A jumping sex determining factor in the fly Megaselia scalaris. Chromosoma 99, 407–412. Willhoeft, U., Traut, W., 1990. Molecular differentiation of the homomorphic sex chromosomes in Megaselia scalaris (Diptera) detected by random DNA probes. Chromosoma 99, 237–242.
TROMB, a new retrotransposon of the gypsy–Ty3 group from the fly Megaselia scalaris Garnet Suck, Walther Traut * Institut fu¨r Biologie, Medizinische Universita¨t zu Lu¨beck, D-23538 Lu¨beck, Germany Received 17 April 2000; received in revised form 28 June 2000; accepted 3 July 2000 Received by M. Schartl
Abstract We describe TROMB, a new LTR retrotransposon, from the phorid fly Megaselia scalaris. Three full-length copies (4226, 4160 and 4129 bp) and a truncated one (319 bp) have been isolated. The target site consensus is TATAT, with a 4 bp target site duplication TATA. The LTRs are short (142 bp) and contain a TATA-box and a polyadenylation signal. The isolated copies are degenerate to different degrees and presumably inactive. The polyprotein coding sequence contains scattered stop codons and deletions/insertions at non-homologous positions. The consensus sequence among the three full-length copies, however, has an uninterrupted open reading frame and, presumably, represents the original sequence of the active element. Southern hybridization experiments showed TROMB to be present at a low copy number in two wild-type strains of M. scalaris and absent in a related species, M. abdita. The order of domains in the polyprotein coding region, the target site specificity for AT-rich sequences, and the protein sequence similarity to blastopia, mdg3 and micropia place TROMB in the gypsy–Ty3 group of LTR retrotransposons. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Blastopia; mdg3; Micropia; Transposable element
1. Introduction LTR retrotransposons are the most complex transposable elements. They resemble retrovirus organization and gene content. The distinguishing feature is the infectiousness of retroviruses. Retrotransposons, except for rare cases of horizontal transfer (Jordan et al., 1999), cannot actively leave the cell line once invaded and enter other cells. Three fates are possible: transposition, excision (a recombination event between its 3∞ and 5∞ LTR, leaving ‘solo LTRs’ behind) or mutation (Promislow et al., 1999). The phorid fly Megaselia scalaris has a peculiar system of primary sex determination. Male sexual develAbbreviations: aa, amino acid(s); bp, base pair(s); CO, core protein(s); IN, integrase; IR, inverted repeat; kb, kilobase(s) or 1000 bp; LTR, long terminal repeat; NC, nucleocapsid; ORF, open reading frame; PBS, minus strand primer binding site; PCR, polymerase chain reaction; pos, position(s); PPT, polypurine tract (=plus strand priming site); PR, protease; pt, putative tether; RH, ribonuclease H; RT, reverse transcriptase; u, unidentified protein. * Corresponding author. Tel.: +49-451-5004100; fax: +49-451-5004815. E-mail address: [email protected] ( W. Traut)
opment is triggered by the Maleness factor, M (Mainx, 1964). M can alter its location in the genome; it displays a transposon-like behaviour with a low frequency of transposition (Traut and Willhoeft, 1990; Traut, 1994). Since the location of M defines the functional Y chromosome, strains with recently created Y chromosomes, e.g. ‘Except1’, and strains such as ‘Wien’ and ‘Florida’ with old Y chromosomes, coexist. Our interest in the sex determination of M. scalaris prompted an investigation of the yet unknown transposable elements in this species. In this paper, we describe a new low-copy retrotransposon, TROMB, of the gypsy–Ty3 group.
2. Materials and methods 2.1. Animals We studied M. scalaris Loew wild-type strains ‘Wien’ (provided by R. Springer, Wien, Austria) and ‘Florida’ (provided by A. Handler, Gainesville, FL) and a strain, ‘Except1’, with a new Y chromosome derived from chromosome 3 ( Traut and Willhoeft, 1990). M. abdita
0378-1119/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S0 3 7 8 -1 1 1 9 ( 0 0 ) 0 0 31 1 - 5
52
G. Suck, W Traut / Gene 255 (2000) 51–57
Schmitz was a gift from U. Schmidt-Ott (Go¨ttingen, Germany). Megaselia was cultured as described by Willhoeft and Traut (1990). Samples of 200 to 800 female and male flies were used for DNA isolation according to Blin and Stafford (1976). 2.2. Genomic library Genomic DNA was isolated from the anterior half of male pupae (see Beye et al., 1998), partially digested with Sau3AI, ligated into sCos-1 ( Evans et al., 1989) and packaged using the GigapackIII Gold Kit (Stratagene) according to the manufacturer’s protocol. The library consisted of 2.4×104 clones, had an average insert size of 34 kb and represented about 2.5 genome equivalents (Megaselia genome size 3.3×108 bp; Traut and Willhoeft, 1990). 2.3. Sequencing and sequence comparison We used the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Applied Biosystems) and an ABI Prism Model 377 automated sequencer according to the manufacturer’s protocol (Applied Biosystems, Foster City, CA). Sequencing was performed by primer walking, each position was determined at least twice. Primers were custom synthesized by MWG Biotech ( Ebersberg, Germany). Sequence assembly, translation and alignment were done with ASSEMBLE, SEQUENCE (programs written by W.T.) and CLUSTALW ( Thompson et al., 1994), using the default parameters and manual correction. Similarity was defined as the fraction of positives in the BLOSUM 62 matrix (Henikoff and Henikoff, 1992). Database searches were performed with BLASTP and TBLASTN, using default parameters. 2.4. Probes Probe pMSW2482 was generated by inverse PCR (Ochman et al., 1990) on circularized genomic EcoRI fragments of M. scalaris. Primers 2420f9 (5∞ GAATTTCAAACTAAAGAAAGCC 3∞) and 2420r9 (5∞ TTACTTCGATCAATTTGTATGG 3∞) for inverse PCR were defined on the basis of a previously detected malespecific fragment of M. scalaris. The 459 bp Int1 probe was generated by standard PCR on cosmid pMSW2506 DNA. Forward primer REF (5∞ GACGACAAATGGTTCAAAGC 3∞) and reverse primer REB (5∞ TAGCTTCATGTTATCGGAGG 3∞) were defined from the TROMB sequence contained in cosmid pMSW2506. PCR conditions were: 30 s initial denaturation at 94°C, 40 cycles with 30 s denaturing at 94°C, 1 min annealing at 56°C, 1 min extension at 72°C and a final 5 min extension step at 72°C.
3. Results and discussion 3.1. General description We detected the LTR of an unknown retrotransposon adjacent to a male-specific region in a cloned genomic sequence of M. scalaris, pMSW2482 ( EMBL accession number AJ277434), generated by inverse PCR as described in Section 2.4. Using this clone as a probe, we screened a cosmid library of M. scalaris and obtained 26 positives among 2.4×104 clones screened. Four of the positives were isolated: pMSW2506, pMSW2514, pMSW2515 and pMSW2509. They contained copies of a new retrotransposon, termed TROMB (transposon of Megaselia, blastopia-related ). The sequences of the four copies TROMB-Ms1, TROMB-Ms2, TROMB-Ms3 and TROMB-Ms4 were deposited in the databank ( EMBL accession numbers AJ277430, AJ277431, AJ277432 and AJ277433). TROMB-Ms1 turned out to be the Y-chromosomal copy and contained the complete sequence of the probe. Three copies, TROMB-Ms1, TROMB-Ms2 and TROMB-Ms3, are full-length retrotransposons of 4226, 4160 and 4129 bp, respectively, bounded at both ends by LTRs. TROMB-Ms4 is a truncated copy of 319 bp, with only one LTR and some adjacent retrotransposon sequence left. None of the copies contained a continuous open reading frame (ORF ) of the retrotransposon polyprotein. The ORFs are disrupted by stop codons, frameshifts, and deletions/insertions. When the sequences of the three full-length retrotransposons were aligned, however, the consensus sequence represented a reconstructed continuous ORF ( EMBL accession number ds42596, sequence alignment). Remaining nucleotide ambiguities at five positions (pos. 2066, 2101, 2286, 3800 and 3819 of the consensus sequence) were resolved by selecting the nucleotide that produced the best similarity to blastopia (Frommer et al., 1994). 3.2. LTRs All copies of TROMB have LTRs of 142 bp. The TROMB LTR is relatively short, other known LTRs have sizes from 77 bp up to 3.6 kb (Boeke and Stoye, 1997). The LTR sequence is well conserved among the TROMB copies. LTRs differ from one copy to another at six positions altogether (these are mutations that had occurred before insertion) and at four positions between the two LTRs of the same copies (these are mutations that had occurred after insertion). In the truncated element TROMB-Ms4, six more positions are affected. The LTRs are bounded by the 3 bp inverted repeat TGT/ACA ( Fig. 1, IR). This is a subset of the TG… /…CA motif which is also found in most vertebrate
G. Suck, W Traut / Gene 255 (2000) 51–57
53
Fig. 1. 5∞ LTR (upper case) and flanking sequence ( lower case) of the TROMB consensus sequence. Functional sites are underlined.
retrovirus LTRs and in some Drosophila retrotransposons (Bingham and Zachar, 1989). Among the functional elements commonly found in LTRs, the CAATbox is missing in the TROMB LTR. A putative TATAbox with similarity to the consensus sequence (Corden et al., 1980) is found at pos. 32 to 38 (all LTR positions according to Fig. 1). At pos. 49 to 56, a sequence is found with similarity to an initiator element containing a typical Drosophila core sequence, TCAT (Arkhipova, 1995), but considered dubious by us because of the short distance (11 bp instead of ~25 bp) from the putative TATA-box. There is a polyadenylation signal at pos. 83 to 88. A putative RNA termination signal conforming to the consensus TTGX (Lankenau et al., 1988) is present at pos. 115 to 118.
The minus strand primer binding site (PBS) following the 5∞ LTR is a putative tRNAPro PBS (Peters and Dahlberg, 1979) consisting of the sequence TGGGGGCTCAACCG (Figs. 1 and 2, PBS). The putative plus strand priming site (Fig. 2, PPT ), CAGAATGGCCGAT, is similar (10 of 13 positions identical ) to that defined in blastopia (Frommer et al., 1994). With one exception, the copies of TROMB are flanked by a target site duplication, TATA. The exception is an AATA sequence flanking the 5∞ end of TROMB-Ms1 (which may be an error in the duplication process or else a mutation introduced later). The consensus integration site sequence in TROMB is TATAT, which is similar to the YRYRYR consensus in gypsy elements (Dej et al., 1998).
Fig. 2. Organization of TROMB (A) and deviations of TROMB-Ms1 (B), TROMB-Ms2 (C ), TROMB-Ms3 (D) from the consensus TROMB sequence. Putative protein coding domains: CO, core proteins; NC, nucleocapsid; PR, protease-like protein; u, unidentified protein; RT, reverse transcriptase-like protein; pt, putative tether; RH, RNase H-like protein; IN, integrase-like protein. PPT, polypurine tract (=plus strand priming site); PBS, minus strand primer binding site; 3 deletion/insertion; * mutation to in-frame stop codon; ( synonymous mutation; , non-synonymous mutation and mutation in non-coding regions.
54
G. Suck, W Traut / Gene 255 (2000) 51–57
3.3. Protein domains The ORF of the consensus TROMB sequence encodes a putative retrotransposon polyprotein of 1308 aa. Using this sequence in a BLASTP and TBLASTN databank search including the Drosophila genome database, three LTR retrotransposons of the gypsy–Ty3 group, blastopia (Frommer et al., 1994; EMBL accession number Z27119), mdg3 (Avedisov and Ilyin, 1995; EMBL accession number X95908), and micropia (Lankenau et al., 1988; EMBL accession number X14037), received the highest scores. In pairwise alignments with the full aa sequences of the retrotransposons, TROMB shares 36, 33 and 27% identity and 56, 53 and 46% similarity to blastopia, mdg3 and micropia, respectively. Sequence comparison among the four retrotransposons revealed the presence of a typical set of protein domains (Fig. 2A) in the arrangement known from the gypsy–Ty3 group. Protein domain borders are defined on the basis of those published for blastopia (Frommer et al., 1994). When single protein domains of TROMB are compared with the homologous ones of blastopia, mdg3 and micropia, identities (similarities) range from 8% (24%) to 55% (76%) ( Table 1). Conservation is weaker on the 5∞ side of the polyprotein coding sequence (CO, NC, PR, u) than on the 3∞ side (RT, pt, RH, IN ). The nucleocapsid domain (Fig. 2, NC ) contains two zinc fingers (Fig. 3; aa pos. 268 to pos. 301) of the CCHC type, consistent with the CX CX HX C consen2 4 4 sus sequence (Covey, 1986). CCHC-boxes occur in most retrovirus and some retrotransposon nucleocapsid proteins (for a review see Doolittle et al., 1989). Mutagenesis experiments revealed a key role for these zinc finger domains in nucleocapsid function. They are required for packaging genomic RNA, establishing normal core morphology and the production of infectious viral particles (for a review see Darlix et al., 1995; Tanchou et al., 1998). The number of CCHC zinc fingers differs among retrotransposons. Blastopia and mdg3, like TROMB, have two zinc fingers. Other members of the gypsy–Ty3 group have one ( gypsy) or no (Ty3) CCHC-box (for a review see Doolittle et al., 1989). Table 1 Identity (similarity) between protein domains of TROMB and those of blastopia, mdg3 and micropia Domain
aa
Blastopia (%)
Mdg3 (%)
Micropia (%)
CO NC PR u RT pt RH IN
258 52 113 55 244 55 182 349
22 29 22 24 45 49 42 43
21 33 20 31 41 55 45 32
8 (25) 37 (52) 22 (44) 11 (24) 41 (60) 29 (55) 35 (58) 29 (49)
(43) (37) (41) (42) (70) (64) (61) (64)
(37) (56) (41) (49) (68) (76) (66) (50)
The integrase domain possesses a different zinc finger motif (aa pos. 970 to pos. 1008, Fig. 4). It is an HHCC zinc finger, compatible with the HX HX CX C 3–7 23–32 2 consensus sequence (Bushman et al., 1993). The HHCC motif is close to the DDE signature (aa pos. 1038 to pos. 1133, Fig. 4), which is widely distributed among transposable elements (for a review see Polard and Chandler, 1995). By site-directed mutagenesis experiments, the HHCC zinc finger domain and the DDE domain (a putative catalytic centre) together have been shown to be essential for integrase function (for a review see Brown, 1997). 3.4. Copy number EcoRI-restricted genomic DNA of females and males from wild-type strains ‘Wien’ and ‘Florida’ were hybridized with Int1, a probe whose sequence was derived from the integrase region of TROMB. The probe was designed to detect EcoRI fragments reaching from the last EcoRI site in TROMB to the first one outside TROMB, thus encompassing a constant segment from the 3∞ end of TROMB and a variable stretch of adjacent region. The probe detected 12, 14, nine and 13 fragments, respectively in DNA from ‘Wien’ females, ‘Wien’ males, ‘Florida’ females and ‘Florida’ males (Fig. 5). This gives a minimum estimate of the copy numbers in the two Megaselia strains. According to the signal intensities, some bands may represent more than one fragment. Two fragments in ‘Wien’ (or three if the 3.0 kb band in ‘Wien’ is a double band) and four in ‘Florida’ are malespecific, i.e. derived from the Y chromosome. This is roughly proportional to the fraction of Y-chromosomal DNA in the genome (three chromosomes in the haploid set), and indicates that there is no obvious clustering of TROMB in the Y chromosome. According to its size, the male-specific 1.1 kb fragment represents the Y-chromosomal TROMB-Ms1. In a similar experiment with genomic DNA from another Megaselia species, M. abdita, the probe did not detect any fragment (not shown). No sex-specific difference was seen in Southern hybridization to genomic DNA of ‘Except1’, a strain with a new Y chromosome (not shown). Hence, we did not detect an association of TROMB with the Maleness factor M. Two fragments (1.2 and 2.8 kb) from ‘Florida’ with stronger signals in the female lane are probably derived from the X chromosome. The result shows that TROMB is a low copy transposon in M. scalaris. In this respect it is similar to mdg3 with five to 18 copies (Belyaeva et al., 1984), blastopia with about 20 copies (Frommer et al., 1994), and micropia with 16 to 32 copies (Lankenau, 1993) in Drosophila melanogaster. In contrast, micropia is a high copy transposon in Drosophila hydei, but only with respect to the Y chromosome which harbours 50 to 100 copies. The X chromosome and the autosomes together contain only two to 11 copies (Lankenau et al., 1988).
G. Suck, W Traut / Gene 255 (2000) 51–57
55
Fig. 3. Alignment of putative retrotransposon nucleocapsid proteins containing the CCHC zinc finger motif. Positions with identical aa in all four proteins are printed inversely; those with similar aa are shaded.
Fig. 4. N-terminal segment of TROMB, blastopia, mdg3 and micropia integrases containing a HHCC zinc finger and the DDE signature to show identities (inverse) and similarities (shaded).
The three copies of TROMB found in the M. scalaris Y chromosome of the ‘Wien’ strain correlate to the low degree of Y chromosome differentiation in that strain ( Willhoeft and Traut, 1990). The fragment patterns of the two strains ‘Wien’ and ‘Florida’ are almost completely different (Fig. 5); only one fragment (1.1 kb) is possibly identical in the two strains. The different patterns are due to different integration sites of TROMB and/or to genomic differences resulting in restriction fragment length polymorphism. Data have been collected from 24 random single copy probes which were hybridized to EcoRI- or HindIIIrestricted DNA of the two M. scalaris strains (Sylvia Kuhn, Garnet Suck and Walther Traut, unpublished). The majority of fragments that were detected in the ‘Wien’ strain (34 of 45 fragments) are different from those in the ‘Florida’ strain. The result shows sufficient restriction fragment length polymorphism to explain the different band patterns between the two strains with the TROMB probe, but does not exclude transposition events. 3.5. Intragenomic evolution Fig. 5. TROMB in Megaselia scalaris strains ‘Wien’ and ‘Florida’. The Int1 probe was hybridized to EcoRI-restricted genomic DNA from female and male flies. Arrowheads point to Y-chromosomal fragments.
None of the three full-length copies studied has the coding capacity for the full set of proteins required for transposition. The coding region is interrupted at vari-
56
G. Suck, W Traut / Gene 255 (2000) 51–57
ous positions by stop codons, frameshifts and larger deletions of several base pairs. It is clear that these copies can no longer be active transposons, though they may still be transposable in trans. In retroviruses and LTR retrotransposons, frameshifting between gag and pol is a regular process (for a review see Capy et al., 1998). But in TROMB the consensus coding sequence for the polyprotein is free of frameshifts as well as stops; it has one continuous ORF. TROMB shares this property with blastopia, mdg3 and micropia. Each of the three copies of TROMB has its own set of stop codons, frameshifts and deletions/insertions besides synonymous and non-synonymous mutations at non-homologous positions ( Fig. 2). They include mutations before and after insertion. As shown for mutations in the LTRs (see Section 3.2), some of the mutations have probably arisen by mutational decay of the elements after insertion. Others have occurred before insertion, as the variation in the fraction of synonymous mutations in the polyprotein, 34, 27 and 62%, respectively in TROMB-Ms1, TROMB-Ms2 and TROMBMs3, indicates. 3.6. Classification The order of domains in the putative polyprotein coding sequence — the integrase is 3∞ of the reverse transcriptase — puts TROMB into the gypsy–Ty3 group, one of the two major groups (Ty1–copia/gypsy–Ty3) of LTR retrotransposons. Comparison of the reconstructed TROMB polyprotein sequence with that of other LTR retrotransposons revealed TROMB to be most closely related to three members of that group: blastopia, mdg3 and micropia (see Section 3.3). According to more recent data, some members of either group, e.g. SIRE-1 from soybean and gypsy from Drosophila, can no longer be considered genuine retrotransposons. The presence of env-like ORFs makes it possible that they are retroviruses (for a review see Peterson-Burch et al., 2000); gypsy in fact possesses infective properties ( Kim et al., 1994). According to the classification scheme proposed by Capy et al. (1998), the PR–RT–RH–IN order of protein domains in the polyprotein sequence, the minus strand priming by a tRNA primer and the missing env place TROMB — as well as blastopia, mdg3 and micropia — in the Ty3 superfamily of LTR retrotransposons. When a phylogenetic tree was constructed with aa alignments of the combined reverse transcriptase, RNaseH and integrase domains according to Malik and Eickbush (1999) of TROMB, mdg3, blastopia and micropia using Ty3 as an outgroup, TROMB formed the last branchpoint with blastopia (not shown).
Acknowledgements We thank Heidemarie Riechers, Sylvia Kuhn and Katja Andruleit for help with DNA sequencing,
Angelika Poleksic and Jan Meyer for Southern hybridization, and Dieter Weichenhan for providing sCos-1, for helpful advice in cosmid library construction and critical reading of the manuscript.
References Arkhipova, I.R., 1995. Promoter elements in Drosophila melanogaster revealed by sequence analysis. Genetics 139, 1359–1369. Avedisov, S.N., Ilyin, Yu.V., 1995. Retrotransposon mdg3 of Drosophila: general structure and functional domains of the full-length copy. Dokl. Biochem. 344, 160–163. Belyaeva, E.S., Ananiev, E.V., Gvozdev, V.A., 1984. Distribution of mobile dispersed genes (mdg-1 and mdg-3) in the chromosomes of Drosophila melanogaster. Chromosoma 90, 16–19. Beye, M., Poch, A., Burgtorf, C., Moritz, R.F., Lehrach, H., 1998. A gridded genomic library of the honeybee (Apis mellifera): a reference library system for basic and comparative genetic studies of a hymenopteran genome. Genomics 49, 317–320. Bingham, P.M., Zachar, Z., 1989. Retrotransposons and the FB transposon from Drosophila melanogaster. In: Berg, D.E., Howe, M.M. ( Eds.), Mobile DNA. American Society for Microbiology, Washington, DC, pp. 485–502. Blin, N., Stafford, D.W., 1976. A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res. 3, 2303–2308. Boeke, J.D., Stoye, J.P., 1997. Retrotransposons, endogenous retroviruses, and the evolution of retroelements. In: Coffin, J.M., Hughes, S.H., Varmus, H.E. ( Eds.), Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 343–435. Brown, P.O., 1997. Integration. In: Coffin, J.M., Hughes, S.H., Varmus, H.E. (Eds.), Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 161–203. Bushman, F.D., Engelman, A., Palmer, I., Wingfield, P., Craigie, R., 1993. Domains of the integrase protein of human immunodeficiency virus type 1 responsible for polynucleotidyl transfer and zinc binding. Proc. Natl. Acad. Sci. USA 90, 3428–3432. Capy, P., Bazin, C., Higuet, D., Langin, T., 1998. Dynamics and Evolution of Transposable Elements. Springer, Austin, TX. Corden, J., Wasylyk, B., Buchwalder, A., Sassone-Corsi, P., Kedinger, C., Chambon, P., 1980. Promoter sequences of eukaryotic proteincoding genes. Science 209, 1406–1414. Covey, S.N., 1986. Amino acid sequence homology in gag region of reverse transcribing elements and the coat protein gene of cauliflower mosaic virus. Nucleic Acids Res. 14, 623–633. Darlix, J.L., Lapadat-Tapolsky, M., de Rocquigny, H., Roques, B.P., 1995. First glimpses at structure–function relationships of the nucleocapsid protein of retroviruses. J. Mol. Biol. 254, 523–537. Dej, K.J., Gerasimova, T., Corces, V.G., Boeke, J.D., 1998. A hotspot for the Drosophila gypsy retroelement in the ovo locus. Nucleic Acids Res. 26, 4019–4025. Doolittle, R.F., Feng, D.F., Johnson, M.S., McClure, M.A., 1989. Origins and evolutionary relationships of retroviruses. Q. Rev. Biol. 64, 1–30. Evans, G.A., Lewis, K., Rothenberg, B.E., 1989. High efficiency vectors for cosmid microcloning and genomic analysis. Gene 79, 9–20. Frommer, G., Schuh, R., Jackle, H., 1994. Localized expression of a novel micropia-like element in the blastoderm of Drosophila melanogaster is dependent on the anterior morphogen bicoid. Chromosoma 103, 82–89. Henikoff, S., Henikoff, J.G., 1992. Amino acid substitution matrices from protein blocks. Proc. Natl. Acad. Sci. USA 89, 10 915–10 919. Jordan, I.K., Matyunina, L.V., McDonald, J.F., 1999. Evidence for the recent horizontal transfer of long terminal repeat retrotransposon. Proc. Natl. Acad. Sci. USA 96, 12 621–12 625.
G. Suck, W Traut / Gene 255 (2000) 51–57 Kim, A., Terzian, C., Santamaria, P., Pelisson, A., Purd’homme, N., Bucheton, A., 1994. Retroviruses in invertebrates: the gypsy retrotransposon is apparently an infectious retrovirus of Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 91, 1285–1289. Lankenau, D.H., 1993. The retrotransposon family micropia in Drosophila species. In: McDonald, J.F. (Ed.), Transposable Elements and Evolution. Kluwer Academic, Amsterdam, pp. 232–241. Lankenau, D.H., Huijser, P., Jansen, E., Miedema, K., Hennig, W., 1988. Micropia: a retrotransposon of Drosophila combining structural features of DNA viruses, retroviruses and non-viral transposable elements. J. Mol. Biol. 204, 233–246. Mainx, F., 1964. The genetics of Megaselia scalaris LOEW (Phoridae): a new type of sex determination in Diptera. Am. Natur. 98, 415–430. Malik, H.S., Eickbush, T.H., 1999. Modular evolution of the integrase domain in the Ty3/Gypsy class of LTR retrotransposons. J. Virol. 73, 5186–5190. Ochman, H., Medhora, M.M., Garza, D., Hartl, D.L., 1990. Amplification of flanking sequences by inverse PCR. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. ( Eds.), PCR Protocols. A Guide to Methods and Applications. Academic Press, San Diego, pp. 219–227. Peters, G., Dahlberg, J.E., 1979. RNA-directed DNA synthesis in Moloney murine leukemia virus: interaction between the primer tRNA and the genome RNA. J. Virol. 31, 398–407.
57
Peterson-Burch, B.D., Wright, D.A., Laten, H.M., Voytas, D.F., 2000. Retroviruses in plants. Trends Genet. 16, 151–152. Polard, P., Chandler, M., 1995. Bacterial transposases and retroviral integrases. Mol. Microbiol. 15, 13–23. Promislow, D.E., Jordan, I.K., McDonald, J.F., 1999. Genomic demography: a life-history analysis of transposable element evolution. Proc. R. Soc. London, Ser. B: Biol. Sci. 266, 1555–1560. Tanchou, V., Decimo, D., Pechoux, C., Lener, D., Rogemond, V., Berthoux, L., Ottmann, M., Darlix, J.L., 1998. Role of the N-terminal zinc finger of human immunodeficiency virus type 1 nucleocapsid protein in virus structure and replication. J. Virol. 72, 4442–4447. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Traut, W., 1994. Sex determination in the fly Megaselia scalaris, a model system for primary steps of sex chromosome evolution. Genetics 136, 1097–1104. Traut, W., Willhoeft, U., 1990. A jumping sex determining factor in the fly Megaselia scalaris. Chromosoma 99, 407–412. Willhoeft, U., Traut, W., 1990. Molecular differentiation of the homomorphic sex chromosomes in Megaselia scalaris (Diptera) detected by random DNA probes. Chromosoma 99, 237–242.