Trypsin of Litopenaeus vannamei is required for the generation of hemocyanin-derived peptides

Developmental and Comparative Immunology 79 (2018) 95e104

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Trypsin of Litopenaeus vannamei is required for the generation of hemocyanin-derived peptides Changping Li 1, Fan Wang 1, Jude Juventus Aweya, Defu Yao, Zhou Zheng, He Huang, Shengkang Li**, Yueling Zhang* Department of Biology, Guangdong Provincial Key Laboratory of Marine Biotechnology, Shantou University, Shantou 515063, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 16 July 2017 Received in revised form 22 October 2017 Accepted 23 October 2017 Available online 24 October 2017

Hemocyanin is a copper containing respiratory glycoprotein in arthropods and mollusks, which also have multiple functions in vivo. Recent studies have shown that hemocyanin could generate several peptides, which play important roles in shrimp innate immunity. However, how these hemocyanin-derived peptides are generated is still largely unknown. In this study, we report for the first time that the generation of hemocyanin-derived peptides was closely correlated with trypsin expression in shrimp hepatopancreas following infection with different bacteria. RNA interference (RNAi) mediated knockdown of trypsin or treatment with the serine protease inhibitor, aprotinin, resulted in significant decrease in the levels of hemocyanin-derived peptides. Moreover, recombinant trypsin (rTrypsin) was able to hydrolyse hemocynin in vitro with the hydrolysate having a high bacterial agglutination activity while the denatured hemocynin untreated with rTrypsin lost its agglutination activity. Taken together, our current results showed that the generation of hemocyanin-derived peptides correlates with an increase trypsin expression. © 2017 Elsevier Ltd. All rights reserved.

Keywords: Litopenaeus vannamei Hemocyanin Peptides Trypsin Agglutination

1. Introduction Shrimp aquaculture is an important component of modern agriculture, which has brought huge benefits to China. However, various pathogens have hampered the development of the shrimp aquaculture industry (Xiong et al., 2016). Shrimp lack adaptive immunity, with the innate immune system being the only line of defense against pathogenic bacteria and virus infection (Pope et al., 2011). Therefore, an increasing number of studies have focused on understanding the innate immune system of shrimp so as to improve the resistance of shrimps to pathogens and to efficiently culture (Shi et al., 2016). Hemocyanin, a copper containing respiratory protein in arthropods and mollusks, is also involved in a variety of immune functions such as phenoloxidase activity, antiviral, antimicrobial, hemolytic and antitumor activity (Coates and Nairn, 2014; Zlateva

* Corresponding author. Department of Biology, School of Science, Shantou University, Shantou, Guangdong, 515063, China. ** Corresponding author. Marine Biology Institute, Shantou University, Shantou, Guangdong, 515063, China. E-mail addresses: [email protected] (S. Li), [email protected] (Y. Zhang). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.dci.2017.10.015 0145-305X/© 2017 Elsevier Ltd. All rights reserved.

et al., 1996; Yan et al., 2011; Zhang et al., 2009, 2017; Zhao et al., 2016; Zhao et al., 2012; Zheng et al., 2016). Interestingly, hemocyanin is not just an important immune molecule, as it has recently been shown that hemocyanin-derived peptides were significantly upregulated with in vivo pathogen challenge (Coates and Decker, 2017), suggesting that these derived peptides have important immune functions. For instance, the hemocyanin C-terminus generated a new antibacterial peptide, astacidin1 in plasma, when Pacifastacus leniusculus was injected with Vibrio parahaemolyticus (Lee et al., 2003). Similarly, Destoumieux-Garzon and colleagues separated three kinds of antifungal peptides (PvHCt, PsHCt, PsHCt) from Penaeus vannamei and Penaeus stylirostris, which had simi
n larity with the C-terminus of hemocyanin (Destoumieux-Garzo et al., 2001). Qiu et al. idenitified two antimicrobial peptides (AMPs), FCHc-C1 and FCHcC2, from Fenneropenaeus chinensis heomcyanin (Qiu et al., 2014). More recently, our group identified a new 18.4 kDd hemocyanin derived peptide, HMCS4, from shrimp Litopenaeus vannamei injected with V. parahaemolyticus (Wen et al., 2016). From the foregoing, it thus seems to suggest that hemocyanin could generate various peptides in response to different pathogenic infection. Trypsin is a serine protease found in many organisms, and cleaves peptide chains mainly at the carboxyl side of the amino

96

C. Li et al. / Developmental and Comparative Immunology 79 (2018) 95e104

acids lysine or arginine (Kurth et al., 1998). As a protease, trypsin is reported to play essential roles in the immune system (Patel, 2017), with some recent studies indicating that this enzyme played diverse roles in invertebrate innate immunity (G€ ade and Goldsworthy, 2003). For example, hemocyanin phenoloxidase, which is one of important components of shrimp humoral immunity, was reported to be greatly enhanced via trypsin treatment (Kim et al., 2011). Similarly, trypsin purified from Steinernema carpocapsae could change host haemocytes, actin filaments and control haemolymph melanization (Balasubramanian et al., 2010). In the larval gut of Heliothis virescens, trypsin modulating ostatic factor (TMOF) is reported to control the biosynthesis of serine proteases (Nauen et al., 2001). Furthermore, people has suggest that some cysteine proteinase might be involved in the processing of the antibacterial peptides from hemocyanin (Lee et al., 2003). Intrigued by these revelations, we sought to determine the relationship between trypsin and hemocyanin in shrimps. We had also earlier on employed the use of bioinformatics tools and found 12 potential L. vannamei hemocyanin-derived antimicrobial peptides, ranging from 1.5 to 1.9 kDa, by the action of potential proteases, such as trypsin, chymotrypsin, and others (data unpublished). Our results here revealed that trypsin and hemocyanin were both upregulated in shrimp hepatopancreas following infection with some pathogens. Meanwhile, hemocyanin could be hydrolyzed by trypsin both in vitro and in vivo. The present study thus expands our knowledge on hemocyanin's role in shrimp innate immunity.

Table 1 Sequence of primers and siRNAs used in this paper. Prime Real-time qPCR Trypsin-F Trypsin-R HMCS-F HMCS-R EF-1ɑ-F EF-1ɑ-R Recombinant expression rTrypsin-F rTrypsin-R siRNA siTrypsin-F siTrypsin-R si-Non-F si-Non-R

Sequence (50 -30 ) ATCCTCTGTGTGCTCCTTGCTGG CATGGTAGGAGACCTCAGCGTA CCTGGCCTCATAAAGACAACA TTTTCCACCCTTCAAAGATACC TATGCTCCTTTTGGACGTTTTGC CCTTTTCTGCGGCCTTGGTAG CCGGAATTCATGAAGACCCTCATCCTCTGTG CCCAAGCTTTTAAACAGCATTGGCCTTAATC GAUUAAGGCCAAUGCUGUUTT AACAGCAUUGGCCUUAAUCTT UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT

cDNA and inserted into the vector pGEX6P-1 (Amersham). The recombinant plasmid was transformed into Escherichia coli BL21 (DE3). The overexpressed trypsin proteins with a glutathione Stransferase tag were purified by glutathione-sepharose 4B (GE Healthcare). After the removal of the glutathione S-transferase tag by PreScission protease (GE Healthcare) cleavage, the eluted untagged recombinant trypsin (rTrypsin) was used for subsequent experiments. 2.5. Preparation of antisera against rTrypsin

2. Materials and methods 2.1. Experimental animals Penaeid shrimps Litopenaeus vannamei (approximate weight of 5 g) were purchased from a local farm, Shantou Huaxun Aquatic Product Corporation (Shantou, Guangdong, China). Shrimps were immediately transferred to tanks with aerated seawater at room temperature, and acclimatized for at least 2 days before experiments. All animal experiments were carried out in accordance with the guidelines and approval of the Animal Research and Ethics Committees at Shantou University.

To prepare antisera against trypsin, the eluted untagged recombinant trypsin (rTrypsin) produced, was concentrated to 1 mg/ ml with an ultracentrifuge filter. Equal volumes of rTrypsin (0.5 ml) and complete Freund's adjuvant (Sigma-Aldrich, USA) were mixed thoroughly and 0.1 ml each injected into 5 Kunming mice. The injection was repeated 7 days later replacing complete Freund's adjuvant with incomplete Freund's adjuvant. Mice were bleed periodically and tested for anti-rTrypsin titer and specificity. The collected anti-rTrypsin antiserum was stored at 80
C for further use. 2.6. Challenge of shrimps and extraction of proteins

2.2. Total RNA extraction and cDNA synthesis Total RNA was extracted from various shrimp tissues (gills, heart, hemocytes, hepatopancreas, intestine, muscle and stomach) using the RNAFAST 200 Kit (FeiJie, China). The cDNA samples were prepared using the PrimeScript™ RT reagent Kit (TaKaRa, Japan). 2.3. Tissue distribution of hemocyanin and trypsin The tissue distribution of hemocyanin and trypsin was detected using real-time qPCR with gene specific primers (Table 1). The hemocyanin and trypsin specific primers were designed according to the hemocyanin small subunit sequence (GenBank: X82502.1) and trypsin sequence (GenBank: X86369.1). The real-time qPCR program used was set at the following conditions: 95
C for 10 min; 40 cycles of 95
C for 15 s; 60
C for 20 s; a melting curve analysis from 72
C to 95
C. The qPCR data were analyzed using the 2DDCT method (Zhao et al., 2013) with the Lv-EF-1ɑ gene as the internal control. 2.4. Cloning, expression and purification of recombinant trypsin The gene coding for trypsin was amplified, using primers rTrypsin-F and rTrypsin-R (Table 1), from shrimp hepatopancreas

For bacteria challenge experiments, each shrimp was injected via the third and forth segment of the muscle with 0.5  106 CFU/g of V. parahaemolyticus and Staphylococcus aureus, and then hemolymph and hepatopancreas were extracted at different time points (0, 2, 6, 12, 24 h) as previously described (Lu et al., 2015). The hemolymph was centrifuged at 800 g for 15 min at 4
C to sediment the hemocytes. For the proteins from hepatopancreas, extracted hepatopancreas (5 shrimp) were homogenized, centrifuged at 500 g for 10 min to pellet the cells, washed thoroughly with PBS (0.01 M, pH 7.4), lysed with lysis buffer (Beyotime, China) plus protease inhibitor PMSF for 30 min and then centrifuged at 20000 g for 15 min to collect the supernatant. The concentration of the hemolymph and hepatopancreas proteins were determined by a modified Bradford assay (Bio-Rad, USA) using BSA as standard, and used immediately for the next experiment or stored at 20
C for later use. 2.7. SDS-PAGE and Western blot All the extracted proteins were separated on SDS-PAGE and transferred onto a polyvinylidene fluoride (PVDF) membrane. The PVDF membrane were blocked with 5% skimmed milk dissolved in TBST (20 mM Tris, 150 mM NaCl, 0.1% Tween 20, pH 7.6) for 2 h at

C. Li et al. / Developmental and Comparative Immunology 79 (2018) 95e104

room temperature, followed by incubation with mouse anti-trypsin antisera (1:5000, generated in-house), rabbit anti-hemocyanin antisera (1:5000, Zhao et al., 2012) or anti-tubulin antibody (1:1000, Sigma-Aldrich, USA), at room temperature for 2 h and then washed 3 times (15 min) with TBST. Next, membranes were incubated with HRP-linked goat anti-mouse or goat anti-rabbit secondary antibodies (1:10000 or 1:2000, Sigma-Aldrich, USA) for 1 h at room temperature. Blots were detected with enhanced chemiluminescence substrates (Thermo Scientific) and developed using X-ray film (Kodak, USA). 2.8. RNA interference Target-specific trypsin siRNA (siTrypsin) and scrambled control siRNA (siNon) were designed and synthesized by GenePharma (Suzhou, China). The siRNA sequences are listed in Table 1. The experiment groups were intramuscularly injected with 5 mg siRNA per shrimp, while the control groups were injected with equivalent amount of scrambled siRNA. At 72 h post-siRNA injection, hemolymph and hepatopancreas from each group (5 shrimps each) were collected as previously described (Wang and Zhu, 2016) to determine the expression of the hemocyanin-derived peptides and trypsin. 2.9. Hemocyanin hydrolysis Hemocyanin was purified with Sephadex G-100 as previously described (Takagi and Nemoto, 1980), followed by denaturation of the hemocyanin in boiling water for 5 min. Hydrolysis of the denatured hemocyanin was carried out at room temperature with rTrypsin for 2 h in a buffer solution (20 mM Tris, 0.1 mM CaCl2, pH 8.0) (Cheison et al., 2011). The hydrolysis process was stopped by adding 5X SDS-PAGE loading buffer followed by heating in boiling water for 10 min. The samples were aliquoted and stored at 20
C for further analysis. 2.10. Agglutination assays Agglutination assay was performed as previously described (Wen et al., 2016). Briefly, V. parahaemolyticus was cultured overnight in broth medium at 37
C, and diluted to 107 CFU/ml in TBSCa2þ buffer (0.05 M Tris-HCl, 0.75% NaCl, 0.05 M CaCl2). The agglutination of bacteria by the denatured hemocyanin hydrolysate, rTrypsin or denatured hemocyanin was carried out at 37
C for 30 min. Each V. parahaemolyticus suspension (20 ml) was mixed with an equal volume of samples (i.e., denatured hemocyanin hydrolysate, rTrypsin and denatured hemocyanin), which were diluted 2-fold in TBS-Ca2þ buffer. Agglutination was observed and recorded using a light microscope and compared to a control bacterium in TBS-Ca2þ buffer. The agglutinative titer was defined as the highest dilution of the test sample. 3. Results 3.1. Tissue distribution of hemocyanin and trypsin Previous studies have shown that both trypsin and hemocyanin were involved in invertebrate immunity (Coates and Nairn, 2014; €de and Goldsworthy, 2003). Here, the expression of hemocyaGa nin and trypsin in different shrimp tissues was examined using qPCR. The results showed that trypsin was mainly expressed in hemocytes, stomach, hepatopancreas and gills, while hemocyanin was primarily expressed in hepatopancreas and stomach (Fig. 1). Both of these two proteins were highly expressed in the hepatopancreas and less expressed in the heart.

97

3.2. Hemocyanin-derived peptides generation increases with trypsin expression in shrimp hepatopancreas upon infection with different bacteria Next, we wanted to know whether or not there was any correlation between the level of trypsin and hemocyanin-derived peptides in shrimp immune response. To test this, two types of bacteria, V. parahaemolyticus and S. aureus, were injected into shrimps and the levels of hemocyanin-derived peptides and trypsin in the hepatopancreas were detected using Western blot analysis. It was observed that shrimps challenged with 0.5  106 CFU/g of V. parahaemolyticus had high expression of trypsin within 2 h.p.i., with the highest expression observed at 6 h.p.i. (Fig. 2A). On the other hand, shrimps challenged with 0.5  106 CFU/g of S. aureus had high expression of trypsin at 12 h.p.i. (Fig. 2B). Interestingly, there was a corresponding expression of hemocyanin-derived peptides at 6 h.p.i. with V. parahaemolyticus infection and at 12 h.p.i. with S. aureus infection (Fig. 2). While both bacteria challenge resulted in the generation of hemocyanin-derived peptides, the banding pattern of the degradation products were slightly different, with the peptide bands after V. parahaemolyticus injection occurring between 75 and 25 kDa (designated I to VII in Fig. 2A), while those after S. aureus injection were between 75 and 17 kDa (designated i to x in Fig. 2B). Despite the slight difference in banding patterns, these results suggest that the level of hemocyaninderived peptides generated increases with trypsin expression in shrimp hepatopancreas following different pathogen challenge. 3.3. Hemocyanin-derived peptides production requires trypsin Our previous results suggest that in vivo breakdown of hemocyanin might require trypsin (Fig. 2). To explore this, target specific siRNA against trypsin (siTrypsin) (5 mg/shrimp) and the serine protease inhibitor, aprotinin (20 mg/shrimp) were injected into shrimps. The level of hemocyanin-derived peptides in hepatopancres was determined using Western blot analysis at 72 h post siRNA injection, or at 0, 2, 6, 12, 24 h post aprotinin injection. While it was observed that both siTrypsin and aprotinin treatment greatly reduced the level of hemocyanin-derived peptides (Fig. 3A and B), it was interesting to see that the number of bands, mainly found between 63 and 35 kDa, was different between the two treatments, i.e., six bands (marked A - F in Fig. 3A) and four bands (marked a d in Fig. 3B), respectively, which was different compared with what was observed in Fig. 2. Of special note is one major hemocyaninderived peptide band (~35 kDa), which was observed to significantly decrease upon siRNA-mediated knockdown of trypsin or with serine protease inhibitor treatment (Fig. 3). 3.4. Recombinant trypsin (rTrypsin) can digest hemocyanin in vitro To further validate whether trypsin could generate hemocyaninderived peptides, the shrimp trypsin gene was cloned into the pGEX6p-1 vector and expressed in E. coli (K12). The GST-tagged recombinant trypsin (rTrypsin) was purified with glutathione beads. The purity of rTrypsin was checked with SDS-PAGE (Fig. 4A). Given that hemocyanin normally exists as polymers (Coates and Nairn, 2014), native hemocyanin is resistant to in vitro trypsin digestion (Data not shown), thus the hemocyanin was boiled prior to trypsin digestion. Thus, 2 mg denatured hemocyanin and 0.02 mg rTrypsin were mixed and incubated at room temperature for 2 h. As shown in Fig. 4B, denatured hemocyanin was digested by the rTrypsin, generating about 9 peptides (p1-9) with sizes ranging between 25 and 75 kDa, of which six bands, viz. p1, p3, p4, p6, p7 and p9, could specifically bind with hemocyanin antibody. Notably, four bands, designated with Roman numerals in Fig. 2 (i.e., v/V, vii/

98

C. Li et al. / Developmental and Comparative Immunology 79 (2018) 95e104

Fig. 1. Tissue distribution of hemocyanin and trypsin in L. vannamei. Relative expression of Hemocyanin (A) and Trypsin (B) in different tissues were analyzed by real-time qPCR.

C. Li et al. / Developmental and Comparative Immunology 79 (2018) 95e104

99

Fig. 2. Western blot analysis of hemocyanin-derived peptides and trypsin induced by different pathogens. Hemocyanin-derived peptides and trypsin expression at different timepoints (0, 2, 6, 12 and 24 h) post-injection with V. parahaemolyticus (A) and S. aureus (B). Roman numerals indicate the positions of hemocyanin-derived peptides on the immunoblots.

100

C. Li et al. / Developmental and Comparative Immunology 79 (2018) 95e104

Fig. 3. Western blot analysis of hemocyanin-derived peptides after siTrypsin and serine protease inhibitor (aprotinin) injection. (A) Hemocyanin-derived peptides and trypsin expression in shrimp hepatopancreas at 72 h post siNon (lane 1) and siTrypsin (lane 2) injection. (B) Hemocyanin-derived peptides expression in shrimp hepatopancreas at different time points (0, 2, 6, 12 and 24 h) post serine protease inhibitor (aprotinin) injection. Upper and lower case alphabets indicate the positions of hemocyanin-derived peptides on the immunoblots.

VII, viii/VIII, and ix/IX), were the major in vivo hemocyanin-derived peptides.

3.5. Hemocyanin-derived peptides generated by rTrypsin in vitro possess bacterial agglutination activity To further explore the functions of the hemocyanin-derived

peptides, V. parahaemolyticus was incubated with hemocyanin hydrolysate for 30 min at 37
C. The results showed that while the denatured hemocyanin lost its agglutination acitivity, the denatured hemocyanin hydrolysate produced by treating with rTrypsin had a high agglutination activity (Table 2, Fig. 5).

C. Li et al. / Developmental and Comparative Immunology 79 (2018) 95e104

101

Fig. 4. Digestion of hemocyanin by trypsin in vitro and Western blot analysis. (A) Purification of recombinant trypsin (rTrypsin) from E. coli. Lane M, protein marker; Lane 1, rTrypsin before induction of E.coli with IPTG; Lane 2, rTrypsin after induction of E. coli with IPTG; Lane 3, GST-trypsin purified from E. coli BL21 lysates; Lane 4, purified rTrypsin from GSTtrypsin after PreScission proteases excision. (B) SDS-PAGE (left) and Western blot (right) analysis of in vitro rTrypsin digested hemocyanin. Lane M, protein marker; Lane 1, molecular sieve purified hemocyanin; Lane 2, rTrypsin; Lane 3, rTrypsin digested hemocyanin; Lane 4 and Lane 5, hemocyanin and rTrypsin digested hemocyanin analyzed by Western blot.

4. Discussion The shrimp aquaculture industry has suffered from various diseases in recent years, resulting in huge economic losses. Although shrimps do not have an adaptive immune system, as aquatic organisms, they are inundated with numerous pathogens compared with terrestrial organisms (Pope et al., 2011). In order to better understand and improve the resistance of shrimps to the numerous pathogens, a lot of efforts have been put into shrimp immunology research (Li and Xiang, 2013). As the most abundant

Table 2 Agglutinative activities V. parahaemolyticus.

of

rTrypsin

hydrolyzed

hemocyanin

against

rTrypsin (mg/mL)

Hemocyanin (mg/mL)

Agglutinative efficiency

Agglutinative activity (mg/mL)

0 20 20

50 0 50

0 0 8

e e 6.25

102

C. Li et al. / Developmental and Comparative Immunology 79 (2018) 95e104

Fig. 5. Photomicrographs of the agglutinative activity of rTrypsin hydrolyzed hemocyanin against V. parahaemolyticus (400X).

protein in shrimp plasma, hemocyanin was originally identified as an oxygen carrier protein, but later its immunological functions were identified (Coates and Nairn, 2014; Yan et al., 2011; Zhang et al., 2009; Zhang et al., 2017; Zhao et al., 2012, 2016; Zheng et al., 2016). More recently, we found that following infection with different pathogens, hemocyanin could generate different short peptides, which seem to play some roles in pathogen specific
n et al., immune responses (Choi and Lee, 2014; Destoumieux-Garzo 2001; Lee et al., 2003; Qiu et al., 2014; Wen et al., 2016). Intrigued by these phenomena, further experiments were performed so as to delineate the enzyme(s), which might be responsible for the in vivo generation of these hemocyanin-derived short peptides. In this study, trypsin was identified as the key protease responsible for the in vivo and in vitro cleavage of hemocyanin to generate the short peptides upon pathogen challenge. Our current results have unraveled some previously unknown humoral immune response in shrimp (Tassanakajon et al., 2017), which might be conserved in other higher organisms. Trypsin is an evolutionary conserved protease which plays multiple functions in invertebrates (G€ ade and Goldsworthy, 2003). Consisted with previous studies, trypsin was also shown to be induced by various pathogens in recent studies (Chen et al., 2016; Clark et al., 2013). Interestingly, we observed here that both trypsin expression and hemocyanin-derived peptides generation were affected by the type of pathogens (Fig. 2), with the immune responses against V. parahaemolyticus occurring earlier than S. aureus at the same dosage, suggesting that these two strains of bacteria might have different virulence. Moreover, the banding pattern of the hemocyanin degradation products between V. parahaemolyticus and S. aureus were slightly different, which seems to suggest that the two bacteria elicit different immune responses in shrimp. This observation is similar to some previous

studies which have reported that different variants of immune molecules including hemocyanin (Zhao et al., 2016), grass carp PGRP6 (Yu et al., 2014), 185/333 (Terwilliger et al., 2007) and Carcinolectin 5 (Zhu et al., 2007) were expressed differently in response to different microbial ligands stimulation. In any case, despite the difference in banding pattern as well as the time-lapse in response to the two bacteria, the appearance of hemocyaninderived peptides corresponded with the highest expression of trypsin in the hepatopancreas (Fig. 2). While a number of proteases including chymotrypsin (Cao et al., 2014) and other proteases (Maningas et al., 2013) occur in shrimp hepatopancreas, our results suggest that probably trypsin or a trypsin-like protease might be an important molecule in shrimp humoral immunity and thus play a key role in the immune response. To further substantiate our observation, we employed siRNAmediated knockdown of trypsin as well as used a serine protease inhibitor to block the protease activity of trypsin (Fig. 3). It was observed that compared with the siTrypsin treatment, the serine protease inhibitor was more effective in reducing the level of hemocyanin-derived peptides generated, which could be due to the fact that aprotinin is a general serine protease inhibitor, and therefore inhibited most, if not all, serine proteases including trypsin, chymotrypsin and other serine proteases (Liu et al., 2017). Curiously, we also observed that the banding pattern of the hemocyanin degradation products between the bacteria challenge (Fig. 2) and inhibitor or siTrypsin treatment (Fig. 3) were slightly different, with the former having more bands than the latter. While at this stage we can not exclude the possible involvement of other proteases, both bacterial and shrimp, it is conceivable to speculate that the pan-activity of the inhibitor and probably some off-target effects of the siRNA used could account for the different banding patterns. Although the exact reason(s) for this observation is yet to

C. Li et al. / Developmental and Comparative Immunology 79 (2018) 95e104

be determined, this study provides strong evidence for the first time, implicating trypsin or a trypsin-like protease in the generation of hemocyanin-derived peptides. Next, we went about to determined if hemocyanin was a substrate of trypsin, in in vitro experiments whereby purified hemocyanin was treated with rTrypsin. Interestingly, it was observed that indeed hemocyanin-derived peptides were generated in vitro (Fig. 4). More importantly, we observed that there were more hemocyanin degradation products (number of bands) generated in vitro than that generated in vivo (Fig. 3). This was an interesting observation and strongly supports the involvement of trypsin in the generation of these peptides, since the conditions under which degradation of hemocyanin occurred in vivo and in vitro differ. It thus seems to suggest that probably some other factors or serine protease inhibitors present in vivo may have an impact on the activity of trypsin (Liu et al., 2014; Somprasong et al., 2006), hence, the observed disparity in the number of hemocyanin degradation products. Moreover, hemocyanin lost its bacterial agglutinative activity when heat denatured, implying that the agglutinative activity of hemocyanin required its native protein structure. Meanwhile, hemocyanin-derived peptides from trypsin digestion possessed agglutinative activity, which was consistent with our previous studies (Wen et al., 2016). For a long time, the view had always been that the innate immune system of invertebrates was nonspecific compared with the adaptive immune system (Amparyup et al., 2013). However, accumulating research data seems to suggest that innate immunity €derha €ll, 2004; might also have some specificity (Cerenius and So Lemaitre and Hoffmann, 2007). Here, our data supports the latter premise, as we have shown that shrimps could mount different immune response against various pathogens. More importantly, we observed that different hemocyanin-derived peptides were generated in response to different and diverse pathogen challenge (unpublished date). While these findings are interesting and thought provoking, future studies will try to explore how these diverse hemocyanin-derived peptides are generated in vivo. Acknowledgements This work was sponsored by National Natural Science Foundation of China (Nos. 31372558 & 31672689), Natural Science Foundation of Guangdong Province (No. S2013010015190 & 2017A030311032) and The National Key Growth Project of Guangdong Province College (No. 2014GKXM043). References Amparyup, P., Charoensapsri, W., Tassanakajon, A., 2013. Prophenoloxidase system and its role in shrimp immune responses against major pathogens. Fish. Shellfish Immunol. 34, 990e1001. Balasubramanian, N., Toubarro, D., Simoes, N., 2010. Biochemical study and in vitro insect immune suppression by a trypsin-like secreted protease from the nematode Steinernema carpocapsae. Parasite Immunol. 32, 165e175. Cao, J., Wang, Z., Zhang, Y., Qu, F., Guo, L., Zhong, M., Li, S., Zou, H., Chen, J., Wang, X., 2014. Identification and characterization of the related immune -enhancing proteins in crab Scylla paramamosain stimulated with rhubarb polysaccharides. Mol. Immunol. 57, 263e273. € derh€ Cerenius, L., So all, K., 2004. The prophenoloxidase-activating system in invertebrates. Immunol. Rev. 198, 116e126. Cheison, S.C., Brand, J., Leeb, E., Kulozik, U., 2011. Analysis of the effect of temperature changes combined with different alkaline pH on the b-lactoglobulin trypsin hydrolysis pattern using MALDI-TOF-MS/MS. J. Agric. Food Chem. 59, 1572e1581. Chen, L.H., Lin, S.W., Liu, K.F., Chang, C.I., Hseu, J.R., Tsai, J.M., 2016. Comparative proteomic analysis of Litopenaeus vannamei gills after vaccination with two WSSV structural proteins. Fish. Shellfish Immunol. 49, 306e314. Choi, H., Lee, D.G., 2014. Antifungal activity and pore-forming mechanism of astacidin 1 against Candida albicans. Biochimie 105, 58e63. Clark, K.F., Acorn, A.R., Greenwood, S.J., 2013. Differential expression of American lobster (Homarus americanus) immune related genes during infection of

103

Aerococcus viridans var. homari, the causative agent of Gaffkemia. J. Invertebr. Pathol. 112, 192e202. Coates, C.J., Decker, H., 2017. Immunological properties of oxygen-transport proteins: hemoglobin, hemocyanin and hemerythrin. Cell. Mol. Life Sci. 74, 293e317. Coates, C.J., Nairn, J., 2014. Diverse immune functions of hemocyanins. Dev. Comp. Immunol. 45, 43e55.
n, D., Saulnier, D., Garnier, J., Jouffrey, C., Bulet, P., Bache re, E., Destoumieux-Garzo 2001. Crustacean immunity antifungal peptides are generated from the C terminus of shrimp hemocyanin in response to microbial challenge. J. Biol. Chem. 276, 47070e47077. €de, G., Goldsworthy, G.J., 2003. Insect peptide hormones: a selective review of Ga their physiology and potential application for pest control. Pest Manag. Sci. 59, 1063e1075. Kim, S.G., Jung, B.W., Kim, H., 2011. Hemocyanin-derived phenoloxidase activity with broad temperature stability extending into the cold environment in hemocytes of the hair crab Erimacrus isenbeckii. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 159, 103e108. Kurth, T., Grahn, S., Thormann, M., Ullmann, D., Hofmann, H.J., Jakubke, H.D., Hedstrom, L., 1998. Engineering the S1 ‘Subsite of Trypsin: design of a protease which cleaves between dibasic residues. Biochemistry 37, 11434e11440. € derh€ Lee, S.Y., Lee, B.L., So all, K., 2003. Processing of an antibacterial peptide from hemocyanin of the freshwater crayfish Pacifastacus leniusculus. J. Biol. Chem. 278, 7927e7933. Lemaitre, B., Hoffmann, J., 2007. The host defense of Drosophila melanogaster. Annu. Rev. Immunol. 25, 697e743. Li, F., Xiang, J., 2013. Signaling pathways regulating innate immune responses in shrimp. Fish. Shellfish Immunol. 34, 973e980. Liu, X., Kopparapu, N.k., Li, Y., Deng, Y., Zheng, X., 2017. Biochemical characterization of a novel fibrinolytic enzyme from Cordyceps militaris. Int. J. Biol. Macromol. 94, 793e801. Liu, Y., Hou, F., He, S., Qian, Z., Wang, X., Mao, A., Sun, C., Liu, X., 2014. Identification, characterization and functional analysis of a serine protease inhibitor (Lvserpin) from the Pacific white shrimp, Litopenaeus vannamei. Dev. Comp. Immunol. 43, 35e46. Lu, X., Lu, H., Guo, L., Zhang, Z., Zhao, X., Zhong, M., Li, S., Zhang, Y., 2015. Cloning and characterization of a novel hemocyanin variant LvHMCV4 from shrimp Litopenaeus vannamei. Fish. Shellfish Immunol. 46, 398e405. Maningas, M.B.B., Kondo, H., Hirono, I., 2013. Molecular mechanisms of the shrimp clotting system. Fish. Shellfish Immunol. 34, 968e972. Nauen, R., Sorge, D., Sterner, A., Borovsky, D., 2001. TMOF-like factor controls the biosynthesis of serine proteases in the larval gut of Heliothis virescens. Arch. Insect Biochem. Physiol. 47, 169e180. Patel, S., 2017. A critical review on serine protease: key immune manipulator and pathology mediator. Allergol. Immunopathol. (Madr). https://doi.org/10.1016/ j.aller. 2016. 10.011. Pope, E.C., Powell, A., Roberts, E.C., Shields, R.J., Wardle, R., Rowley, A.F., 2011. Enhanced cellular immunity in shrimp (Litopenaeus vannamei) after ‘vaccination’. PLoS One 6, e20960. Qiu, C., Sun, J., Liu, M., Wang, B., Jiang, K., Sun, S., Meng, X., Luo, Z., Wang, L., 2014. Molecular cloning of hemocyanin cDNA from Fenneropenaeus chinensis and antimicrobial analysis of two C-terminal fragments. Mar. Biotechnol. 16, 46e53. Shi, X.Z., Feng, X.W., Sun, J.J., Yang, M.C., Lan, J.F., Zhao, X.F., Wang, J.X., 2016. Involvement of a LysM and putative peptidoglycan-binding domain-containing protein in the antibacterial immune response of kuruma shrimp Marsupenaeus japonicus. Fish. Shellfish Immunol. 54, 489e498. Somprasong, N., Rimphanitchayakit, V., Tassanakajon, A., 2006. A five-domain Kazal-type serine proteinase inhibitor from black tiger shrimp Penaeus monodon and its inhibitory activities. Dev. Comp. Immunol. 30, 998e1008. Takagi, T., Nemoto, T., 1980. Tachypleus tridentatus hemocyanin separation and characterization of monomer subunits and studies on sulfhydryl groups. J. Biochem. 87, 1785e1793. Tassanakajon, A., Rimphanitchayakit, V., Visetnan, S., Amparyup, P., Somboonwiwat, K., Charoensapsri, W., Tang, S., 2017. Shrimp humoral responses against pathogens: antimicrobial peptides and melanization. Dev. Comp. Immunol. https://doi.org/10.1016/j.dci.2017.05.009. Terwilliger, D.P., Buckley, K.M., Brockton, V., Ritter, N.J., Smith, L.C., 2007. Distinctive expression patterns of 185/333 genes in the purple sea urchin, Strongylocentrotus purpuratus: an unexpectedly diverse family of transcripts in response to LPS, beta-1,3-glucan, and dsRNA. BMC Mol. Biol. 8, 1e16. Wang, Z., Zhu, F., 2016. Minichromosome maintenance protein 7 regulates phagocytosis in kuruma shrimp Marsupenaeus japonicas against white spot syndrome virus. Fish. Shellfish Immunol. 55, 293e303. Wen, Y., Zhan, S., Huang, H., Zhong, M., Chen, J., You, C., Wang, F., Zhang, Y., 2016. Identification and characterization of an 18.4 kDa antimicrobial truncation from shrimp Litopenaeus vannamei hemocyanin upon Vibrio parahaemolyticus infection. Fish. Shellfish Immunol. 56, 450e458. Xiong, J., Dai, W., Li, C., 2016. Advances, challenges, and directions in shrimp disease control: the guidelines from an ecological perspective. Appl. Microbiol. Biotechnol. 100, 6947e6954. Yan, F., Zhang, Y., Jiang, R., Zhong, M., Hu, Z., Du, H., Lun, J., Chen, J., Li, Y., 2011. Identification and agglutination properties of hemocyanin from the mud crab (Scylla serrata). Fish. Shellfish Immunol. 30, 354e360. Yu, Z.L., Li, J.H., Xue, N.N., Nie, P., Chang, M.X., 2014. Expression and functional characterization of PGRP6 splice variants in grass carp Ctenopharyngodon idella.

104

C. Li et al. / Developmental and Comparative Immunology 79 (2018) 95e104

Dev. Comp. Immunol. 47, 264e274. Zhang, Y.L., Fang, Y., Zhong, H., Zhao, X.L., Min, S.Y., Du, Z.H., Shan, Z., Ye, X.Q., Li, Y.Y., 2009. Hemocyanin from shrimp Litopenaeus vannamei shows hemolytic activity. Fish. Shellfish Immunol. 27, 330e335. Zhang, Y.L., Peng, B., Li, H., Yan, F., Wu, H.K., Zhao, X.L., Lin, X.M., Min, S.Y., Gao, Y.Y., Wang, S.Y., 2017. C-terminal domain of hemocyanin, a major antimicrobial protein from Litopenaeus vannamei: structural homology with immunoglobulins and molecular diversity. Front. Immunol. 8, 611. Zhao, S., Lu, X., Zhang, Y., Zhao, X., Zhong, M., Li, S., Lun, J., 2013. Identification of a novel alternative splicing variant of hemocyanin from shrimp Litopenaeus vannamei. Immunol. Lett. 154, 1e6. Zhao, X., Guo, L., Lu, X., Lu, H., Wang, F., Zhong, M., Chen, J., Zhang, Y., 2016. Evidences of abundant hemocyanin variants in shrimp Litopenaeus vannamei. Mol.

Immunol. 77, 103e112. Zhao, X., Guo, L., Zhang, Y., Liu, Y., Zhang, X., Lun, J., Chen, J., Li, Y., 2012. SNPs of hemocyanin C-terminal fragment in shrimp Litopenaeus vannamei. FEBS Lett. 586, 403e410. Zheng, L., Zhao, X., Zhang, P., Chen, C., Liu, S., Huang, R., Zhong, M., Wei, C., Zhang, Y., 2016. Hemocyanin from shrimp Litopenaeus vannamei has antiproliferative effect against HeLa cell in vitro. PLoS One 11, e0151801. Zhu, Y., Ng, P., Wang, L., Ho, B., Ling Ding, J., 2007. Diversity in lectins enables immune recognition and differentiation of wide spectrum of pathogens. Int. Immunol. 18, 1671e1680. Zlateva, T., Di, M.P., Salvato, B., Beltramini, M., 1996. The o-diphenol oxidase activity of arthropod hemocyanin. FEBS Lett. 384, 251e254.