TRPV3 expression and vasodilator function in isolated uterine radial arteries from non-pregnant and pregnant rats

VPH-06310; No of Pages 12 Vascular Pharmacology xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Vascular Pharmacology journal homepage: www.elsevier.com/locate/vph

TRPV3 expression and vasodilator function in isolated uterine radial arteries from non-pregnant and pregnant rats Timothy V. Murphy a,⁎, Arjna Kanagarajah a, Sianne Toemoe a, Paul P. Bertrand a, T. Hilton Grayson a, Fiona C. Britton a, Leo Leader b, Sevvandi Senadheera a, Shaun L. Sandow a,c a b c

Department of Physiology, School of Medical Sciences, University of New South Wales, Sydney, NSW 2052, Australia School of Women's and Children's Health, University of New South Wales, Sydney, NSW 2052, Australia Inflammation and Healing Cluster, Faculty of Science, Health, Education and Engineering, University of the Sunshine Coast, Maroochydore, QLD 4558, Australia

a r t i c l e

i n f o

Article history: Received 21 March 2016 Accepted 4 April 2016 Available online xxxx Keywords: TRPV3 Carvacrol Uterus Radial artery Pregnancy

a b s t r a c t This study investigated the expression and function of transient receptor potential vanilloid type-3 ion channels (TRPV3) in uterine radial arteries isolated from non-pregnant and twenty-day pregnant rats. Immunohistochemistry (IHC) suggested TRPV3 is primarily localized to the smooth muscle in arteries from both non-pregnant and pregnant rats. IHC using C′ targeted antibody, and qPCR of TRPV3 mRNA, suggested pregnancy increased arterial TRPV3 expression. The TRPV3 activator carvacrol caused endothelium-independent dilation of phenylephrineconstricted radial arteries, with no difference between vessels from non-pregnant and pregnant animals. Carvacrol-induced dilation was reduced by the TRPV3-blockers isopentenyl pyrophosphate and ruthenium red, but not by the TRPA1 or TRPV4 inhibitors HC-030031 or HC-067047, respectively. In radial arteries from nonpregnant rats only, inhibition of NOS and sGC, or PKG, enhanced carvacrol-mediated vasodilation. Carvacrolinduced dilation of arteries from both non-pregnant and pregnant rats was prevented by the IKCa blocker TRAM-34. TRPV3 caused an endothelium-independent, IKCa-mediated dilation of the uterine radial artery. NOPKG-mediated modulation of TRPV3 activity is lost in pregnancy, but this did not alter the response to carvacrol. © 2016 Published by Elsevier Inc.

1. Introduction Intracellular [Ca2+] and Ca2+ entry into the endothelial and smooth muscle cells of arteries are vital in regulating arterial diameter. In addition, changes in cellular Ca2 + handling occur during vascular cell growth and proliferation, and in arterial remodelling which occurs during pregnancy and disease. In the endothelium, nitric oxide synthase (NOS) activity and endothelium-derived hyperpolarization (EDH) and subsequent relaxation of the overlying smooth muscle depend upon an increase in endothelial cell intracellular [Ca2+] [1]. The key role of voltage-sensitive Ca2+ channels in vascular smooth muscle cell function is established and knowledge of other pathways for Ca2 + entry into smooth muscle and endothelial cells is increasing [1,2]. The emergence of the transient receptor potential (TRP) super-family of voltageinsensitive cation channels has allowed identification of new Abbreviations: TRPV3, transient receptor potential vanilloid type-3 channel; IHC, immunohistochemistry; NO, nitric oxide; NOS, nitric oxide synthase; sGC, soluble guanylate cyclase; PKG, cGMP-dependent protein kinase; BKCa, IKCa, SKCa, large-, intermediate- and small-conductance Ca2+-activated K+ channel (respectively); L-NAME, Nω-nitro-Larginine methyl ester; ODQ, 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one; PE, phenylephrine. ⁎ Corresponding author. E-mail address: [email protected] (T.V. Murphy).

mechanisms for controlling Ca2 + entry and homeostasis in vascular cells [3]. The physiological roles of the various TRP channel subtypes remain to be fully established, but evidence is emerging that such channels play a vital role in several and varied vascular functions. For example, members of the TRPC (canonical) class including TRPC1, TRPC3 and TRPC6 mediate Ca2+ entry into both smooth muscle and endothelial cells induced by Ca2+ store depletion or G-protein-coupled receptors [3], whilst other studies suggest that TRPC and TRPV4 (vanilloid type-4) are mediators of endothelium-dependent vasodilation stimulated by G-protein-coupled receptors and the shear-stress of blood flow [3–5]. The TRPV family offer an interesting target for investigation due to their sensitivity to vanilloid compounds including capsaicin, resiniferatoxin, camphor and eugenol, suggesting a range of selective ligands [6]. TRPV are also osmo- and thermo-sensitive [7]. Of the six TRPV channels present in mammals, TRPV1–4 have been identified in the vasculature, but relatively few studies have examined potential vascular roles of TRPV3 compared to TRPV1, V2 and V4 [7,8]. Like TRPV4, vascular TRPV3 may also stimulate vasodilation, although very few studies have examined this potential outside cerebral arteries [7,9,10]. Indeed remarkably little is known or understood regarding the function of vascular TRPV3.

http://dx.doi.org/10.1016/j.vph.2016.04.004 1537-1891/© 2016 Published by Elsevier Inc.

Please cite this article as: T.V. Murphy, et al., TRPV3 expression and vasodilator function in isolated uterine radial arteries from non-pregnant and pregnant rats, Vascul. Pharmacol. (2016), http://dx.doi.org/10.1016/j.vph.2016.04.004

2

T.V. Murphy et al. / Vascular Pharmacology xxx (2016) xxx–xxx

TRPV3 is a generally non-selective cation channel, but does display moderately selective permeability for Ca2 + over Na+ [11]. Utilising the TRPV3 activator carvacrol, the current study examined the expression, distribution and function of TRPV3 in uterine radial arteries from age-matched non-pregnant and late (20-day) pregnant rats. Uterine radial vessels undergo extensive alteration in pregnancy, with changes in Ca2 + signalling fundamental to such adaptations [12–14]. Previous studies from our laboratory identified a role for TRPV4 channels in modulating uterine artery function during pregnancy [14]. Therefore, the hypothesis of the present study was that changes in the expression of the related TRPV3 contributed to pregnancy-induced functional changes in uterine radial arteries. 2. Materials and methods 2.1. Animals and tissue collection Female non-pregnant Sprague–Dawley rats (280 ± 8 g; n = 18) in the oestrus of their cycle were used along with age-matched 20 day pregnant rats (428 ± 13 g; n = 17; noting that full gestation in rats is 21–22 days). Rats were anaesthetised using sodium thiopentone (100 mg/kg, i.p.) and third-order radial arteries collected as described previously [14]. All dissections were performed in dissection buffer composed of (concentrations in mM): 3 MOPS, 145 NaCl, 5 KCl, 2.5 CaCl2, 1 MgSO4, 1 NaH2PO4, 0.02 EDTA, 2 pyruvate, 5 D-glucose and 1% BSA. All studies were performed in accordance with the guidelines of the National Health and Medical Research Council of Australia and the UNSW Animal Ethics and Experimentation Committee (AEEC #09/43B). 2.2. Immunohistochemistry Arteries were fixed in 2% paraformaldehyde in 0.1 M phosphate buffered saline (PBS) for 10 min. After being washed, tissues were incubated at room temperature for 2 h in blocking buffer (1% BSA and 0.2% Triton in PBS), washed and incubated overnight with the primary antibody at 4 °C. The primary antibodies for TRPV3 were rabbit anti-human N′ (1:100; Santa Cruz (H-150), sc-50414, lot #E2507) or goat antihuman C′ (1:100; Santa Cruz (K-16), sc-23372, lot#B1907), and IKCa as rabbit anti-human to N′ amino acids 2–17 (IK1, 1:100, Chen, M20; see [15]). The tissue was washed again and incubated with the secondary antibody for 2 h at room temperature. Anti-rabbit IgG Alexa Fluor 633 (1:200; Molecular Probes/Invitrogen, A21070; lot #50728A) and anti-goat IgG Alexa Fluor 633 (1:200; Molecular Probes/Invitrogen, A21082; lot #399683) were used as secondary antibodies. Following final washing the tissue was mounted on slides in anti-fade mounting media, with the media of selected preparations also containing 0.002% propidium iodide to clarify cell layer patency. An FV1000 confocal microscope (Olympus, North Ryde, Australia) was used to examine the tissue under uniform settings. Controls involved peptide block of primary antibody in a 1:10 (v/v) excess of the immunizing peptide. For the estimation of TRPV3 and IKCa channel density, the fluorescence level of confocal signals was determined using CellR software (Olympus). The mean fluorescence density of 4 randomly selected 100 mm2 regions of interest, each of 4 different preparations from a different animal, was determined; with secondary only taken as baseline fluorescence. Control images for TRPV3 and IK1 antibodies are shown in the Supplementary Fig. A 2.3. Western blot Pooled third-order radial arteries from non-pregnant and pregnant rats (arteries from 4 animals per sample) and corneal tissue from nonpregnant rats were ground in liquid nitrogen and resuspended in PBS (pH 7.4) containing a protease inhibitor cocktail (Roche, Castle Hill, NSW). This was centrifuged at 3000g at 4 °C for 5 min. The supernatant was collected, and cooled on ice. The pellet was snap frozen in liquid

nitrogen. This process was then repeated and the supernatants combined and centrifuged at 25,000g at 4 °C for 1 h. The resulting pellet was resuspended in PBS containing 0.1% Triton X-100 and protease inhibitor cocktail, aliquoted, snap frozen and stored at −80 °C. Bradford assay (Bio-Rad, Gladesville, NSW) was used to determine protein concentration in samples. Lysates of HEK293T cells overexpressing TRPV3 cDNA (containing an in-frame FLAG epitope) and control HEK293T cells containing empty vector were purchased from OriGene (Rockville, MD, USA). Protein extracts in lithium dodecyl sulphate (LDS) sample buffer (Life Technologies, Mulgrave, VIC) were heated at 70 °C for 10 min, electrophoresed on Bis-Tris denaturing polyacrylamide gels (Life Technologies) and electro-blotted onto polyvinylidene difluoride (PVDF) membranes overnight at 4 °C. Blots were blocked for 2 h with Invitrogen purified casein Tween 20 blocker, and incubated with primary antibody at 4 °C overnight. Primary antibodies were TRPV3 N′ and C′ (as above; 1:1000) and mouse monoclonal anti-FLAG (F3165, Sigma; 1:2000). Following subsequent washes in TNT buffer, membranes were incubated with appropriate secondary antibodies either conjugated with alkaline phosphatase or horseradish peroxidase, (1:5000 in 5% milk-TNT), for 2 h at 4 °C. Antibody binding was visualised either by chemiluminescence or using NBT/BCIP reagent (Pierce Biotechnology, Rockford, IL, USA). Blots were stripped and re-probed with rabbit anti-actin antibody (1:1000; A2066, Sigma). Digital densitometry was used to quantify TRPV3 band intensities relative to the intensity of actin staining.

2.4. Quantitative and analytical RT-PCR Radial arteries from pregnant or non-pregnant animals (n = 5 for each) were pooled for RNA isolation. Total RNA was extracted from homogenized vessels using RNeasy Micro Kit (Qiagen, Doncaster, VIC). RNA quantity and purity were measured by 260/280 nm absorbance using a NanoDrop™ ND-1000 spectrophotometer (ThermoFisher Scientific, Mulgrave, VIC). RNA samples (1 μg each) were reverse transcribed using the VILO™ cDNA reaction kit (Invitrogen, Mulgrave, VIC) in 20 μL reactions using an ABI 2720® thermal cycler (Applied Biosystems, Mulgrave, VIC) at 25 °C for 10 min, 42 °C for 60 min, 85 °C for 5 min. Following reverse transcription, cDNA samples were diluted 5 fold for quantitative analysis. cDNA quality was evaluated by PCR amplification of glyceraldehyde 3-phosphate dehydrogenase (Gapdh). Real-time PCR reactions were performed on a Mastercycler realplex2 (Eppendorf, North Ryde, Australia) using pre-designed FAM™ or VIC® dye-labelled TaqMan Gene Expression assays (Applied Biosystems, Mulgrave, VIC) optimized for the detection of rat TRPV3 (assay ID: Rn01460303_m1) and 18S ribosomal RNA (assay ID: Rn03928990_g1). Reactions were 20 μL volumes, consisting of TaqMan Universal PCR master mix, specific TaqMan assay and 2 uL cDNA. Each assay was run in triplicate and repeated in a duplicate PCR experiment. Control PCRs were carried out substituting RNase-free water. RT-PCR was also performed using primer set specific for rat TRPV3 mRNA [GenBank: NM_001025757]. Details of the primer sets used are provided in Table 2. PCR was performed using AmpliTaq Gold® PCR reagent (Applied Biosystems, Mulgrave, Australia) with cDNA from pregnant and non-pregnant animals (see above). PCR reactions included rat kidney cDNA as a control for primer efficiency and a template-free negative control. Reactions were performed in a ABI 2720® thermal cycler consisting of 95 °C for 10 min, then 35 cycles of 95 °C for 15 s, 55 °C for 25 s and 72 °C for 25 s, followed by a final step at 72 °C for 3 min. PCR products were resolved on 2% agarose gels. TRPV3 amplification products were purified on QIAquick columns (Qiagen, Doncaster, VIC) and subsequently sequenced at the Garvan Institute Molecular Genetics facility, Sydney. Nucleotide sequences were analysed using Vector NTI v.11 software (Invitrogen, Mulgrave, VIC) and BLASTN v.11 software [http://www.ncbi.nlm.nih.gov/BLAST/].

Please cite this article as: T.V. Murphy, et al., TRPV3 expression and vasodilator function in isolated uterine radial arteries from non-pregnant and pregnant rats, Vascul. Pharmacol. (2016), http://dx.doi.org/10.1016/j.vph.2016.04.004

T.V. Murphy et al. / Vascular Pharmacology xxx (2016) xxx–xxx

3

Fig. 1. TRPV3 channel distribution in uterine radial arteries from non-pregnant (A–D) and pregnant (E–H) rats, as determined by confocal immunohistochemistry. Two different antibodies to TRPV3 (C′ and N′) demonstrated low level labelling in endothelial cells (EC) of arteries from both rat groups (A + E; C + G), and higher levels in smooth muscle cells (SM; D, F). Coincident TRPV3 labelling of apparent perivascular sympathetic and/or sensory innervation and a putative macrophage-like cell was also observed (lower inset, D). Note that panels A–B, C–D, E–F and G–H are from the same vessel region, but at different focal planes. Upper inset, D, and inset, F, show selective antibody binding in arteries, as omission of the primary antibody and peptide (1:10 v/v excess) block, respectively; noting that the peptide to the N′ TRPV3 antibody was not available for blocking experiments. EC and SM integrity was verified by propidium iodide staining (e.g. H inset). n = 3–4, each from a different animal. Bar 25 μm; except D, lower inset, 100 μm.

2.5. Pressure myography Arteries were dissected as described above and then cannulated on glass micropipettes and mounted in a superfusion chamber. In the absence of intraluminal flow, arteries were pressurized (60 mm Hg) and diameter measured through video microscopy. Vessels were not studied if they had pressure leaks at 120 mm Hg. Arteries were superfused with Krebs solution (3 mL/min, 34 °C). Krebs solution contained 112 mM NaCl, 25 mM NaHCO3, 4.7 mM KCl, 1.2 mM MgSO4.7H2O,

Table 1 Relative fluorescence intensity of TRPV3 and IK1 confocal immunohistochemical labelling in endothelium (endo) and smooth muscle layers (sm) of the utero-placental radial artery from non-pregnant and 20 day pregnant rats.

C′ TRPV3 Ab endo — non-pregnant C′ TRPV3 Ab endo — pregnant N′ TRPV3 Ab endo — non-pregnant N′ TRPV3 Ab endo — pregnant C′ TRPV3 Ab sm — non-pregnant C′ TRPV3 Ab sm — pregnant N′ TRPV3 Ab sm — non-pregnant N′ TRPV3 Ab sm — pregnant IK1 Ab endo — non-pregnant IK1 Ab endo — pregnant IK1 Ab sm — non-pregnant IK1 Ab sm — pregnant

Mean ± SEM

% change

1.3 ± 0.3 0 2.3 ± 0.9 0 0 75.4 ± 4.4 57.8 ± 6.8 3.9 ± 0.9 35.0 ± 5.6 12.7 ± 1.0 119.5 ± 0.5 130.7 ± 4.5

– 0 – 0 – ↑ 100%⁎ – ↓ 93%⁎ – ↓ 64%⁎ – ↑ 9%

NB. secondary only is taken as baseline/‘zero’ fluorescence. Mean ± SEM for n = 3–4 preparations, each from a different animal. Ab; antibody. ⁎ P b 0.05, as significant compared to non-pregnant, unpaired t-test.

0.7 mM KH2PO4, 10 mM HEPES, 11.6 mM D-glucose and 2.5 mM CaCl2.2H2O (pH 7.4; 34 °C). Phenylephrine (PE) was used to constrict radial arteries from nonpregnant and pregnant rats to around 30% of their maximum diameter. Sensitivity to PE was increased during pregnancy [13], hence a PE concentration of 0.3 μM was used in vessels from these animals and 1 μM for those from non-pregnant rats. Three or four consecutive concentration-response curves to carvacrol (5-isopropyl-2methylphenol) were obtained in each tissue. Where present, L-NAME (100 μM) and 1H- [1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ, 10 μM), 1-[(2-chlorophenyl) diphenylmethyl]-1H-pyrazole (TRAM-34, 1 μM), tetraethylammonium chloride (TEA, 1 mM), KT-5823 (1 μM) or the various TRPV inhibitors were added into the organ bath for 20 min prior to carvacrol addition; sodium nitroprusside (SNP) was added to the bath 5 min prior to addition of carvacrol. At the end of the experiment, the organ bath was then washed out and Ca2+-free Krebs solution was added for 20 min to determine the maximum diameter. Ca2 +-free Krebs solution contained no added CaCl2 but contained 2 mM EGTA. In experiments where the vascular endothelium was removed, an air bolus was perfused through the lumen of the vessel and endothelial function was tested before and after this procedure using acetylcholine as described previously [16].

2.6. Drugs and chemicals All chemicals and drugs used in experiments were obtained from Sigma (Castle Hill, Australia or Saint Louis, USA). Carvacrol, TRAM-34, ODQ, SKA-31 and KT-5823 were dissolved in DMSO and diluted in

Please cite this article as: T.V. Murphy, et al., TRPV3 expression and vasodilator function in isolated uterine radial arteries from non-pregnant and pregnant rats, Vascul. Pharmacol. (2016), http://dx.doi.org/10.1016/j.vph.2016.04.004

4

T.V. Murphy et al. / Vascular Pharmacology xxx (2016) xxx–xxx

Fig. 2. IK1 (IKCa) channel distribution in uterine radial arteries from non-pregnant (A, B) and pregnant (C, D) rats, as determined by confocal immunohistochemistry. In radial artery of both non-pregnant and pregnant rats, IK1 antibody demonstrated low level labelling in endothelial cells (EC; A, C) and higher presence in smooth muscle cells (SM; B, D). Inset (B) shows antibody control, as peptide (1:10 v/v excess) block; whilst inset (D) shows omission of the primary antibody. EC integrity was verified by propidium iodide staining (C, red; example nuclei arrowed). n = 5–7, each from a different animal. Bar, 50 μm. SKA-31 concentration-response curves in rat isolated, pressurized (60 mm Hg) uterine radial arteries from nonpregnant and pregnant rats (n = 5 for both). Points represent mean ± SEM. SKA-31 was more potent in arteries with an intact endothelium, than those from non-pregnant rats and denuded arteries (G; P b 0.05; two-way ANOVA with Bonferroni post-hoc tests). The IKCa inhibitor TRAM-34 (TRAM, 1 μM) inhibited responses to SKA-31 in endothelium-denuded arteries (H). * indicates response to SKA-31 was significantly greater in arteries from non-pregnant compared to pregnant rats. $ indicates significant inhibition of responses by TRAM34 in arteries from pregnant and non-pregnant rats; $Δ indicates significant inhibition of responses by TRAM-34 in arteries from pregnant rats (P b 0.05; two-way ANOVA with Bonferroni post-hoc tests). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Krebs solution. Adenosine, acetylcholine, TEA and L-NAME were dissolved in Krebs solution. 2.7. Statistical calculations TRPV3 mRNA levels relative to the 18S internal control, were calculated using the comparative cycle threshold (CT) method [17]. Quantitative data are expressed as mean ± standard error of the mean (SEM). The relative fold difference in TRPV3 transcript expression between pregnant and non-pregnant groups was compared using Student's unpaired t-test using GraphPad Prism version 5.03 software (GraphPad, La Jolla, USA). Statistical significance was set at P b 0.05. In functional studies, diameter measurements were calculated as a percentage of maximal diameter determined in Ca2 +-free Krebs and expressed as

mean ± SEM. Non-linear regression analysis in GraphPad Prism was used to determine pEC50 values and maximum diameter. ‘n’ indicated the number of experiments, each involving a different animal. Data were differentially analysed using a one- or two-way analysis of variance with Bonferroni correction or a t-test where appropriate. Values of P b 0.05 were taken as statistically significant. 3. Results 3.1. TRPV3 protein and mRNA expression in uterine radial arteries from non-pregnant and pregnant rats Immunohistochemistry showed that TRPV3 was present in the smooth muscle of uterine radial arteries from non-pregnant and

Please cite this article as: T.V. Murphy, et al., TRPV3 expression and vasodilator function in isolated uterine radial arteries from non-pregnant and pregnant rats, Vascul. Pharmacol. (2016), http://dx.doi.org/10.1016/j.vph.2016.04.004

T.V. Murphy et al. / Vascular Pharmacology xxx (2016) xxx–xxx

5

Fig. 3. TRPV3 protein and transcript expression in uterine radial arteries from pregnant and non-pregnant rats. A: Western analysis of TRPV3 expression in membrane-enriched fractions of uterine radial arteries using the TRPV3 N′ antibody. Each gel lane contains third-order arteries pooled from 4 animals with 4 lanes for each non-pregnant and pregnant group (n = 4), plus corneal tissue as a control. Immunoreactive bands corresponding to monomeric TPV3 protein (~90 kDa) and a high molecular weight (HMW, N220 kDa) band containing TRPV3 are highlighted. Actin labelling (43 kDa band) was used as a loading control between the groups. B: Comparison of the relative labelling intensity of TRPV3 (90 kDa and HMW bands) with actin. Columns represent the mean ± SEM, n = 4 for both.* indicates significant difference in TRPV3 expression compared with non-pregnant (P b 0.05, unpaired t-test). C: Western blot of TRPV3 reactivity in HEK293T cell lysates either overexpressing TRPV3-FLAG cDNA (‘+’ lanes) or expressing empty vector (‘−’ lanes). Probing with either the N′ or C′ terminal TRPV3 antibody labelled a predominant band of ~90 kDa in ‘+’ lanes. Similar reactivity was observed for FLAG antibody labelling. No 90 kDa band was detected when the blot was probed with preabsorbed C′ TRPV3 Ab (incubation with a 1:10 (v/v) excess of peptide). D: RT-PCR analysis of TRPV3 transcripts in whole radial arteries from pregnant and nonpregnant rats. Amplification products were resolved on 2% agarose gels alongside a 100 bp marker. RT-PCR Set A primers (±exons 5/6; N′) amplify a 170 bp product; Set B primers (±exons 2–4; N′) amplify a 199 bp product and Set C primers (±exon 15–17; C′) amplify a 216 bp product. +ctrl, kidney tissue; Non, non-pregnant, Preg pregnant; ntc, no template negative control.

pregnant rats (see Fig. 1, Table 1). Two antibodies were used to detect TRPV3, targeting the N′ and C′ regions. Observations with both antibodies suggested that TRPV3 was present at a low level in the endothelium of arteries from non-pregnant and pregnant rats (Fig. 1A and 1E; 1C and 1G; Table 1). TRPV3 was expressed more prominently in the smooth muscle (Table 1). The N′ antibody showed prominent labelling in the smooth muscle of radial arteries from non-pregnant rats (Fig. 1D, Table 1), but TRPV3 N′ labelling declined markedly in vessels from pregnant rats (Fig. 1H, Table 1). Observations using the C′ antibody showed the opposite pattern, with low-intensity labelling in the smooth muscle of arteries from non-pregnant animals (Fig. 1B, Table 1), but significantly increased labelling in arteries from pregnant rat (Fig. 1F, Table 1). Both antibodies labelled TRPV3 with equal intensity in control studies using rat corneal epithelium, and tissue binding of both antibodies were prevented by pre-incubation with native peptide (Fig. 2A). Expression of IKCa (IK1) in the radial arteries was also investigated using immunohistochemistry. IKCa was strongly expressed in the smooth muscle of radial arteries, with no apparent effect of pregnancy on the level of expression (Fig. 2B, Table 1). In contrast, IKCa was expressed at a low level in the endothelium of radial arteries from non-pregnant rats and declined significantly in the endothelium of arteries from pregnant rats (Fig. 2B, Table 1).

TRPV3 protein expression was examined further by Western analysis of membrane-enriched fractions of pooled uterine radial arteries isolated from pregnant and non-pregnant rats. Utilizing the N′ antibody, the expression of a 90 kDa TRPV3 protein was detectable at a low level in membrane-enriched samples of pooled uterine radial arteries from pregnant rats, and when compared with vessels from nonpregnant rats, expression was relatively higher in the latter (P b 0.05; t-test; Fig. 3A, 3B). The N′ antibody also labelled a high molecular weight (HMW) band (N 220 kDa), but expression of this band was not different between non-pregnant and pregnant rats (Fig 3A, 3B; P N 0.05, t-test). The C′ antibody did not detectably label a 90 kDa band in membrane-enriched artery preparations from non-pregnant or pregnant rats, but did label a HMW band in the artery samples and corneal epithelium (not shown). However, the C′ antibody recognised a 90 kDa band in lysates of HEK293 cells overexpressing TRPV3 (Fig 3C), and this band was absent when the C′ antibody was preincubated with the immunizing peptide, and from lysates of HEK293T cells expressing empty vector. Similar observations were made with the N′ and FLAG antibodies (Fig 3C). To further investigate the expression of TRPV3 in radial arteries, we performed quantitative RT-PCR to assay TRPV3 mRNA normalised to 18S rRNA. The normalised Ct values for TRPV3 in arteries from non-

Please cite this article as: T.V. Murphy, et al., TRPV3 expression and vasodilator function in isolated uterine radial arteries from non-pregnant and pregnant rats, Vascul. Pharmacol. (2016), http://dx.doi.org/10.1016/j.vph.2016.04.004

6

T.V. Murphy et al. / Vascular Pharmacology xxx (2016) xxx–xxx

Table 2 Primer sets designed to specifically amplify TRPV3 mRNA fragments in regions corresponding to the N- (sets A and B) and C- (set C) regions of the protein. Primer set A B C

Forward (exon 5) Reverse (exon 6) Forward (exon 2) Reverse (exon 4) Forward (exon 15) Reverse (exon 17)

Sequence 5′-3′

Product size

CTGGCCAAGGAAGAACAGAG GTCAGCTTGTGCATGAGGAA GATCTCACCCCCACCAAGAA GGATGGGGTCTCTGTCACAT AGCGGATCTGGGCCTTGCAG CTGCTGTCCGTCTTATGGGC

170 bp 199 bp 216 bp

pregnant and pregnant animals were 19.00 ± 0.2 and 16.37 ± 0.18, respectively. TRPV3 expression in pregnant relative to non-pregnant animals was determined by the 2− ΔΔCt method. TRPV3 was expressed 6.23 ± 0.10 fold more in arteries from pregnant compared to nonpregnant rats (P b 0.05 t-test, n = 5). In an attempt to resolve the apparent discrepancy between TRPV3 IHC and Western blot data using and N′ and C′ antibodies, mRNA expression was also examined with primer sets designed to specifically amplify TRPV3 mRNA fragments in regions corresponding to the N- and C- regions of the protein where the antibodies are predicted to bind (see Table 2). As shown in Fig. 3D, each primer set yielded a single TRPV3 fragment of the expected size for the wildtype TRPV3 transcript. Fragments that differed in size corresponding to the size of an alternative exon were not observed in arterial tissue from pregnant and non-pregnant rats, indicating no exon splicing events in the regions analysed. Sequencing and analysis of the amplification products confirmed these PCR product sequences matched the rat TRPV3 cDNA sequence and were the same for radial arteries from pregnant and non-pregnant rats. The expression of TRPV3 mRNA was also observed in rat kidney tissue (used as a positive control for primer sets), consistent with previous report for TRPV3 expression (http://www.ncbi.nlm.nih.gov/geoprofiles/74915849). 3.2. Functional responses of isolated, pressurized radial arteries Functional studies were performed in pressurised (60 mm Hg) uterine radial arteries from non-pregnant and pregnant rats. Radial arteries from non-pregnant rats had a maximum intra-luminal diameter (determined in Ca2+-free Krebs) of 109.9 ± 5.4 μm (n = 24). In radial arteries from pregnant rats the maximum intra-luminal diameter was significantly greater at 211.9 ± 18.3 μm (n = 22; P b 0.05, t-test). Despite this change in diameter, there was no significant difference in wall thicknesses between uterine radial arteries from non-pregnant and pregnant rats, as measured by video microscopy ((outside diameter − inside diameter) / 2). In uterine radial arteries from nonpregnant rats the wall thickness was 23.0 ± 1.3 μm and in vessels from pregnant rats 22.8 ± 1.1 μm (P N 0.05, t-test). The IKCa activator SKA-31 (0.1–30 μM) caused a concentrationdependent dilation of PE pre-constricted arteries (Fig. 2G). SKA-31

was more potent in arteries from non-pregnant then pregnant rats (Fig. 2G, Table 3). Following functional ablation of the endothelium (endothelium-denuded), SKA-31 still caused dilation of the arteries but removing the endothelium reduced its' potency in vessels from nonpregnant rats. Responses in endothelium-denuded arteries from pregnant rats were not altered significantly (Fig. 2G). The IKCa inhibitor TRAM-34 (1 μM) inhibited SKA-31-induced relaxation of the endothelium-denuded arteries, at concentrations of SKA-31 up to 3 μM; higher concentrations of SKA-31 were less sensitive to TRAM-34 (Fig. 2H). The TRPV3 activator carvacrol (1 μM–3 mM) caused a concentration-dependent dilation of PE pre-constricted arteries (Fig. 4). There was no significant difference between radial arteries from non-pregnant and pregnant rats in their response to carvacrol, in terms of either EC50 or maximum dilation; the EC50 of carvacrol in non-pregnant rat arteries was 93 ± 7 μM (n = 11) and in pregnant rat arteries, 85 ± 8 μM (n = 10; see Table 3; Fig. 4A). Responses to carvacrol were significantly inhibited by the TRPV3 antagonists isopentenyl pyrophosphate (IPP, 3 μM) and ruthenium red (10 μM), in arteries from both non-pregnant and pregnant rats (Fig. 4B, 4C and Table 3). The TRPA1 and TRPV4 inhibitors HC-030031 (10 μM) and HC-067047 (1 μM) respectively did not alter responses to carvacrol in arteries from non-pregnant or pregnant rats (Fig. 4B, C; Table 3). 3.3. Effect of NO-cGMP-PKG pathway inhibition and endothelium removal on responses to carvacrol In radial arteries from non-pregnant rats, simultaneous inhibition of NOS and sGC using L-NAME (100 μM) and ODQ (10 μM) respectively enhanced the response to 100 μM carvacrol (Fig. 5A; P b 0.05, twoway ANOVA). L-NAME plus ODQ did not significantly increase the potency of carvacrol as measured by pEC50, but the combination of NOS and sGC inhibition did increase the potency of carvacrol in radial arteries from non-pregnant rats compared to vessels from pregnant rats, where L-NAME plus ODQ had no effect on responses to carvacrol (Table 3, Fig. 5B). The cGMP-dependent protein kinase (PKG) inhibitor KT-5823 (1 μM) enhanced the vasodilator response to carvacrol in terms of pEC50 in arteries from non-pregnant rats, and also compared to vessels from pregnant rats (Table 3), and the response to individual concentrations of carvacrol in arteries from non-pregnant rats (10 and 30 μM, Fig. 5C,P b 0.05, two-way ANOVA). Removal of the endothelium from non-pregnant radial arteries did not alter responses to carvacrol (Fig. 5E). Pregnancy was associated with a loss of the enhancing effects of NO and PKG-inhibition on responses to carvacrol. In radial arteries from pregnant rats, neither the L-NAME and ODQ combination nor KT-5823 had any effect upon responses to carvacrol (see Table 3; Fig. 5B, 5D). As in arteries from non-pregnant rats, removal of the endothelium did not alter responses to carvacrol (Fig. 5F).

Table 3 pEC50 and Emax for carvacrol and SKA-31 in uterine radial arteries from non-pregnant and pregnant rats. Mean ± SEM for 4–11 experiments. Non-pregnant

Carvacrol Carvacrol + L-NAME/ODQ Carvacrol + KT-5823 Carvacrol – Endothelium SKA-31 SKA-31 − Endothelium Carvacrol Carvacrol + HC-030031 Carvacrol + HC-067047 Carvacrol + IPP Carvacrol + Ruthenium Red

Pregnant

pEC50

Emax (%)

pEC50

Emax (%)

4.03 ± 0.08 4.17 ± 0.08▲ 5.18 ± 0.13⁎,▲ 4.03 ± 0.08 5.86 ± 0.15 5.60 ± 0.21 4.15 ± 0.07 4.37 ± 0.06 4.19 ± 0.07 3.85 ± 0.03⁎ 3.87 ± 0.14⁎

92.1 ± 3.6 91.1 ± 3.1 94.2 ± 4.5 91.0 ± 5.7 99.1 ± 9.9 85.0 ± 9.2 98.4 ± 4.0 92.5 ± 3.1 98.7 ± 3.7 96.0 ± 1.7 100.0 ± 9.8

4.07 ± 0.10 3.78 ± 0.15 4.19 ± 0.04 4.28 ± 0.05 5.55 ± 0.07▲ 5.36 ± 0.45 4.24 ± 0.09 4.37 ± 0.17 3.97 ± 0.07 3.83 ± 0.06⁎ 3.32 ± 0.27⁎

94.8 ± 3.4 92.5 ± 7.1 98.2 ± 3.0 95.1 ± 2.2 93.2 ± 4.4 86.7 ± 6.2 91.4 ± 4.5 91.9 ± 7.9 99.0 ± 5.4 97.6 ± 4.0 100.5 ± 12.4

⁎ Significantly different from carvacrol alone (P b 0.05, paired t-test). ▲ Significantly different from value in pregnant rats (P b 0.05, unpaired t-test).

Please cite this article as: T.V. Murphy, et al., TRPV3 expression and vasodilator function in isolated uterine radial arteries from non-pregnant and pregnant rats, Vascul. Pharmacol. (2016), http://dx.doi.org/10.1016/j.vph.2016.04.004

T.V. Murphy et al. / Vascular Pharmacology xxx (2016) xxx–xxx

7

radial arteries from pregnant rats, SNP (1 μM, 1 and 3 mM) caused a concentration-dependent increase in the vasodilator responses to carvacrol (P b 0.05, one-way ANOVA, n = 4 for all; Fig. 6A, C). Lower concentrations of SNP (10 and 100 nM) had no effect on responses to carvacrol (Fig. 6A, C). In arteries from non-pregnant rats, SNP did not alter the response to carvacrol (Fig. 6B). When the actions of endogenous NO were blocked (i.e. in the presence of L-NAME and ODQ), SNP continued to enhance carvacrol-induced dilation of arteries from nonpregnant (Fig. 6D) and pregnant rats (Fig. 6E). 3.5. Role of BKCa and IKCa in responses to carvacrol The roles of BKCa and IKCa in responses to carvacrol were investigated using the concentration-selective BKCa inhibitor tetraethylammonium chloride (TEA, 1 mM) and the IKCa inhibitor TRAM-34 (1 μM). Experiments were conducted in the presence of LNAME/ODQ to prevent potential complicating effects of endogenous NO/cGMP. TRAM-34 abolished the vasodilator response to 100 μM carvacrol in radial arteries from both non-pregnant and pregnant rats (see Fig. 7A, B). Indeed, TRAM-34 abolished responses to carvacrol over the concentration range 10–300 μM, but responses to concentrations of carvacrol N 300 μM proved resistant to TRAM-34 (data not shown). In contrast, the BKCa inhibitor TEA (1 mM), did not significantly inhibit responses to carvacrol, in either non-pregnant or pregnant rats (see Fig. 7A, B). 4. Discussion

Fig. 4. A: Carvacrol concentration-response curves in rat isolated, pressurized (60 mm Hg) uterine radial arteries from non-pregnant (n = 10) and pregnant rats (n = 11). Points represent mean ± SEM. Pregnancy had no significant effect on the response to carvacrol (P N 0.05; two-way ANOVA with Bonferroni post-hoc tests). B and C: Carvacrol concentration-response curves in radial arteries from non-pregnant (B) and pregnant (C) rats in the absence (Control) and presence of various TRPV inhibitors (IPP, isopentenyl pyrophosphate). * indicates significant inhibition of responses (P b 0.05; two-way ANOVA with Bonferroni post-hoc tests).

3.4. Effect of an NO donor on responses to carvacrol As pregnancy was associated with a loss of basal NO-mediated inhibition of TRPV3 in the uterine radial arteries, the question of whether exogenous NO could inhibit TRPV3 in arteries from pregnant rats was investigated using the NO donor sodium nitroprusside (SNP). In uterine

This study investigated the distribution and expression of TRPV3 channels and the vasodilator effect of the TRPV3 activator carvacrol in uterine radial arteries from non-pregnant and pregnant rats. These vessels undergo significant changes during pregnancy, including extensive remodelling [14]. TRPV3 in radial arteries displayed marked changes in expression and regulation with pregnancy, but surprisingly the basic distribution and mechanism of action of the channel remained unaltered in pregnancy. One notable exception was in the regulation of the channel, with a loss of NO-PKG mediated modulation of channel activation in pregnancy. TRPV3 expression and distribution in the vessels as assessed by IHC, using distinct antibodies directed against TRPV3 N′ and C′ regions, showed that the channel was highly expressed in the medial smooth muscle, with comparatively low expression in endothelial cells. Functional studies with carvacrol supported smooth muscle localization, as functional ablation of the endothelium did not alter carvacrol-induced vasodilation in arteries from either rat model. This is in contrast to rat posterior and superior cerebellar arteries where carvacrol-induced relaxation of the vessel was entirely endothelium-dependent, matching the apparent distribution of TRPV3 [9]. Smooth muscle localization of TRPV3 is supported by studies in rat aorta and pulmonary arteries [18] and human pulmonary artery smooth muscle cells in culture [19], although the functional role of the channels was not established in those studies. The effect of pregnancy on TRPV3 expression in the uterine radial arteries was investigated. Quantitative PCR demonstrated TRPV3 mRNA in the arteries with a significant 6-fold increase in TRPV3 mRNA in arteries from pregnant rats, relative to non-pregnant rats. Protein expression studies provided conflicting results depending upon which TRPV3 antibody was used, with C′ antibody also showing increased TRPV3 expression in pregnancy, whilst N′ antibody suggested the opposite. The possibility that these observations represented the differential expression of TRPV3 splice variants [20] was explored, but no evidence was found supporting expression of a TRPV3 splice variant in radial arteries from pregnant rats, at least within the N′ or C′ antibody epitope regions. TRPV3 and TRP channels generally are assembled as tetramers and form part of a signalling complex containing components including other TRP proteins, often from the same subfamily [3,7,18,21]. The N′ region of all

Please cite this article as: T.V. Murphy, et al., TRPV3 expression and vasodilator function in isolated uterine radial arteries from non-pregnant and pregnant rats, Vascul. Pharmacol. (2016), http://dx.doi.org/10.1016/j.vph.2016.04.004

8

T.V. Murphy et al. / Vascular Pharmacology xxx (2016) xxx–xxx

Fig. 5. Carvacrol concentration-response curves in rat isolated, pressurized (60 mm Hg) uterine radial arteries from non-pregnant (A, C, E) and pregnant (B, D, F) rats in the absence and presence of L-NAME (100 μM)/ODQ (10 μM; A, n = 6, B, n = 9), KT-5823 (1 μM; C, n = 6, D, n = 4) and with the endothelium removed (E, n = 4, F, n = 4). Points represent mean ± SEM. * indicates a significant increase in the response to carvacrol (P b 0.05, two-way ANOVA with Bonferroni post-hoc tests).

TRPV proteins, including TRPV3, is rich in ankyrin repeats [22,23] which allow protein–protein interactions and attachment to cytoskeletal elements. Therefore, post-translational modification of TRPV3 and the assembly of such complexes probably affected both the conformation of the protein and the accessibility to antibody binding of the N′ (and possibly C′) region of the protein. For example, the smooth muscle layer of rat uterine radial artery also contains TRPV4, expression of which is increased in pregnancy [14]. TRPV4 can coassemble with TRPV3 to form functional channels [24] and such an arrangement may also affect both the folded conformation and accessibility of TRPV3 to antibody binding.

The high molecular weight (HMW) bands evident on Western blots of arterial and corneal tissue probed with either antibody most likely represent non-dissociated protein/lipid complexes of TRPV3 channel tetramers containing N′ and C′ epitope regions. The presence of HMW complexes arises from the method used for preparing membranes and separating the constituent proteins, glycoproteins and lipids, the composition, concentration, and physico-chemical properties of these components, and their variable resistance to dissociation by detergents and temperature [25]. The monomeric 90 kDa band observed on Western blots of tissue samples probed with N′ antibody but not on blots probed with C′ antibody represents TRPV3 protein with N′ epitopes present,

Please cite this article as: T.V. Murphy, et al., TRPV3 expression and vasodilator function in isolated uterine radial arteries from non-pregnant and pregnant rats, Vascul. Pharmacol. (2016), http://dx.doi.org/10.1016/j.vph.2016.04.004

T.V. Murphy et al. / Vascular Pharmacology xxx (2016) xxx–xxx

9

Fig. 6. A: Representative trace of an experiment showing effect of sodium nitroprusside (SNP) on carvacrol (Carv)-induced vasodilation of an isolated, pressurized (60 mm Hg) uterine radial artery from a pregnant rat. Vessels were pre-constricted with phenylephrine (PE). Vertical, broken lines represent periods where recording stopped whilst the vessel recovered from carvacrol treatment or was incubated with SNP (5 min). B–E: Group data showing the effect of various concentrations of SNP (0.01, 0.1, 1 μM and 1 mM) on responses to carvacrol of uterine radial arteries from non-pregnant (B, D) and pregnant (C, E) rats, in the absence (B, C) and presence (D, E) of L-NAME (100 μM) and ODQ (10 μM). Columns represent mean ± SEM, n = 4 for all. * indicates a significant enhancement of the response to carvacrol caused by SNP (P b 0.05, two-way ANOVA with Bonferroni post-hoc tests).

that has either wholly or partially lost the major C′ epitopes, possibly during channel turnover. In lysates of TRPV3 transfected HEK cells, both antibodies unambiguously labelled a 90 kDa band representing monomeric TRPV3 protein, and the absence of HMW complexes containing TRPV3 reflects the artificial nature of this host-vector expression system.

Despite these observed changes in TRPV3 expression, the TRPV3 activator carvacrol produced near-identical concentration–vasodilation relationships in radial arteries from non-pregnant and pregnant rats. Carvacrol is a TRPV3 and TRPA1 activator [6], but investigations using various TRPV inhibitors, including isopentenyl phyrophosphate [26], suggested carvacrol acted through TRPV3 in the radial arteries

Please cite this article as: T.V. Murphy, et al., TRPV3 expression and vasodilator function in isolated uterine radial arteries from non-pregnant and pregnant rats, Vascul. Pharmacol. (2016), http://dx.doi.org/10.1016/j.vph.2016.04.004

10

T.V. Murphy et al. / Vascular Pharmacology xxx (2016) xxx–xxx

Fig. 7. Vasodilation induced by carvacrol (CAR, 100 μM) of isolated, pressurized (60 mm Hg) uterine radial arteries from non-pregnant (A) and pregnant (B) rats in the absence (CAR, A, n = 11, B, n = 10) and presence of L-NAME/ODQ (A, n = 6, B, n = 9), L-NAME/ODQ/TRAM-34 (1 μM; A, n = 6, B, n = 4) or L-NAME/ODQ/TEA (1 mM, A, n = 5, B, n = 5). Also shown is pre-carvacrol diameter (Base, A, n = 11, B, n = 10). Columns represent mean ± SEM. * indicates a significant inhibition of the response to carvacrol in the presence of L-NAME/ODQ (P b 0.05, two-way ANOVA with Bonferroni post-hoc tests).

regardless of the rats' pregnancy status. In the uterine radial arteries carvacrol was a less potent vasodilator than in cerebral vessels [9] where an EC50 of about 4 μM was reported, approximately 20-fold more potent than in the radial arteries in the current study. Reported concentrations for carvacrol in activating TRPV3 are diverse, from the low μM range in cerebral arteries [8,9] and corneal epithelial cells [27], to the mM concentrations used in TRPV3-expressing HEK cells [6,28,29] and rat keratinocytes [30,31]. The membrane lipid environment of TRPV3 is known to affect its potency [9] and the differential location of the vasoactive TRPV3 in uterine radial arteries as opposed to cerebellar vessels (smooth muscle vs. endothelium, respectively) may also account for the observed difference in the potency of carvacrol in the vessels. TRPV3 in radial arteries from non-pregnant rats appeared to be negatively regulated by endogenous NO, through cGMP-dependent phosphorylation of the channel by PKG. In the present study inhibition of PKG caused an increase in the potency of carvacrol to an EC50 of about 7 μM, which is comparable with that observed in the cerebral arteries. PKG-mediated phosphorylation is known to inhibit several members of the TRPC family [32], including TRPC1 and C3 in rat carotid arteries [33] and TRPC6 in vascular smooth muscle cells [34,35]. TRPC channels

on vascular smooth muscle are commonly associated with Ca2+ entry and vasoconstriction, and their inhibition by NO-cGMP-PKG is seen as a mechanism contributing to the vasodilator effect of NO [33], although a recent study demonstrated a role for TRPC3 in endotheliumdependent vasodilation [4]. Some studies have suggested that TRPV4 coupled to NO production [7] may be inhibited in a negative feedback manner by cGMP in mouse and rat pulmonary vascular endothelial cells [36] and NO-activated PKG in cochlear cells [37]. In the current study, vasodilation-stimulating TRPV3 in the radial arteries also appeared to be negatively-regulated by local NO-cGMP-PKG, despite TRPV3 not being directly coupled to NO production. In contrast to observations in arteries from non-pregnant rats, in vessels from pregnant animals, inhibition of the NO-cGMP-PKG signalling mechanism had no effect on TRPV3 function as assessed by responses to carvacrol, despite these vessels increasing NO production during pregnancy [38,39], suggesting that the ability of NO or PKG to inhibit TRPV3 was lost during pregnancy. This was investigated using the NO donor SNP. In arteries from pregnant rats, SNP actually increased responses to carvacrol, probably due to cysteine S-nitrosylation of the channel [40], an idea supported by the observation that the effect persisted when sGC was inhibited by ODQ. Conserved Cys residues in TRPV1, V3 and V4 along with TRPC1, C4 and C5 may be directly nitrosylated by NO, increasing the channel activity; at a concentration of 1 mM, the NO donor SNAP caused an approximate 3-fold increase in TRPV3-mediated Ca2+ entry into HEK cells [40], an effect comparable to the current study where 1 mM SNP increased the response to 30 μM carvacrol by approximately 4-fold. Such effects of SNP were not observed in arteries from non-pregnant rats, unless the endogenous NOS-sGC system was blocked. These apparent opposing effects of NO on TRPV3 activity–activation via nitrosylation, and inhibition through PKG-mediated phosphorylation–may explain why, in arteries from non-pregnant rats, inhibition of PKG produced a greater increase in the response to carvacrol than inhibition of NOS or removal of the endothelium (see [41]). In any case, endogenous NO-cGMP-PKG inhibited TRPV3 activity in arteries from non-pregnant, but this effect was lost in pregnant rats. Pharmacological studies suggested carvacrol-induced vasodilation occurred via IKCa channels in uterine radial arteries from nonpregnant and pregnant rats. IKCa channels causing vasodilation are usually associated with the vascular endothelium and endothelium-derived hyperpolarization of smooth muscle [42–45], but carvacrol-induced dilation in the present study was independent of the endothelium. IHC confirmed the IKCa in uterine radial arteries from both non-pregnant and pregnant rats were present at a high level in the vascular smooth muscle, as reported previously in other vessels and human fetoplacental vascular smooth muscle cells [46,47]. Furthermore, the IKCa activator SKA-31 [48] caused dilation of the arteries following functional ablation of the endothelium, suggesting these IKCa are capable of stimulating smooth muscle relaxation. As IKCa distribution was similar to that of TRPV3, this suggests the potential for TRPV3 to cause vasodilation by facilitating a localized increase in [Ca2+] within the smooth muscle cell, thus activating spatially juxtaposed IKCa which hyperpolarize the cell membrane, leading to relaxation of the muscle. It remains to be confirmed if TRPV3, Ca2+ signals and IKCa are indeed spatially organised to form such a microdomain signalling complex in these vessels. In rat cerebellar arteries endothelium-dependent, carvacrol-induced vasodilation was blocked by each of TRAM-34, the SKCa inhibitor apamin and Ba2+, an inward-rectifying K+ channel (KIR) blocker [9]. SKCa- and KIRmediated mechanisms are commonly associated with endotheliumderived hyperpolarization and vasodilation [43–45], although their participation in the effects of carvacrol in the present study cannot be ruled out entirely. TRPV4 channels localized to vascular smooth muscle are thought to function through activation of BKCa [49,50], but the BKCa inhibitor TEA did not inhibit responses to carvacrol in arteries from either group of rats in the current study, suggesting that BKCa is not part of TRPV3 signalling in these vessels.

Please cite this article as: T.V. Murphy, et al., TRPV3 expression and vasodilator function in isolated uterine radial arteries from non-pregnant and pregnant rats, Vascul. Pharmacol. (2016), http://dx.doi.org/10.1016/j.vph.2016.04.004

T.V. Murphy et al. / Vascular Pharmacology xxx (2016) xxx–xxx

5. Conclusions TRP channel pharmacology and physiology are emerging fields offering many potential benefits to human health. This study makes several novel findings concerning the expression and function of TRPV3 in small, uterine radial arteries in non-pregnant and pregnant rats. Notably, TRPV3 was highly expressed in the smooth muscle, and negligibly in the endothelium of these vessels. Changes in the expression of TRPV3 mRNA in these arteries during pregnancy, and changes to the protein which, whilst not effecting the action of carvacrol, may alter TRPV3 activation by other agents or in concert with co-expressed TRPV. The mechanism of vasodilation (via IKCa) was the same as that reported for endothelial TRPV3. In radial arteries from non-pregnant rats, TRPV3 channels were subject to regulation by endogenous NO via cGMP-dependent protein kinase but this does not occur in pregnant rats, in which vascular NO production is increased. Thus, the function of the vasodilation-inducing TRPV3-IKCa unit is preserved in pregnancy. The observations made will stimulate further investigation into TRP channel function and of their specific roles in the regulation of signalling mechanisms in controlling vascular tone and function in health, development and disease. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.vph.2016.04.004. Source of funding This work was supported by National Health and Medical Research Council of Australia (NHMRC) Project Grant APP1048885 to PPB and SLS; and a NHMRC Dora Lush Scholarship GNT0630768 to SS. Disclosures No conflicts of interest, financial or otherwise, are declared by the authors. References [1] S.L. Sandow, S. Senadheera, T.H. Grayson, D.G. Welsh, T.V. Murphy, Calcium and endothelium-mediated vasodilator signaling, Adv. Exp. Med. Biol. 740 (2012) 811–831. [2] M.J. Berridge, Smooth muscle cell calcium activation mechanisms, J. Physiol. 586 (2008) 5047–5061. [3] S. Earley, J.E. Brayden, Transient receptor potential channels and vascular function, Clin. Sci. (Lond.) 119 (2010) 19–36. [4] S. Senadheera, Y. Kim, T.H. Grayson, S. Toemoe, M.Y. Kochukov, J. Abramowitz, et al., Transient receptor potential canonical type 3 channels facilitate endotheliumderived hyperpolarization-mediated resistance artery vasodilator activity, Cardiovasc. Res. 95 (2012) 439–447. [5] S.K. Sonkusare, A.D. Bonev, J. Ledoux, W. Liedtke, M.I. Kotlikoff, T.J. Heppner, et al., Elementary Ca2+ signals through endothelial TRPV4 channels regulate vascular function, Science 336 (2012) 597–601. [6] H. Xu, M. Delling, J.C. Jun, D.E. Clapham, Oregano, thyme and clove-derived flavors and skin sensitizers activate specific TRP channels, Nat. Neurosci. 9 (2006) 628–635. [7] R.L. Baylie, J.E. Brayden, TRPV channels and vascular function, Acta. Physiol. (Oxford) 203 (2011) 99–116. [8] S. Earley, J.E. Brayden, Transient receptor potential channels in the vasculature, Physiol. Rev. 95 (2015) 645–690. [9] S. Earley, A.L. Gonzales, Z.I. Garcia, A dietary agonist of transient receptor potential cation channel V3 elicits endothelium-dependent vasodilation, Mol. Pharmacol. 77 (2010) 612–620. [10] P.W. Pires, M.N. Sullivan, H.A. Pritchard, J.J. Robinson, S. Earley, Unitary TRPV3 channel Ca2+ influx events elicit endothelium-dependent dilation of cerebral parenchymal arterioles, Am. J. Physiol. Heart Circ. Physiol. 309 (2015) H2031–H2041. [11] H. Xu, I.S. Ramsey, S.A. Kotecha, M.M. Moran, J.A. Chong, D. Lawson, et al., TRPV3 is a calcium-permeable temperature-sensitive cation channel, Nature 418 (2002) 181–186. [12] G. Osol, M. Mandala, Maternal uterine vascular remodeling during pregnancy, Physiology (Bethesda) 24 (2009) 58–71. [13] S. Senadheera, P.P. Bertrand, T.H. Grayson, L. Leader, M. Tare, T.V. Murphy, et al., Enhanced contractility in pregnancy is associated with augmented TRPC3, L-type, and T-type voltage-dependent calcium channel function in rat uterine radial artery, Am. J. Phys. Regul. Integr. Comp. Phys. 305 (2013) R917–R926. [14] S. Senadheera, P.P. Bertrand, T.H. Grayson, L. Leader, T.V. Murphy, S.L. Sandow, Pregnancy-induced remodelling and enhanced endothelium-derived hyperpolarization-type vasodilator activity in rat uterine radial artery: transient

[15]

[16]

[17]

[18]

[19]

[20] [21]

[22]

[23]

[24]

[25] [26]

[27]

[28]

[29] [30] [31]

[32] [33]

[34]

[35]

[36]

[37]

[38] [39]

[40]

[41] [42]

11

receptor potential vanilloid type 4 channels, caveolae and myoendothelial gap junctions, J. Anat. 223 (2013) 677–686. M.X. Chen, S.A. Gorman, B. Benson, K. Singh, J.P. Hieble, M.C. Michel, et al., Small and intermediate conductance Ca(2+)-activated K+ channels confer distinctive patterns of distribution in human tissues and differential cellular localisation in the colon and corpus cavernosum, Naunyn Schmiedeberg's Arch. Pharmacol. 369 (2004) 602–615. L. Howitt, T.H. Grayson, M.J. Morris, S.L. Sandow, T.V. Murphy, Dietary obesity increases NO and inhibits BKCa-mediated, endothelium-dependent dilation in rat cremaster muscle artery: association with caveolins and caveolae, Am. J. Physiol. Heart Circ. Physiol. 302 (2012) H2464–H2476. M.W. Pfaffl, G.W. Horgan, L. Dempfle, Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR, Nucleic Acids Res. 30 (2002), e36. X.R. Yang, M.J. Lin, L.S. McIntosh, J.S. Sham, Functional expression of transient receptor potential melastatin- and vanilloid-related channels in pulmonary arterial and aortic smooth muscle, Am. J. Phys. Lung Cell. Mol. Phys. 290 (2006) L1267–L1276. Y.X. Wang, J. Wang, C. Wang, J. Liu, L.P. Shi, M. Xu, Functional expression of transient receptor potential vanilloid-related channels in chronically hypoxic human pulmonary arterial smooth muscle cells, J. Membr. Biol. 223 (2008) 151–159. G.D. Smith, M.J. Gunthorpe, R.E. Kelsell, P.D. Hayes, P. Reilly, P. Facer, et al., TRPV3 is a temperature-sensitive vanilloid receptor-like protein, Nature 418 (2002) 186–190. W. Cheng, F. Yang, S. Liu, C.K. Colton, C. Wang, Y. Cui, et al., Heteromeric heatsensitive transient receptor potential channels exhibit distinct temperature and chemical response, J. Biol. Chem. 287 (2012) 7279–7288. D.J. Shi, S. Ye, X. Cao, R. Zhang, K. Wang, Crystal structure of the N-terminal ankyrin repeat domain of TRPV3 reveals unique conformation of finger 3 loop critical for channel function, Protein Cell 4 (2013) 942–950. K.W. Huynh, M.R. Cohen, S. Chakrapani, H.A. Holdaway, P.L. Stewart, V.Y. Moiseenkova-Bell, Structural insight into the assembly of TRPV channels, Structure 22 (2014) 260–268. W. Cheng, F. Yang, C.L. Takanishi, J. Zheng, Thermosensitive TRPV channel subunits coassemble into heteromeric channels with intermediate conductance and gating properties, J. Gen. Physiol. 129 (2007) 191–207. D.A. Brown, Lipid rafts, detergent-resistant membranes, and raft targeting signals, Physiology 21 (2006) 430–439. S. Bang, S. Yoo, T.J. Yang, H. Cho, S.W. Hwang, Isopentenyl pyrophosphate is a novel antinociceptive substance that inhibits TRPV3 and TRPA1 ion channels, Pain 152 (2011) 1156–1164. T. Yamada, T. Ueda, S. Ugawa, Y. Ishida, M. Imayasu, S. Koyama, et al., Functional expression of transient receptor potential vanilloid 3 (TRPV3) in corneal epithelial cells: involvement in thermosensation and wound healing, Exp. Eye Res. 90 (2010) 121–129. L. De Petrocellis, P. Orlando, A.S. Moriello, G. Aviello, C. Stott, A.A. Izzo, et al., Cannabinoid actions at TRPV channels: effects on TRPV3 and TRPV4 and their potential relevance to gastrointestinal inflammation, Acta. Physiol. (Oxford) 204 (2012) 255–266. A.K. Vogt-Eisele, K. Weber, M.A. Sherkheli, G. Vielhaber, J. Panten, G. Gisselmann, et al., Monoterpenoid agonists of TRPV3, Br. J. Pharmacol. 151 (2007) 530–540. J.M. Reilly, V. Telezhkin, G.M. Passmore, S.J. Marsh, D.A. Brown, Kv7/M-type potassium channels in rat skin keratinocytes, Pflugers Arch. 465 (2013) 1371–1381. O. Grubisha, A.J. Mogg, J.L. Sorge, L.J. Ball, H. Sanger, C.L. Ruble, et al., Pharmacological profiling of the TRPV3 channel in recombinant and native assays, Br. J. Pharmacol. 171 (2014) 2631–2644. X. Yao, TRPC, cGMP-dependent protein kinases and cytosolic Ca2+, Handb. Exp. Pharmacol. 527–40 (2007). J. Chen, R.F. Crossland, M.M. Noorani, S.P. Marrelli, Inhibition of TRPC1/TRPC3 by PKG contributes to NO-mediated vasorelaxation, Am. J. Physiol. Heart Circ. Physiol. 297 (2009) H417–H424. S. Takahashi, H. Lin, N. Geshi, Y. Mori, Y. Kawarabayashi, N. Takami, et al., Nitric oxide-cGMP-protein kinase G pathway negatively regulates vascular transient receptor potential channel TRPC6, J. Physiol. 586 (2008) 4209–4223. J. Wang, K. Yang, L. Xu, Y. Zhang, N. Lai, H. Jiang, et al., Sildenafil inhibits hypoxia induced TRPC expression in pulmonary arterial smooth muscle via cGMP-PKGPPARgamma Axis, Am. J. Respir. Cell Mol. Biol. 49 (2013) 231–240. J. Yin, J. Hoffmann, S.M. Kaestle, N. Neye, L. Wang, J. Baeurle, et al., Negative-feedback loop attenuates hydrostatic lung edema via a cGMP-dependent regulation of transient receptor potential vanilloid 4, Circ. Res. 102 (2008) 966–974. H. Takeda-Nakazawa, N. Harada, J. Shen, N. Kubo, H.P. Zenner, T. Yamashita, Hyposmotic stimulation-induced nitric oxide production in outer hair cells of the guinea pig cochlea, Hear. Res. 230 (2007) 93–104. C. Barron, M. Mandala, G. Osol, Effects of pregnancy, hypertension and nitric oxide inhibition on rat uterine artery myogenic reactivity, J. Vasc. Res. 47 (2010) 463–471. G. Osol, M. Cipolla, Interaction of myogenic and adrenergic mechanisms in isolated, pressurized uterine radial arteries from late-pregnant and nonpregnant rats, Am. J. Obstet. Gynecol. 168 (1993) 697–705. T. Yoshida, R. Inoue, T. Morii, N. Takahashi, S. Yamamoto, Y. Hara, et al., Nitric oxide activates TRP channels by cysteine S-nitrosylation, Nat. Chem. Biol. 2 (2006) 596–607. R. Inoue, J. Shi, Z. Jian, Y. Imai, Regulation of cardiovascular TRP channel functions along the NO-cGMP-PKG axis, Expert. Rev. Clin. Pharmacol. 3 (2010) 347–360. S.L. Sandow, C.B. Neylon, M.X. Chen, C.J. Garland, Spatial separation of endothelial small- and intermediate-conductance calcium-activated potassium channels (K(Ca)) and connexins: possible relationship to vasodilator function? J. Anat. 209 (2006) 689–698.

Please cite this article as: T.V. Murphy, et al., TRPV3 expression and vasodilator function in isolated uterine radial arteries from non-pregnant and pregnant rats, Vascul. Pharmacol. (2016), http://dx.doi.org/10.1016/j.vph.2016.04.004

12

T.V. Murphy et al. / Vascular Pharmacology xxx (2016) xxx–xxx

[43] S.L. Sandow, R.E. Haddock, C.E. Hill, P.S. Chadha, P.M. Kerr, D.G. Welsh, et al., What's where and why at a vascular myoendothelial microdomain signalling complex, Clin. Exp. Pharmacol. Physiol. 36 (2009) 67–76. [44] P.S. Chadha, L. Liu, M. Rikard-Bell, S. Senadheera, L. Howitt, R.L. Bertrand, et al., Endothelium-dependent vasodilation in human mesenteric artery is primarily mediated by myoendothelial gap junctions intermediate conductance calciumactivated K+ channel and nitric oxide, J. Pharmacol. Exp. Ther. 336 (2011) 701–708. [45] I. Eichler, J. Wibawa, I. Grgic, A. Knorr, S. Brakemeier, A.R. Pries, et al., Selective blockade of endothelial Ca2+-activated small- and intermediate-conductance K+-channels suppresses EDHF-mediated vasodilation, Br. J. Pharmacol. 138 (2003) 594–601. [46] A.J. McNeish, S.L. Sandow, C.B. Neylon, M.X. Chen, K.A. Dora, C.J. Garland, Evidence for involvement of both IKCa and SKCa channels in hyperpolarizing responses of the rat middle cerebral artery, Stroke 37 (2006) 1277–1282.

[47] M.F. Brereton, M. Wareing, R.L. Jones, S.L. Greenwood, Characterisation of K+ channels in human fetoplacental vascular smooth muscle cells, PLoS One 8 (2013), e57451. [48] A. Sankaranarayanan, G. Raman, C. Busch, T. Schultz, P.I. Zimin, J. Hoyer, et al., Naphtho[1,2-d]thiazol-2-ylamine (SKA-31), a new activator of KCa2 and KCa3.1 potassium channels, potentiates the endothelium-derived hyperpolarizing factor response and lowers blood pressure, Mol. Pharmacol. 75 (2009) 281–295. [49] S. Earley, Endothelium-dependent cerebral artery dilation mediated by transient receptor potential and Ca2+-activated K+ channels, J. Cardiovasc. Pharmacol. 57 (2011) 148–153. [50] S. Earley, T.J. Heppner, M.T. Nelson, J.E. Brayden, TRPV4 forms a novel Ca2+ signaling complex with ryanodine receptors and BKCa channels, Circ. Res. 97 (2005) 1270–1279.

Please cite this article as: T.V. Murphy, et al., TRPV3 expression and vasodilator function in isolated uterine radial arteries from non-pregnant and pregnant rats, Vascul. Pharmacol. (2016), http://dx.doi.org/10.1016/j.vph.2016.04.004