Tropoelastin gene expression in optic nerve heads of normal and glaucomatous subjects

Matrix Biology Vol. 15/1996, pp. 3 2 3 - 3 3 0 © 1996 by Gustav Fischer Verlag, Stuttgart • Jena • New York

Tropoelastin Gene Expression in Optic Nerve Heads of Normal and Glaucomatous Subjects JANETHE D. O. PENA*, SAYON ROY t and M. ROSARIO HERNANDEZ* * Department of Ophthalmology and Visual Sciences, Washington University School of Medicine, St. Louis, Missouri and t Schepens Eye Research Institute, Harvard Medical School, Boston, Massachusetts, USA.

Abstract Elastic fibers are a major component of the extracellular matrix in the optic nerve head (ONH) and undergo marked morphological changes during primary open angle glaucoma (POAG). Previous findings indicated that there is reactivation of tropoelastin m R N A synthesis in glaucoma. In this study, we sought to determine the alternative splicing pattern of tropoelastin in the human optic nerve head and in cultured laminar astrocytes. Furthermore, we compared the alternative splicing pattern of normal elastogenesis with that of reactivation of elastin synthesis in patients with primary open angle glaucoma. Our results demonstrate that exons 23 and 32 of tropoelastin are alternatively spliced in the normal O N H as well as in tissue from glaucomatous patients. There are no qualitative differences. We also demonstrated that astrocytes from the O N H synthesize tropoelastin in vitro. In conclusion, we have demonstrated a tropoelastin alternative splicing pattern in the human optic nerve head and laminar astrocytes. Abnormalities in elastic fibers in the O N H of patients with POAG are not due to an aberrant splice variant of tropoelastin. Astrocytes grown from O N H explants may serve as an in vitro model to study extracellular matrix changes in glaucoma. Key words: alternative splicing, astrocytes, glaucoma, lamina cribrosa, tropoelastin.

Introduction Primary open angle glaucoma (POAG) 1 is characterized by elevated intraocular pressure due to impaired outflow of aqueous humor and by cupping of the optic disc due to loss of axons and compression of the lamina cribrosa in the optic nerve head (ONH) (Hayreh, 1978). The earliest site of damage to the axons of retinal ganglion cells is at the level of the lamina cribrosa. This structure is fibroelastic and is formed by stacks of connective tissue, the cribriform plates, which are organized in lamellae (Anderson, 1969) and are lined by astrocytes. In the glaucomatous O N H , compression, stretching and remodeling of the cribriform plates occurs in response to elevated intraocular pressure (Quigley et al., 1983). Elastin, one of the major extracellular matrix components of the lamina cribrosa in the human O N H , confers

elasticity and resiliency necessary to withstand fluctuations in intraocular pressure. In normal individuals, elastin is predominantly synthesized and deposited in the cribriform plates during the neonatal period and infancy; little or no elastin synthesis occurs in adult optic nerves. Abundant fibers of elastin are found in the core of the cribriform plates of normal adults, as well as a network of filamentous basement membranes and fibrillar collagens (Hernandez et al., 1987; Morrison et al., 1989). In the core of the cribriform plates of the glaucomatous lamina cribrosa, granular masses of elastin appear, and elastic fibers become increasingly disorganized with the progression of the disease (Hernandez et al., 1990). An in1 Abbreviations used: G3PDH, glyceraldehyde-3-phosphate dehydrogenase; ONH, optic nerve head; POAG, primary open angle glaucoma; RT, reverse transcription.

324

J . D . O . Pena et al.

crease in the m R N A for tropoelastin, the secreted precursor of elastin, was recently described in optic nerve heads from patients with POAG as compared to normal age-matched individuals. In situ hybridization of O N H s from patients with POAG localized tropoelastin m R N A to cells in the compressed lamina cribrosa expressing glial fibrillary acidic protein, an ubiquitous marker for astrocytes (Hernandez et al., 1994). Optic nerve head compliance changes during glaucoma, consistent with changes in the elastic element of the lamina cribrosa (Zeimer and Ogura, 1989; Burgoyne et al., 1995). Once secreted by the cells, tropoelastin is deposited in a scaffold of microfibrils and is cross-linked by peptidyl lysil oxidase, forming insoluble elastin. Tropoelastin has two major types of domains. Dispersed throughout the protein in an alternating arrangement are the cross-linking or hydrophilic domains, separated by the hydrophobic domains which confer elasticity to the fiber. The exons encoding for these domains usually alternate in the gene. A single gene encodes tropoelastin mRNA, which undergoes extensive alternative splicing to produce a diverse pattern of protein isoforms. Alternative splicing of tropoelastin occurs in all species, with some exons being subject to developmental control of alternate usage (Boyd et al., 1993; Parks et al., 1988). Changes in the regulation of exon usage may lead to an alteration in the function of the translated protein. For example, cellular and circulating forms of fibronectin differ due to alternative splicing of the primary transcript (ffrench-Constant, 1995). The presence of tropoelastin splice variants could influence important processes of elastic fiber formation, such as the transport of tropoelastin, fiber assembly, or cell-matrix and matrix-matrix interactions. Any disturbance in one of these processes may alter the normal function of elastic fibers. In this study, our objectives were (1) to determine the alternative splicing pattern of tropoelastin in the human O N H and in cultured laminar astrocytes, and (2) to compare the alternative splicing pattern of normal elastogenesis with that of reactivation of elastin synthesis in patients with primary open angle glaucoma.

Materials and Methods

Cell culture of laminar astrocytes

One pair of fetal eyes (aged 18 weeks) and two pairs of adult normal eyes (ages 22 and 57 years) were used to generate primary cultures of astrocytes type 1B from the lamina cribrosa, termed laminar astrocytes. The culture medium used consisted of DME/F-12 supplemented with 5% fetal bovine serum, 1 btg/ml PDGF-AA, 5 btg/ml basic fibroblast growth factor, and antibiotics. The fetal bovine serum, antibiotics, trypsin, and DME/F-12 were purchased from Gibco/BRL, Grand Island, NY; PDGF-AA was from Sigma Chemical Co., St. Louis, MO, and basic fibroblast growth factor was from Biomedical Technologies, Inc., Stoughton, MA. The cultures were established as described elsewhere (Hernandez et al., 1988). Briefly, the optic nerve heads were removed and dissected free from sclera and surrounding tissues, and then cut into two or three explants which were placed into 25 mm 2 culture flasks (Falcon) containing medium with supplements and maintained in a humidified 6% CO)_, 94% air incubator at 37 °C. The medium was changed twice weekly, and the cells were passed at confluence. On the third passage, cells were seeded into six wells at a density of 1.5 x l 0 4 cells/well; three wells contained glass coverslips for immunocytochemical characterization. Skin (ATCC collection number CRL 1506) and scleral fibroblasts (from a 7-month-old normal donor) served as positive controls. The culture medium used for fibroblasts was the same as for the laminar astrocytes, except that the fibroblast medium contained 10% fetal bovine serum.

Characterization of laminar astrocytes

When the cells reached confluence, the coverslips were removed, fixed in 4% paraformaldehyde in PBS, and processed for immunocytochemistry using primary antibodies against human glial fibrillary acidic protein, a cytoskeletal marker of astrocytes (ICN Pharmaceuticals Inc., Costa Mesa, CA), and human neural cell adhesion molecule HNKI / N - C A M (Boehringer-Mannheim Corporation, Indianapolis, IN), as previously described (Ye and Hernandez, 1995). The cells were defined as laminar astrocytes if they stained for both epitopes.

Human tissues

Four pairs of normal human fetal eyes (gestational age 18-24 weeks), 14 pairs of normal human eyes (donor ages, 7 months to 91 years) with no history of eye disease or diabetes, and three pairs of eyes with a history of POAG were obtained from eye banks throughout the United States. The fetal eyes were obtained from the Anatomic Gift Foundation (Laurel, MD). The optic nerve heads were dissected free from sclera and surrounding tissues under sterile RNase-free conditions and then processed for cell culture or total RNA extraction within 24 h post mortem.

RNA extraction and RT-PCR

Total RNA was extracted from fresh optic nerve heads and cultured cells by the acid-guanidine-phenol-chloroform method (Chomczynski and Sacchi, 1987), using a commercial kit (RNagents; Promega Corporation, Madison, WI). Each O N H weighed an average of 12 mg and yielded about 7 btg of total RNA. First-strand cDNA was prepared from total RNA by reverse transcription (RT) according to the manufacturer's instructions (Superscript II; Gibco/BRL). For each sample, RT was performed in a 20 ~1

Tropoelastin in the Optic Nerve Head

325

Table I. Primer sequences used for RT-PCR analysis of tropoelastin mRNA. Target

DNA sequence

expected size (bp)

Region A (exons 19-24)

5'GGGGTTGTGTCACCAGAA3'(U/S) 5'GGA GCCA CGCCAA CGCCA3'(D/S) 5'TGGGGTCCTTGGAGGGCT3'(U/S) 5'ACAAGCTTTCCCCAGGCA3'(D/S)

473

Region B (exons 28-36)

358

Table II. Oligonucleotide sequences used for Southern blot analysis of tropoelastin mRNA. Target

DNA sequence

Exon 21 Exon 31 Exon 32 Exon 33

5'CCGAAGCTCAGGCAGCAG3' 5'GTATACCTCCAGCTGCAGCCG3' 5'GTGCTGCTGGCCTTGGAGGT3' 5'GGCTTCGGATTGTCTCCCAT3'

volume containing 3 big total RNA, 200 U enzyme, 2.5 I.tmol random hexamers, 1 [.IMeach nucleoside triphosphate (dNTP), 5 mM MgCI2, lx polymerase chain reaction (PCR) buffer, and RNase inhibitor. The reaction was performed at 42 °C for 45 rain. At the end of RT, samples were incubated with 2 U of RNase H for 15 min and then stored at - 2 0 °C until use. The reverse transcribed material was then used for PCR amplification of specific sequences within the tropoelastin and glyceraldehyde-3-phosphate-dehydrogenase (G3PDH) genes. The PCR primers for human tropoelastin were designed from the published nucleotide sequence (Fazio et el., 1988a), and they amplify sequences within tropoelastin cDNA that are known to undergo alternative splicing in humans. Oligonucleotide probe to exon 21 was designed according to the published tropoelastin cDNA sequence, and oligonucleotides to exons 31, 32 and 33 were according to Holzenberger et al. (1993). All primers were synthesized by Oligos Etc. Inc., as shown in Table I. The human G3PDH primers and cDNA probe for Southern hybridization were obtained from Clontech Eabs., Palo Alto, CA. Polymerase chain reaction was performed in a 100 ILl volume containing 4 ~1 (tropoelastin) or 2 btl (G3PDH) of reverse transcribed material, 0.2 ~M primers, 2.5 U Taq DNA polymerase (Gibco/BRL), 2 mM MgC12 and l x PCR buffer. Skin fibroblasts were used as positive controls for the expression of tropoelastin m R N A and, as negative control, a separate tube containing all the reagents except for the cDNA was used. The cycle parameters were as follows: denaturation for 1 min at 95 °C, annealing for I min at 56 °C and 2 min for extension at 72 °C for 35 cycles. Southern hybridization PCR products were analyzed in 1.3% agarose gels and transferred to nylon membranes (Hybond, Amersham), according to manufaturer's instructions. After transfer, D N A was fixed onto the membranes by heating in a vacuum ov-

en at 80 °C for 2 h. Exon-specific oligonucleotides were synthesized by Oligos Etc. Inc. (Table II) and labeled at the 3' end with fluorescein-ll-dUTP (3' oligolabelling kit; Amersham, Arlington Heights, IL) and stored a t - 2 0 °C until use. Pre-hybridization and hybridization were done according to the instructions provided by the manufacturer (ECL detection system, Amersham), except that the prehybridization was done for 16 h and hybridization for 2 h at 42 °C. For autoradiography, the membranes were exposed to Hyperfilm ECL for 2-50 rain and then developed. D NA sequencing PCR products from a 20-week-old fetus were excised from agarose gels, purified (GeneClean; Bio 101, Vista, CA), and subcloned into the PGEM-T vector according to the manufacturer's instructions (Promega Corporation). JM109 competent cells (Promega Corporation) were transformed with the plasmids and amplified. Clones containing full length products were sequenced by the dideoxy chain termination method (Sequenase 2.0, Amersham) using [~sS]-dATP-c~S. Sequencing results were confirmed by Southern hybridization with exon-specific oligonucleotides or restriction enzyme digestion. Western blots To determine whether cultured laminar astrocytes synthesize elastin, laminar astrocytes and skin fibroblasts were harvested form culture dishes using a 0.1% trypsin (Gibco/BRL) solution and lysed into Tris-glycine SDS sample buffer (Novex Electrophoresis, San Diego, CA). After a 2min centrifugation at 1000g/4 °C, the supernatant was transferred to a fresh tube, and the total protein was quantified by the DC Protein Assay (Bio-Rad, Richmond, CA) using albumin to establish a standard curve. 2.2 ~g of total protein were loaded onto 8% Tris-glycine SDS-PAGE (Novex Electrophoresis) and then transferred onto nitrocel-

326

J . D . O . Pena et al.

1234

5 6 7 8 910111213

A

473 bp417 bp-

B 358 bp_ 304 b p -

C 983 bp-

lulose membranes (Hybond-ECL nitrocellulose, Amersham). Western blot procedure was performed according to manufacturer's instructions (ECL Western blot kit, Amersham). The primary antibody used was a rabbit polyclonal anti- human ~x-elastin (Elastin Products, Owensville, MO) at 1:2000 dilution for 1 h at room temperature. After the final wash, the blots were exposed to Kodak XAR film for 1-5 min and then developed.

Results Alternative splicing of tropoelastin m R N A in normal optic nerve heads at different ages Specific cDNA sequences, encoding for tropoelastin and G3PDH, generated by reverse transcription of total RNA from optic nerve heads, from cultured laminar astrocytes or from skin fibroblasts, were amplified by PCR. An agarose gel containing ten representative samples of O N H s from patients at different ages is shown in Fig. 1. The region of

Fig. 1. Agarose gel electrophoresis of tropoelastin PCR product from normal optic nerve heads. 3 mg of total RNA from each sample were reverse-transcribed and amplified by PCR. Panels A and B represent amplification of tropoelastin regions A and B, respectivelB and C represents amplification of G3PDH. Lane 1, 100 bp ladder; lanes 2-4, fetal samples 20, 20 and 24 wks gestational age, respectively; lane 5, 7-mo-old infant sample; lanes 6-1i, samples from 15-, 49-, 65-, 71-, 71- and 85-yr-old subjects, respectively; lane 12, skin fibroblasts; lane 13, negative control.

tropoelastin cDNA covering exons 19-24, termed "region A", gave an expected product of 473 bp and an additional product at 417 bp. Primers that amplify the region of tropoelastin cDNA covering exons 28-36, termed "region B", gave the expected 358 bp product and a spliced product of 304 bp. PCR products generated from amplification of regions A and B were detected throughout life. PCR amplification of region B seemed more efficient than region A, especially in the samples of patients 15 years and older; however, our assay is not quantitative. Skin fibroblasts, used as positive controls, yielded fragments of similar molecular weight, but the unspliced form of region A (473 bp) and the spliced form of region B (304 bp) were predominantly am-

1

2

3

4

5

473 b p 417 b p -

1 2 3 4 5 6 7 8 9 1011 473 bp417 bp-

A

268 b p -

B

205 bp-

358 bp304 bpFig. 2. Southern analysis of the RT-PCR products from Fig. 1. Southern blots were hybridized with fluorescein-labeled oligonucleotides to tropoelastin exons 21 (A) and 31 (B).

Fig. 3. Restriction digestion analysis of products amplified by region A primers (tropoelastin exons 19-24) in a 20-wk-old fetal sample. PCR products were purified from agarose gels and submitted to AvalI digestion. Lane 1, 100 bp ladder; lanes 2 and 4, 473 and 417 bp fragments, respectively, with no additon of Avail; lanes 3 and 5,473 and 417 bp, respectively, with Avail digestion.

Tropoelastin in the Optic Nerve Head

1

2

3

358 bp304 bp-

1

2

3

4

327

5

600 bp 473 bp i 417 bp268 bp-

!

iiill ii iiiiii ! i ii !!

205 bpFig. 4. Southern analysis of region B (exons 28-36) in a 49-yearold normal subject. Southern blot was hybridized with fluoresceinlabeled oligonucleotides to tropoelastin exons 31 (lane 1), 32 (lane 2) and 33 (lane 3).

Fig. 5. Avail restriction digestion of Region A (covering tropoelastin exons 19-24) in a sample from an 86-yr-old patient with glaucoma. Lane 1,100 bp ladder; lanes 2 and 4, 417 and 473 bp PCR products, respectively, with no addition of Avail; lanes 3 and 5, 417 and 473 bp products, respectively, with addition of Avail.

plified. A 983 bp product of amplification using G3PDH primers was seen in all samples. Southern blot analysis of the PCR-derived DNA using specific oligonucleotides confirmed the specificity of the products (Fig. 2).

Using specific oligonucleotides to exons 31 and 33, both products (at 358 and 304 bp) from amplification of exons 28-36 hybridized to the probe. However, when the oligonucleotide specific to exon 32 was used, only the 358 bp fragment was positive, further confirming the absence of exon 32 (Fig. 4). For comparison, a summary of the published data on alternative splicing of tropoelastin m R N A in human tissues is shown in Table III.

Sequence analysis of the PCR products PCR products derived from a 20-week-old fetal eye were subcloned and sequenced by the dideoxy chain-termination method. When sequencing the product derived from amplification of region A (exons 19-24) and region B (exons 28-36), we found that exons 22, 23 and 32 were absent. Exon 22 was absent from both fragments generated by amplification of region A primers, in accordance to the human cDNA sequence published. To confirm the absence of exon 23, we performed restriction digestion analysis, and to confirm the absence of exon 32, we performed Southern hybridization using exon-specific oligonucleotide probes (Table II). To further confirm the absence of exon 23, restriction digestion with Avail was performed on the fragments generated by amplification of region A. There is only one AvaII site in the 473 bp fragment, located within exon 23. If exon 23 were present, two digestion products (268 and 205 bp) would be expected. As shown in Fig. 3, the 473 bp fragment containing exon 23 is cleaved, yielding products of 268 and 205 bp, but the alternatively spliced product of 417 bp remains intact, confirming the absence of exon 23. Table III. Tropoelastin exons subject to alternative splicing in human tissues. Tissue

Spliced exons

Reference

Aorta

23, 24, 26A, 32

Skin

23, 32, 33 32 23, 32, 33 23, 32

Indik et al., 1987 Indik et al., 1989 Fazio et al., 1988a Holzenberger et al., 1993 Fazio et al., 1988b This study

Placenta Optic nerve head

Alternative splicing of tropoelastin in glaucoma Optic nerve heads from three donors with a history of primary open angle glaucoma were used for RT-PCR amplification. The gel electrophoresis showed that glaucomatous patients display PCR products of a size similar to those of the normal patients (473 and 417 bp for exons 19-24 and 356 and 304 bp for exons 28-36). To further confirm that the exons lost in the alternative splicing in glaucoma are the same as those lost in the fetal sample (exons 23 and

Exon 31

Exon 32 I

1

2

3

f

!

1

2

3

358 b p 304 b p -

Fig. 6. Southern blot analysis of PCR products from optic nerve samples of patients with glaucoma. Blots were hybridized with oligonucleotides specific to tropoelastin exons 31 and 32. Lanes 1-3, samples from 86-, 85- and 68- yFold glaucomatous patients, respectively.

328

J . D . O . Pena et al.

1

1234 A 983 bp-

473 bp417 bp-

B

C 358 bp304 bpFig. 7. Agarose gel electrophoresis of tropoelastin PCR products generated from cultured laminar astrocytes. 3 big of total RNA were reverse transcribed and PCR amplified using tropoelastin specific primers. Lanes 1-2, cultured cell samples from fetal optic nerves of an 18-wk-old fetus, left and right eye, respectively; lanes 3-4, cultured cell samples from 22- and 57-yr-old normal subjects. Panels A, B and C represent amplification of G3PDH, tropoelastin region A and tropoelastin region B, respectively.

32), the PCR amplified DNA was subjected to restriction digestion with Avail or hybridized to exon-specific oligonucleotides. Restriction digestion of region A fragments with Avail revealed the absence of exon 23, as demonstrated by the non-cleavage of the product at 417 bp (Fig. 5) in glaucomatous tissue. Southern blot demonstrates that exon 32 is also being spliced during reactivation of tropoelastin synthesis in patients with POAG, due to absence of hybridization of products at 304 bp (Fig. 6).

Analysis of tropoelastin mRNA and protein in cultured laminar astrocytes Laminar astrocytes cultured from two normal fetal and two normal adult eyes were used for RT-PCR amplification, Gel electrophoresis showed that cultured laminar astrocytes from adult samples also produce products at 473 and 417 bp when amplified with region A primers, and at 358 and 304 bp, when amplified with region B primers. However, cultured astrocytes from fetal optic nerve heads expressed mostly the spliced form of region B (Fig, 7). Southern hybridization using an oligonucleotide specific to exon 32 and restriction digestion with AvalI enzyme yielded results similar to those seen in vivo, i.e., absence of exons 32 and 23, respectively (not shown). We assessed tropoelastin production by laminar astro-

2

3

4

5

67 kDaFig. 8. Western blotting analysis of tropoelastin production by laminar astrocytes. Cultured laminar astrocytes were lysed in SDS sample buffer and 2.2 btg of protein were run onto 8% SDS-PAGE. The blot was incubated with an antibody specific to human ct-elastin, and detection was done by enhanced chemiluminescence. A single tropoelastin band was observed at 67 kDa. Lanes 1-2, cul tured cell samples from fetal optic nerves of an 18-wk-old fetus, left and right eye, respectively; lanes 3-4, cultured cell samples from 22- and 57-yr-old normal subjects; lane 5, sample from cultured scleral fibroblasts from a 7-too-old infant. cytes using Western blot analysis. Total protein obtained from cell lysates of laminar astrocytes or skin fibroblasts was loaded onto SDS-PAGE gel and transferred to a nitrocellulose membrane. Our results demonstrate that, in vitro, welt characterized laminar astrocytes from both fetal and adult subjects produce the translated tropoelastin, as in vivo (Fig. 8).

Discussion Elastin is one of the most important and abundant components of the extracellular matrix of the human O N H , conferring resiliency to the tissue. We have demonstrated tropoelastin alternative splicing in the human O N H , in which exons 23 and 32 are spliced. Absence of exons 23 and 32 represents the deletion of hydrophilic and hydrophobic domains, respectively, in the translated protein. In the human tropoelastin cDNA, exons 22, 23, 24, 26A, 32 and 33 are subject to alternate usage in different combinations in various tissues (lndik et al., 1990). The function of the different isoforms of tropoelastin is not yet clear. The loss of a hydrophobic domain may not affect the net charge of the fiber; similarly, the loss of hydrophilic domain may not affect cross-linking (Parks et al., 1992). Thus, these changes may not significantly alter the fiber elasticity. However, heterogeneity of tropoelastin isoforms may be important for other functions of elastic fibers, such as interactions of elastic fibers with cells, as observed in some malignancies (Mecham et al., 1989), or matrix-matrix interactions, such as binding to proteoglycans which could contribute to tissue integrity (Pasquali-Ronchetti et al., 1984). In this study, we determined the profile of tropoelastin m R N A splicing in the O N H at different ages, from the fetal period to old adulthood. Tropoelastin mRNA was detected throughout life, from fetal to adult tissues. Nevertheless, the alternative splicing pattern of tropoelastin mRNA did not change with age.

Tropoelastin in the Optic Nerve Head Using Southern hybridization with exon-specific oligonucleotides and restriction digestion analysis, we demonstrated that during reactivation of elastogenesis in primary open angle glaucoma, exons 23 and 32 are also subjected to alternative splicing, as seen in normal eyes. Therefore, the elastosis observed in the lamina cribrosa in patients with glaucoma is not due to an aberrant isoform of tropoelastin being produced by alternative splicing. Our finding of the absence of an apparent primary defect in tropoelastin suggests that the impairment in elastic fiber formation from newly synthesized tropoelastin during glaucomatous optic neuropathy probably occurs in the extracellular compartment, during assembly into the microfibrillar scaffold. Although there are several human diseases associated with problems in elastin synthesis or deposition, such as pseudoxanthoma elasticum, cuffs laxa and actinic elastosis, a primary defect in the tropoelastin gene has been identified only in supravalvular aortic stenosis (Curran et al., 1993). Moreover, no elastic tissue diseases have been correlated with a specific alternative splicing pattern of tropoelastin mRNA. In one study of pulmonary hypertension in bovine tissue, the authors demonstrated that the same isoforms of tropoelastin were being produced in animals with pulmonary hypertension, as compared to controls (Stenmark et al., 1994). However, in Marfan's syndrome, there is a defect in fibrillin, one of the protein of the microfibrillar component of elastic fibers (Milewicz et al., 1992). Another important finding of our study is the demonstration that astrocytes from the lamina cribrosa produce tropoelastin in vitro, in accordance with our previous finding of tropoelastin m R N A in astroglial cells in vivo by in situ hybridization (Hernandez et al., 1994). The alternative splicing pattern of tropoelastin in the cultured laminar astrocytes from adults resembles that seen in vivo in normal fetal and adult eyes as well as in glaucoma (splicing of exons 23 and 32). However, cultured astrocytes from fetal optic nerves apparently expressed only the spliced product of region B (alternate usage of exon 32). The reason for this difference is unclear. In addition to tropoelastin m R N A expression, laminar astrocytes cultured from fetal and adult optic nerve heads synthesize tropoelastin in vitro, as demonstrated by Western blot analysis. Astroglial cells produce several extracellular matrix proteins, such as collagens, fibronectin and proteoglycans (Hernandez et al., 1988; Hatten et al., 1991; M~iller et al., 1995), but to our knowledge this is the first report of tropoelastin production by astrocytes. Growing astrocytes from the adult lamina cribrosa in culture will provide a useful model for studying the contribution of these cells to the remodeling of the O N H in glaucoma. In addition to the demonstration of the synthesis of tropoelastin, we have previously shown that these cells synthesize collagens type I and IV. The effects of cytokines and growth factors can now be studied as mediators of extracellular matrix remodeling. Laminar astrocytes grown under elevated hydrostatic pressure will provide a model to study

329

the reactivation of tropoelastin synthesis during POAG as well as the effects of pressure on the microfibrillar component.

Acknowledgements We thank Drs. Ian Rawe, Fushin Yu and Andrew Taylor for assistance with DNA sequencing and Western blots, lvonne Vidal for assistance with cell cultures and Drs. Arthur H. Neufeld and William C. Parks for critical reading of the manuscript. The human eyes in this study were provided by the Foundation for Glaucoma Research, San Francisco, and The National Disease Research Interchange, Philadelphia. This research was supported by NIH grants EY02687 and EY06416 and by The Glaucoma Foundation, New York.

References Anderson, D. A.: UItrastructure of human and monkey lamina cribrosa and optic nerve head. Arch. OphthalmoL 82: 800-814, 1969. Boyd, C. D., Pierce, R. A., Schwarzbauer, J. E., Doege, K. and Sandell, L. J.: Alternate exon usage is a commonly used mechanism for increasing coding diversity within genes coding for extracellular matrix proteins. Matrix 13: 457-469, 1993. Burgoyne, C. E, Quigley, H. A., Thompson, H. W., Vitale, S. and Varma, R.: Early changes in optic disc compliance and surface position in experimental glaucoma. Ophthalmology 102: 1800-1809, 1995. Chomczynski, P. and Sacchi, N.: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159, 1987. Curran, M. E., Atkinson, D., Ewart, A. K., Morris, C. A., Leppert, M. E and Keating, M. T.: The elastin gene is disrupted by a translocation associated with supravalvular aortic stem)sis. Cell 73: 159-168, 1993. Fazio, J. J., Olsen, D. R., Kauh, E. A., Baldwin, C. T., Indik, Z., Ornstein-Goldstein, N., Yeh, H., Rosenbloom, J. and Uitto, J.: Cloning of full-lenght elastin cDNAs from a human skin fibroblast recombinant cDNA library: Further elucidation of alternative splicing utilizing exon-specific oligonucleotides. J. Invest. Dermatol. 91: 458-464, 1988a. Fazio, M., Olsen, D., Kuivaniemi, H., Chu, M., l)avidson, J., Rosenbloom, J. and Uitto, J.: Isolation and characterization of human elastin cDNAs, and age-associated variation in elastin gene expression in cultured skin fibroblasts, l.ab. Invest. 58: 270-277, 1988b. ffrench-Constant, C.: Alternative splicing of fibronectin-many different proteins but few different functions. Exp. (;ell Res. 221: 261-271, 1995. Hatten, M. E., Liem, R. K. H., Shelanski, M. L. and Mason, C. A.: Astroglia in CNS injury. Gila 4: 233-243, 1991. Hayreh, S. S.: Pathogenesis of optic nerve damage and visual field defects. In: Glaucoma: Conceptions of a Disease, ed. by Hellmann, K. and Richard K. T., W. B. Saunders, Philadelphia, 1978, pp. 104-180. Hernandez, M. R., Luo, X. X., Igoe, E and Neufeld, A. H.: Extracellular matrix of the human lamina cribrosa. Am. J Ophthalmol. 104: 567-576, 1987. Hernandez, M. R., Igoe, E and Neufeld, A. H.: Cell culture of the human lamina cribrosa. Invest. Ophthalmol. Vis Sci. 29: 78-89, 1988.

330

J . D . O . Pena et al.

Hernandez, M. R., Andrzejewska, W. and Neufeld, A. H.: Changes in the extracellular matrix of the human optic nerve head in primary open-angle glaucoma. Am. J. Ophthalmol. 109: 180188, 1990. Hernandez, M. R., Yang, J. and Ye, H.: Activation of elastin mRNA expression in human optic nerve heads with primary open-angle glaucoma. J. Glaucoma 3: 214-225, 1994. Holzenberger, M., Levi-Minzi, S. A., Herzog, C. P., Deak, S. B., Robert, L. and Boyd, C. D.: Quantitation of tropoelastin mRNA and assessment of alternative splicing in human skin fibroblasts by reverse transcriptase-polymerase chain reaction. PCR Methods and Applicatons 3: 107-114, 1993. Indik, Z., Yeh, H., Ornstein-Goldstein, N., Sheppard, P., Anderson, N., Rosenbloom, J. C., Peltonen, L. and Rosenbloom, J. Alternative splicing of human elastin mRNA indicated by sequence analysis of cloned genomic and complementary DNA. Proc. Natl. Acad. Sci. USA 84: 5680-5684, 1987. Indik, Z., Yeh, H., Ornstein-Goldstein, Kucich, U., Abrams, W., Rosenbloom, J. C. and Rosenbloom, J. Structure of the elastin gene and alternative splicing of elastin mRNA: Implications for human disease. Am. J. Med. Genet. 34: 81-90, 1989. Indik, Z., Yeh, H., Ornstein-Goldstein, N., and Rosenbloom, J.: Structure of the elastin gene and alternative splicing of elastin mRNA. In: Extracellular Matrix Genes, ed. by Sandell, L. J. and Boyd, C. D., Academic Press, New York, 1990, pp. 221-250. Mecham, R. P., Hinek, A., Griffin, G. L., Senior, R. M. and Liotta, L. A.: The elastin receptor shows structural and functional similarities to the 67-kDa tumor cell laminin receptor. J. Biol. Chem. 264: 16652-16657, 1989. Milewicz, D. M., Pyeritz, R. E., Crawford, E. S. and Byers, E H.: Marfan syndrome: defective synthesis, secretion, and extracellular matrix formation of fibrillin by cultured dermal fibroblasts. J. Clin. Invest. 89: 76-86, 1992. Morrison, J. C., Jerdan, J. A., Dorman, M. E. and Quigley, H. A.:

Structural proteins on the neonatal and adult lamina cribrosa. Arch. Ophthalmol. 107: 1220-1224, 1989. Mtiller, H. W., Junghans, U. and Kappler, J.: Astroglial neurotrophic and neurite-promoting factors. Pharmaceut. Ther. 6,5: 1-18, 1995. Parks, W. C., Secrist, H., Wu, L. C. and Mecham, R. P.: Developmental regulation of tropoelastin isoforms. J. Biol. Chem. 263: 4416-4423, 1988. Parks, W. C., Roby, J. D., Wu, L. C. and Grosso, L. E.: Cellular expression of tropoelastin mRNA splice variants. Matrix 12: 156-162, 1992. Pasquali-Ronchetti, I., Bressan, G. M., Fornieri, C., BaccaraniContri, M., Castellani, I. and Volpin, D.: Elastin fiber-associated glycosaminoglycans in [3-aminopropionitrile-induced lathyrism. Exp. Mol. Pathol. 40: 235-245, 1984. Quigley, H. A., Hohman, R. M., Addicks, E. M., Massof, R. W. and Green, W. R.: Morphologic changes in the lamina cribrosa correlated with neural loss in open-angle glaucoma. Am J. Ophthalmol. 95: 673-691, 1983. Stenmark, K. R., Durmowicz, A. G., Roby, J. D., Mecham, R. E and Parks, W. C.: Persistence of the fetal pattern of tropoelastin gene expression in severe neonatal bovine pulmonary hypertension. J. Clin. Invest. 93: 1234-1242, 1994. Ye, H. and Hernandez, M. R.: Heterogeneity of astrocytes in human optic nerve head. J. Comp. Neurol. 362: 441-452, 199.5. Zeimer, R. C. and Ogura, Y.: The relation between glaucomatous damage and optic nerve mechanical compliance. Arch. Opthaltool. 107: 1232-1234, 1989. Dr. M. Rosario Hernandez, Department of Ophthalmology and Visual Science, Washington University School of Medicine, 660 S. Euclid Avenue, Campus Box 8096, St. I,ouis, MO 63110. Received February 28, 1996; accepted April 29, 1996.