- Email: [email protected]
Tubular Morphogenesis and Mesenchymal Interactions Affect Renin Expression and Secretion in SIMS Mouse Submandibular Cells
Experimental Cell Research 248, 172–185 (1999) Article ID excr.1999.4404, available online at http://www.idealibrary.com on
Tubular Morphogenesis and Mesenchymal Interactions Affect Renin Expression and Secretion in SIMS Mouse Submandibular Cells Brı´d M. Laoide, 1 Isabelle Gastinne, and Franc¸ois Rougeon Unite´ de Ge´ne´tique et Biochimie du De´veloppement, URA CNRS 1960, Institut Pasteur, 25, rue du Dr. Roux, 75724 Paris Ce´dex 15, France
We have previously immortalized a mouse submandibular gland (SMG) ductal epithelial cell line, SIMS, from pubertal male mice transgenic for the SV40 large T antigen under the control of the adenovirus 5 E1A promoter. Here we demonstrate the role of the extracellular environment in directing not only the morphogenetic behavior of the cells, but also their functional differentiation in terms of renin expression and secretion. First, we measured renin activity of polarized SIMS cells. Low levels of renin are secreted from both the apical and the basolateral domains; the mechanism appears to be direct as no renin was found to be transcytosed across the cell. Second, we studied homotypic and heterotypic mesenchymal cell interactions with SIMS cells. We found that epithelial–mesenchymal coculture in collagen I gels results in branching tubular morphogenesis of SIMS cells and that significant amounts of renin are secreted, probably into the lumen, as the precursor form, prorenin. Third, we investigated the effects of the basement membrane on SIMS cell morphology and function and found that this structure alone is sufficient to allow expression and secretion of both prorenin and active renin. Finally, we established that SIMS cells can express androgen-regulated genes in a transient transfection assay. In addition, in Matrigel cultures androgen receptor expression appears to be induced, suggesting that the SIMS cell line will be useful for further studies on the molecular basis of the observed high-level expression of SMG-specific genes in male mice. © 1999 Academic Press
Key Words: immortalized cells; differentiation; extracellular matrix; collagen; androgens.
INTRODUCTION
Developmental interactions between the mesenchyme and the epithelium induce both the morphogenesis and the cytodifferentiation of the mouse subman1 To whom correspondence and reprint requests should be addressed. Fax: 1 33 1 40 61 34 40. E-mail: [email protected].
0014-4827/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.
dibular gland [1–3]. Branching occurs following a mesenchymal stimulus which results in cleft formation and the subdivision of the epithelial rudiment into a branched epithelial tree [4, 5]. Submandibular morphogenesis is supported by a small number of heterotypic mesenchyme [6] and, conversely, submandibular gland (SMG) 2 mesenchyme can influence branching of mammary [7] and lung [8] epithelia. Mesenchyme, however, despite its crucial role in branching, appears to have a lesser role in the terminal cytodifferentiation of epithelial cells. In fact, the two processes can be partially uncoupled, although early branching of the epithelial rudiment appears to be a requisite for mesenchyme-independent cytodifferentiation [9, 10]. Takahashi and Nogawa [11] demonstrated by transfilter experiments that, in the absence of direct mesenchymal– epithelial interactions, branching morphogenesis of E13 day mouse glands does not occur unless an appropriate extracellular environment is provided. Proteoglycans, in particular, chondroitin sulfate, play a vital role in the regulation of SMG morphogenesis but do not appear to be required for secretory cell differentiation. In contrast, type IV collagen and laminin appear to be important for both processes, and indeed type IV collagen appears to couple the processes of branching and cytodifferentiation [12, 13]. In vitro studies of tubular morphogenesis have been hampered by the lack of characterized cell lines. Many of the major observations have come from studies using an adult dog kidney cell line, MDCK [14, 15]. However, in contrast to the SMG, during kidney development polarized epithelia arise from the conversion of mesenchymal cells surrounding the uteric bud by inductive cell– cell interactions. We, therefore, decided to take advantage of our well-characterized mouse SMG ductal epithelial cell line, SIMS, to analyze the process of tubulogenesis in this system and, in addition, to study 2 Abbreviations used: SMG, submandibular gland; GCT, granular convoluted tubule; E-C-L, entactin– collagen–laminin, EHS, Engleberth–Holm–Swarm mouse tumor matrix; HDM, hormonally defined medium; TLC, thin liquid chromatography.
172
TUBULOGENESIS AND RENIN EXPRESSION IN SIMS CELLS
the effects of such an architecture on gene specific expression and secretion. The SIMS line used in this study is derived from 21-day-old male littermates transgenic for the SV40 T antigen under the control of the early expressed E1A promoter of adenovirus 5 [16]. The 21-day gland is still immature in terms of cytodifferentiation and is responsive to hormonal influences. The gland shows a striking sexual dimorphism and the male mouse has a highly developed specialized ductal segment, the granular convoluted tube (GCT), which develops postnatally, under both thyroid and androgen hormonal control [17, 18]. GCT cells synthesize and secrete a number of biologically important peptides, including NGF, EGF, and renin [19]. Here we demonstrate that the morphogenetic behavior of SMG-derived SIMS ductal epithelial cells is influenced both by its extracellular environment and by mesenchymal (homotypic and heterotypic) interactions. Renin, a terminal differentiation marker, is not only expressed in these cells but is also secreted in both its precursor (prorenin) and its active forms. MATERIALS AND METHODS Production of transgenic mice (previously described in 16). Briefly, a 3.1-kb EcoRI–BamHI fragment containing the adenovirus E1A promoter fused to the SV40 T gene was microinjected into the pronuclei of fertilized oocytes. Two founder lines were bred by crossing to DBA/2 mice (strain that has two renin genes, Ren-1 and Ren-2) and subsequent progeny generations by backcrossing to F1 hybrids to obtain offspring which are homozygous for E1A-T and Ren-2. Establishment of FS10 fibroblast-like cell line. SMGs were removed from transgenic adult male mice under sterile conditions. For a given experiment three to four SMGs from male siblings were pooled. The glands were finely chopped and then dissociated in the following buffer: 13 collagenase (0.16% collagenase type 2, 0.16% collagenase type 3 (Worthington) were dissolved in MEM, filtered and stored at 220°C), 0.5 U dispase (grade I, Boehringer) per milliliter, 0.002 U DNase (Boehringer) per milliliter. Epithelial clusters were eliminated by discarding cell pellets following differential sedimentation. Supernatants containing individual cells or cell clusters of less than 10 cells were poured onto plastic dishes, and then the cells were allowed to adhere for 1 h and washed abundantly with DMEM. Fibroblast-like cells adhered easily and were fed DMEM 1 15% fetal calf serum (Gibco). After 10 passages the cell nuclei were stained histochemically for the presence of the T antigen. Those cells staining positive and showing a fibroblast-like phenotype were selected and grown in DMEM 1 10% fetal calf serum. When a homogenous population was obtained we tested these cells, which we call FS10, for the presence of the intermediate filament subunit of mesenchymal cells, vimentin, by immunohistochemical staining and for the expression of the fibroblast-specific gene, HGF/scatter factor by RT-PCR. Total RNA from 80% confluent FS10 cultures was prepared and RT-PCR carried out using the primers 59GAAAGTTGGGTTCTTACTGC39 and 59GAGGCCAGTGTATTTGAAGC39 and the internal probe was 59GGTTGTACAATCCCTGAAAAG39. Cell culture. SIMS cells were grown routinely in hormonally defined medium (HDM), containing DMEM/F12 with insulin, transferrin, and selenium (Boehringer Mannheim, 2.5 mg/ml of each), prostaglandin E1 (Sigma, 2.5 mg/ml), and EGF (Sigma, 10 –30 ng/ml).
173
For differentiation experiments, the medium was supplemented (1 mg/ml of each hormone) with thyroxine (T3), androgen hormone, DHT, or Metribolone (RU1881, a kind gift from Roussel Uclaf, France) and dexamethasone (Dex). The filter supports used were Transwell clear polycarbonate 0.4 mm pore size (Costar). The filters were coated with E-C-L matrix (matrix derived from Englebreth– Holm–Swarm mouse tumor and containing collagen IV, entactin, and laminin; Promega). For three-dimensional studies, Cellagen AC-3 (ICN, 0.3% solution of acid-solubilized type I collagen, pH3) was neutralized with 0.34 N NaOH and mixed with 103 RPMI. The collagen mixture was added to cells (2 3 10 5/ml gel) and the mixture allowed to gel. Cultures were then fed with HDM containing hormones. MRC-5 human embryonic lung fibroblast cell line (ATCC collection) was used for heterotypic mesenchymal interactions and cultured on plastic with MEM containing 10% fetal calf serum. Histological techniques and immunohistochemistry. SMG tissue was fixed using the AMeX method (acetone, methyl benzoate, and xylene; 20) and was paraffin embedded. Five-micrometer sections were used for immunohistochemical staining. Cells were fixed with paraformaldehyde (4% in PBS) and permeabilized with saponin for all other immunofluorescence studies. Matrigel cultures were fixed in 2% paraformaldehyde, embedded in sucrose (30% final solution), and frozen in Tissue-Tek [as described in 21, 22] and 6-mm sections were prepared for confocal analysis. The following primary antibodies were used: mouse monoclonal anti-SV40 T antigen (Hybridolab, Institut Pasteur, Paris, France); goat anti-human vimentin (Sigma); rabbit anti-human hAR specific to NH 2 terminal 27 amino acids [23] (kind gift from Ire`ne Mowszowicz, Necker Hospital, Paris, France); and rabbit anti-mouse renin-2 C-terminal-specific antibody, generated by Ruth Ladenheim and purified by Catherine Rougeot (Institut Pasteur, Paris, France) from a synthetic peptide (CT 9292, Ile-His-Tyr-Gly-Ser-Gly-Arg-Val-Lys-Gly) synthesized by Jean Igolen (Institut Pasteur). Confocal microscopy. For confocal microscopy of cells, the nuclei were stained with propidium iodide (1:50 dilution; Boehringer Mannheim) and actin filaments were detected with FITC-labeled phalloidin (Sigma). Samples were mounted in 50% glycerol and observed with a confocal microscope (Wild Leitz) at low magnification (40X objective). Measurement of renin activity. We used a commercially available kit, angiotensin I 125I radioimmunoassay kit from DuPont NEN, to indirectly measure renin by determining the generation of angiotensin I, the primary metabolite of renin activity. The substrate used in our reaction conditions was either sheep substrate derived from the plasma of nephrectomized sheep (a gift from Tim Reudelheuber, IRCM, Montreal, Quebec, Canada) or commercially available porcine angiotensinogen (Sigma). Total renin activity (prorenin and renin) was measured by an initial trypsin digestion of the samples at room temperature for 60 min. A standard curve using angiotensin I standards (provided in the kit) was determined for each experiment. The average net counts for each standard (and for each sample) was expressed as a percentage of the average net counts of the zero standard (which contains the angiotensin I antiserum but no angiotensin I) following substraction from the blank (which does not contain angiotensin I antiserum or angiotensin I) and plotted against the known angiotensin I concentrations in nanograms per milliliter or picograms per milliliter. The concentration of angiotensin I for each culture supernatant tested was interpolated from the standard curve and renin activity expressed as nanograms per milliliter per hour or picograms per milliliter per hour of generated angiotensin I. We used culture medium as an additional control blank in our assays. We defined a sample as having “not significant” amounts of renin activity if the concentration of angiotensin I extrapolated did not lie within the straight area of the curve. Each sample was tested in duplicate in each experiment and each experiment was carried out at least three times. Standard deviations were then calculated.
174
LAOIDE, GASTINNE, AND ROUGEON
Transcytosis experiments. Transcytosis experiments were carried out essentially as previously described for EGF transcytosis across MDCK cells [24]. The cells were grown to confluency on 0.4-mm Transwell clear (Costar) filters. Confluency was assessed by using a phenol red-free medium on one side of the filter and determining spectroscopically (absorbance at 479 nm) the transfer of phenol red from the medium on the other side of the filter [25]. A total of 200,000 cpm of 125I-labeled renin (gift from Catherine Rougeot, Institut Pasteur) was added to either the apical or the basal medium and at various time points samples were removed from the opposite medium and the cpm was measured. 125I-EGF (Amersham) was used as a positive control and [ 3H]inulin was used as a marker of passive diffusion. Transient transfections and CAT assays. Cells were transfected by the calcium phosphate coprecipitation technique. The CAT reporter plasmid carrying an ARE (androgen receptor element) was constructed by fusing a double-stranded oligonucleotide. The sequence of the sense strand is as follows: 59TCGACGTCTGGTACAGGGTGTTCTTTTTG39, which contains a consensus ARE element flanked by SalI and BamHI sites for cloning into pBLCAT5 vector (which has an HSV tk promoter, 59 and 39 polylinkers and minimized background “vector effects”) [26]. CAT activity was assayed by standard methods using [ 14C]chloramphenicol (Amersham). Unreacted chloramphenicol was separated from its acetylated derivatives by TLC and the spots were visualized by autoradiography.
RESULTS
Establishment of an SMG Fibroblast-like Cell Line, FS10, from Mice Transgenic for the SV40 Large T Antigen We wanted to have an SMG-derived cell line to study homotypic mesenchymal– epithelial interactions with our SIMS epithelial cell line. We therefore isolated fibroblast-like cells from male mice carrying the E1ASV40 T antigen construct, previously described elsewhere [16, 27, 28]. After 10 passages in culture containing 15% serum the phenotypically fibroblast-like population was tested for the expression of the T antigen (Fig. 1A) and of the intermediate filament vimentin (Fig. 1B) by indirect immunoflorescence and for expression of the scatter factor/HGF by RT-PCR (Fig. 1C). Cells positive for all three markers are routinely maintained on plastic and are designated FS10 cells. Growth and Differentiation of SIMS Cells in HDM We developed a serum-free medium to allow the growth and differentiation of SIMS cells (Fig. 2). The culture medium, DMEM/F12 (v/v) has a Ca 21 concentration of 1.05 mM which is optimal for SMG epithelial cell differentiation [29, 30]. The cells have an absolute requirement for insulin, transferrin, and selenium as well as for one of the following growth factors: EGF, KGF, or bFGF. KGF and bFGF are not as efficient in promoting growth as EGF but can be substituted following an adaptation period. T3 and testosterone (DHT or Metribolone, a stable synthetic androgen) are not required for growth and were slightly inhibitory at the
FIG. 1. Immortalization of FS10 fibroblast-like mouse SMG cell line derived from male mice transgenic for the SV40 large T antigen under the control of the E1A promoter. (A) Immunohistochemical staining using an antibody directed against the large T antigen. The nuclei of all cells are stained. (B) Immunohistochemical staining using an antibody directed against the intermediate filament, vimentin (scale 5 mm). (C) RT-PCR analysis using HGF/scatter factor specific primers. Lane 1, FS10 PCR product; lane 2, 3T3 PCR product used as a positive control of HGF expression.
concentrations used (1 mg/ml; Fig. 2). These hormones were added in differentiation medium when studying renin expression and secretion and androgen receptor expression in confluent cultures. The cells have an overall doubling time of 48 h in this defined medium. The cells grow slowly until a minimum density is reached and thereafter confluency is attained and maintained for many days on plastic, on E-C-L-coated plastic, or on filter supports. Renin Expression and Secretion in SIMS Cells Grown on Filter Supports The SIMS cell line is derived from the SMG of a 21-day-old male mouse carrying two renin genes, Ren-1
TUBULOGENESIS AND RENIN EXPRESSION IN SIMS CELLS
175
FIG. 2. Definition of a serum-free, hormonally defined medium (HDM) for the proliferation and differentiation of SIMS cells. Cells were allowed to grow for 6 days in medium (ALL 1 EGF) containing DMEM/F12 supplemented with insulin, transferrin, and selenium (ITS), prostaglandin E1, dexamethasone (Dex), thyroxine (T3), and EGF (30 ng/ml). Each component was succesively removed to determine the effect on cell growth (100% represents ALL 1 EGF medium). KGF (30ng/ml) and bFGF(20ng/ml) were not as efficient growth promoters as EGF but could be substituted after an adaptation period.
and Ren-2 [16]. The product of the Ren-2 gene, renin, is highly expressed in the mouse SMG GCT cells [31, 32] and has previously been shown to be expressed in this cell line, using RT-PCR. A heterogenous staining of the cell line, using an anti-renin antibody, was also detected [16]. Here we studied the expression and secretion of renin in polarized cells. SIMS cells were initially cultured on a porous filter support coated with E-C-L matrix (Materials and Methods) to allow the cells to orient their apical– basolateral axes. The cells form domes when confluent after 7–10 days in HDM. Immunohistochemical staining using a mouse anti-renin antibody, which specifically stains GCT cells of mouse SMG sections (Fig. 3A), demonstrates renin synthesis in SIMS cells (Fig. 3B). Using an enzyme radioimmunoassay (RIA) we then determined the amount both of
prorenin and of active renin secreted into the apical and basolateral compartments (Table 1). Prorenin precursor enzyme is found in both compartments, in the presence and in the absence of E-C-L matrix, while active renin appears to be secreted in relatively small amounts only from the apical domain. The presence of mesenchyme, homotypic (FS10) or heterotypic (human embryonic MRC-5 cells), has little or no effect on renin expression (Table 1). In vivo, the GCT cells of the male mouse SMG synthesize large amounts of renin which are released from secretory granules in both the active and the precursor forms and subsequently detected in the saliva [19, 33, 34]. However, under certain conditions (such as male aggressive behavior) SMG-specific enzyme is also found in the blood stream [reviewed 18, 32]. This sug-
176
LAOIDE, GASTINNE, AND ROUGEON
FIG. 3. Renin expression in the adult male mouse SMG (A) and in the SIMS cell line grown on filter supports. The antibody used is directed against the C-terminal peptide of the mouse Ren-2 gene product (Materials and Methods). Only the GCT cells of the SMG are labeled, as expected. (A) SIMS cells form domes at confluency and all the cells stain positive (B). Bar, 50 mm.
gests that GCT cells secrete (pro)renin from both the apical (salivary compartment) and the basolateral (circulation) domains either by a direct mechanism or by transcytosis. We tested whether SIMS cells could transcytose renin across the cell by labeling renin peptide with 125I and adding it to either the basal or the apical culture medium of confluent SIMS cells growing on permeable filter supports. Confluence was assessed spectroscopically using phenol red as an indicator (Materials and Methods). We found that renin is unable to transcytose in either direction: no radioactivity was detectable in the opposite compartment (Fig. 4) when 125 I-renin is added to either the apical or the basal compartments. In contrast, as previously demonstrated [24, 35], 125I-EGF is transcytosed in a timedependent manner in the basal–apical direction. [ 3H]Inulin was used as a control of passive diffusion across SIMS cells (data not shown). These data suggest that prorenin secretion occurs at both the apical and the basolateral surfaces of SIMS cells and that no renin is transported across the cell. Neither was any radioactivity detected in the lysed cell pellet following alkali extraction of the cells from the filter. In conclusion,
SIMS cells secrete predominantly prorenin under the conditions described and, in addition, active renin appears to be secreted exclusively from the apical domain. There is no apparent influence of the mesenchyme in these experiments. SIMS Cells Form Branching Tubular Structures and Secrete Prorenin in Coculture in Collagen Type I Gels We have previously shown that SIMS cells can remodel within collagen type I gels to form three-dimensional cysts of up to 80 mm in diameter with a central lumen surrounded by a single layer of cells [16]. In this study, we investigated, first, whether the morphogenetic behavior of SIMS cells might be influenced in coculture with mesenchymal cells, as has previously been shown for the adult female dog kidney cell line, MDCK [14, 15]; second, whether the cells would respond differently to homotypic than to heterotypic mesenchymal interactions; and third, the effect of the observed morphogenetic behavior on renin expression. Cocultures were prepared as described [14, 15, 36,
TABLE 1 Renin Secretion from SIMS Cells Grown on Filter Supports Total renin a,b
SIMS SIMS 1 FS10 SIMS 1 MRC-5
Active renin a
Total renin a,b
Apical 1 ECL
Apical 2 ECL
Apical 1 ECL
Apical 2 ECL
Basal 1 ECL
Basal 2 ECL
Total renin a,b cell pellet
670 6 110 610 6 96 450 6 60
590 6 105 700 6 110 500 6 108
310 6 95 320 6 85 NS
NS NS 325 6 76
300 6 83 530 6 70 530 6 79
240 6 60 560 6 100 400 6 80
4200 6 230 ND 3200 6 380
Note. NS, not significant; ND, not determined. a Values in pg/ml/h of angiotensin (average of three RIA experiments). b Renin activity following trypsin digestion.
TUBULOGENESIS AND RENIN EXPRESSION IN SIMS CELLS
177
FIG. 4. Renin is not transcytosed across SIMS cells. 125I-labeled renin was added either to the basal or to the apical culture medium of SIMS cells grown to confluency on filter supports (Materials and Methods). After 30 min, 1 h, 2 h, 3 h, 4 h, and 6 h the number of cpm was determined in the opposite medium. No transcytosis is observed. Transcytosis of 125I-EGF (basal to apical) was used as a positive control.
37] (Materials and Methods). Fibroblasts, either FS10 SMG-derived cells (see Fig. 1) or human embryonic lung MRC-5 cells, were first seeded within the gel, a cell-free layer was then added, and finally SIMS cells were suspended in a third layer of collagen. The gels were either fixed in six-well dishes or floated in petri dishes and the cultures allowed to grow and migrate within the gels for 2 to 3 weeks. The gel layer containing SIMS cells was then separated from the remaining gel, the cell nuclei were stained with propidium iodide (Fig. 5), cytoplasmic actin was stained with FITC-labeled phalloidin (Figs. 5C–5D), and then the threedimensional structures were analyzed by confocal microscopy. In both homotypic and heterotypic cocultures, SIMS cells form branching tubular structures: initially the cells migrate to form cyst-like structures reminiscent of SIMS alone embedded in gel; these cysts then develop cavities (Fig. 5A) and elongate (Fig. 5B) within 2 weeks of seeding. Between 2 and 3 weeks an increasingly complex network of branching structures is observed (Fig. 5C) which migrate in all directions within the gel. The size of the lumen of a single branch cord is of the order of 20 – 40 mm and it is surrounded by a monolayer of polarized cells (Fig. 5D). Semithin sections (Fig. 6) confirmed the presence of branching tubules which appear to initiate from spherical struc-
tures (Figs. 6A and 6B) and develop in tubular structures with well-defined lumina (Figs. 6C and 6D). The morphogenetic behavior of SIMS cells in homotypic (FS10) or heterotypic (MRC-5) cocultures was very similar and, indeed, more elaborate structures were observed with MRC-5 fibroblasts. This may be due to the large amounts of HGF/scatter factor secreted by this cell line which has been shown to be responsible for the morphogenetic behavior of MDCK cells in cocultures [14, 15]. We also tested whether different hormones might affect SIMS morphogenesis in collagen gels, either alone or in cocultures, and observed a slight increase in the number of branching cords and in the time of appearance of these structures in the presence of T3 and DHT or Metribolone, known to be important inducers of GCT development in vivo. The addition of Dex to the culture medium had no further visible effect (data not shown). Renin-specific immunoreactive material was detected within the tubular structure following confocal microscopy examination of the stained gel (Fig 5E). The thickness of the gel and the intrinsic properties of the collagen substratum interfere with the immunoflorescence and it is therefore difficult to detect a clear signal. We then determined whether renin is secreted
178
LAOIDE, GASTINNE, AND ROUGEON
FIG. 5. Confocal microscopy images of SIMS cells in coculture within collagen I gels demonstrating the branching morphogenesis (A–D) and renin expression (E). (A) Four images of a SIMS cyst-like structure developing into a tubular structure. The nuclei are stained with propidium iodide (PI) and the numbers represent the image postion within the structure so that number 2 represents a 4-mm image, 6 a 20-mm image, 9 a 32-mm image, and 14 a 52-mm image (40X objective). (B) As in (A) but showing a more advanced stage of tubulogenesis (63X objective). (C) Double staining of cytoplasmic actin with FITC-labeled phalloidin (green) and nuclei with PI (red) showing a network of branching structures. (D) As in (C) but showing a single branch structure with a large central lumen (40 mm) surrounded by a single layer of cells. (E) Renin expression (green) in SIMS tubular structures demonstrated using a mouse anti-renin antibody; nuclear staining with PI. Four sequential images are shown demonstrating the presence of reactive material in the lumen. The collagen interferes with the immunoflorescent signal resulting in a poor image.
TUBULOGENESIS AND RENIN EXPRESSION IN SIMS CELLS
179
FIG. 8. Renin is expressed in SIMS cells embedded in Matrigel. Confocal analysis of a 5-mm cryostat section following double staining of the nuclei with PI and of the cytoplasmic terminal differentiation marker, renin, using a mouse anti-renin antibody. SIMS cells were in coculture for 2 weeks before fixing and staining (63X objective). FIG. 9. Androgen receptor expression in SIMS cells. (A) SIMS cells grown on filters were stained by indirect immunoflorescence using human anti-AR antibody, against the N-terminal region of the receptor (Materials and Methods). The nuclei of a small number of cells are labeled. (B) Confocal analysis of SIMS cells embedded in a Matrigel coculture for 2 weeks. Cryostat section were labeled with anti-AR antibody and the nuclei were stained with PI. Four successive images are shown. Nuclei are positive for the receptor and there is also some weak cytoplasmic staining.
into the culture medium and, if so, whether it is in its active or precursor form. Significant amounts of total renin activity (10 times more than in filter experiments, Tables 1 and 2) were detected, suggesting that the branching tubular morphology, reminiscent of the in vivo structure, induces prorenin expression and secretion. No active renin was detected under these conditions.
An Extracellular Matrix and a Three-Dimensional Structure Are Sufficient for Renin Secretion from SIMS Cells The importance of an intact basement membrane in the differentiation and maintenance of epithelial cellspecific gene expression has been extensively studied [3, 38], particularly using either primary mammary
180
LAOIDE, GASTINNE, AND ROUGEON
FIG. 6. Semithin section of SIMS coculture in collagen I gels. A–D, different stages of tubulogenesis of SIMS cells. In all stages a large central lumen surrounded by a single layer of cells is present (63X objective; bar, 10 mm).
epithelial cells or mouse mammary cell lines [20, 39 – 41]. Bissell and co-workers [42, 43] have demonstrated the role of tissue phenotype and architecture in preventing apoptosis and in supporting the differentiated phenotype of the individual cell within the tissue. In this study, we were interested in determining the structural and functional properties of SIMS cells within a basement membrane support in both the presence and the absence of a mesenchymal coculture and in a hormonally defined medium (HDM, Fig. 2). SIMS cells were grown within, below, or on top of a Matrigel support and the morphogenetic behavior of the cells between 10 and 14 days after seeding was examined by light microscopy. In all cases, the cells rounded up and formed clusters both in the presence and in the absence of hormones. Thus, basement membrane alone is sufficient to allows cyst-like formation of SIMS cells (Figs. 7A and 7B). A growth factor-reduced TABLE 2 Renin Secretion from SIMS Cells Seeded within Collagen Type I Gels Total renin a,b SIMS 1 MRC-5 coculture SIMS 1 FS10 coculture
6.4 6 0.8 4.3 6 0.5
Active renin a NS NS
Note. NS, not significant. a Values in ng/ml/h of angiotensin I (average of three RIA experiments). b Renin activity following trypsin digestion.
gel also sustains cyst formation (Fig. 7A), although the initial proliferation of the cells in HDM is slower. We then grew the cells in the presence and absence of mesenchymal homotypic and heterotypic cocultures avoiding heterocellular contact by separation with a cell-free Matrigel layer. We found extensive three-dimensional formation which, after about 14 days in culture, resulted in structures which were macroscopically visible, including individual ring-like structures (Figs. 7C–7E), complex multilobed cysts (Figs. 7F and 7G), and branched tubules (Fig. 7H). Cryostat sections of the epithelial gel layer demonstrated the presence of lumen in all cases (Figs. 7I, 7J and 8). Similar cell migration and morphogenetic behavior was found using either homotypic or heterotypic fibroblast cocultures. The diversity of phenotypes observed appears to depend on the initial cell density as well as the number of days in culture. We determined renin expression by immunohistochemical staining with a mouse anti-renin antibody of cryostat sections of Matrigel cultures and found that renin is expressed and cytoplasmically located in all SIMS cells organized in a three-dimensional structure (Fig. 8). When we measured renin secretion following HDM renewal we found a time-dependent increase in both prorenin and renin secretion as measured by RIA (Table 3). Both prorenin and active renin activities were detected in culture supernatants from SIMS grown alone in Matrigel and from SIMS homotypic and heterotypic cocultures. Similarily, NGF activity, which is also a terminal differentiation marker of SMG GCT
TUBULOGENESIS AND RENIN EXPRESSION IN SIMS CELLS
181
FIG. 7. Diverse morphological structures of SIMS cells in Matrigel. (A) SIMS embedded in growth factor reduced Matrigel after 2 weeks (32X objective). (B) As in (A) but in Matrigel. (C, D) SIMS with mesenchymal coculture after 8 days in Matrigel (20X objective). (E) As in (C) but with growth factor reduced matrigel. (F–H) As in (C) but after 2 weeks in culture. (I, J) Cryostat sections (5 mm) of Matrigel cocultures demonstrating the presence of a lumen (40X objective).
cells, has also been detected by others (M. Fahnestock, personal communication) in our culture supernatants. We conclude that Matrigel creates a suitable and sufficient environment for renin expression and secretion from SIMS cells, both in its active and in its precursor forms. Androgen Receptor Expression in SIMS Cells The sexual dimorphism of the mouse SMG has been extensively documented: male mice SMGs contain a
highly developed GCT system which can occupy up to 50% of the gland in an adult mouse (see Fig. 3A). The differentiation of GCT cells from striated duct cells is under hormonal control, initially in both sexes by thyroxine, and at puberty, by androgens in males [18, 42]. Certain strains of male mice carry two renin genes, Ren-1 and Ren-2, Ren-2 being highly expressed, along with the genes encoding NGF and EGF, in the male adult gland. However, to date, no androgen-responsive cis-acting element has been characterized upstream of
182
LAOIDE, GASTINNE, AND ROUGEON
the corresponding genes and the molecular mechanism of the high level of transcription remains to be elucidated. We used either DHT or a nonmetabolizable derivative, Metribolone (Materials and Methods) as a source of androgen hormone in our HDM culture medium but were unable to demonstrate a strong induction in renin expression under a variety of environmental conditions tested (data not shown). We determined whether the androgen receptor is present in SIMS cells seeded either on filter supports or in Matrigel cocultures. Between 3–5% of SIMS cells grown for 1 week to confluency on filters stained positive for the receptor using a polyclonal anti-human androgen receptor antibody [23] (Materials and Methods). Immunoreactive material appears exclusively nuclear (Fig. 9A): it is unclear why only a small number of individual cells in a confluent monolayer are positive. SIMS cells in Matrigel cocultures with fibroblasts show a higher, more homogenous level of expression of the receptor (Fig. 9B). Staining of cryostat sections with propidium iodide and indirect immunoflorescence using the same anti-androgen receptor antibody demonstrates mainly nuclear localization of the receptor but also some staining in the cytoplasm. It has previously been demonstrated that expression of the androgen receptor in human prostate epithelial cells is induced by coculture with fibroblasts [45]. Finally, to test whether a classical ARE is recognized in a transfection assay, we constructed a vector carrying an ARE element upstream from the CAT reporter gene (Materials and Methods). A similar construct lacking the ARE was used as a negative control while the SV40 promoter-enhancer fused to CAT was used as a positive control. SIMS cells grown on plastic in the presence of androgens were transiently transfected and the results shown in Fig. 10 demonstrate that the ARE–CAT construct is activated in SIMS cells in both the presence and the absence of cotransfected vector carrying the gene encoding the androgen receptor. These data suggest that the SIMS cell line expresses the androgen receptor and can therefore activate, at TABLE 3 Renin Secretion from SIMS Cells in Matrigel
SIMS SIMS SIMS SIMS SIMS a
within Matrigel on top of Matrigel with Matrigel overlay 1 MRC-5 coculture 1 FS10 coculture
Total renin a,b
Active renin a
1.6 6 0.2 0.7 6 0.1 0.8 6 0.1 1.0 6 0.1 0.8 6 0.1
1.4 6 0.2 0.7 6 0.1 0.72 6 0.2 0.84 6 0.1 0.61 6 0.1
Values in ng/ml/h of Angiotensin I (average of three RIA experiments). b Renin activity following trypsin digestion.
FIG. 10. Transient transfection of SIMS cells and CAT assay demonstrating the expression of a CAT reporter gene fused to an androgen receptor element (ARE). Lane 1, positive control using the SV40 promoter-enhancer fused to the CAT gene; lanes 2 and 4, activation of an ARE–CAT construct in transfected SIMS cells grown in the presence of DHT and cotransfected (lane 2) or not (lane 4) with a vector carrying the AR gene; lane 3, Background control plasmid.
least to some extent, the expression of androgen-regulated genes. DISCUSSION
This report demonstrates the structural and functional relationship of an immortalized mouse epithelial cell line in homotypic and heterotypic interactions under a variety of organotypic and environmental contexts. Mouse SMG development begins during the last third of fetal life and continues until adulthood is attained. The development of the gland is characterized initially by branching morphogenesis, leading to a branching pattern which is characteristic of the SMG. Once the pattern is established cytodifferentiation of secretory cells begins although undifferentiated cells are already capable of synthesizing gland-specific secretory proteins [46]. Cutler and Gremski [13] described the role of the mesenchyme in regulating the SMG branching pattern as “instructive” in that epithelial mesenchymal interactions tend to restrict the cell’s developmental options. They suggested that the control of cytodifferentiation, on the other hand, is “permissive” in nature because epithelial mesenchymal interactions appear to modulate basic processes which are already established. Cutler [9] demonstrated that the rat SMG can cytodifferentiate in the absence of mesenchyme at 16 days pc, when early branching has commenced, but cannot differentiate before then due to the complete lack of branching. Interestingly, it appears that the commitment to cytodifferentiation of SMG cells may be necessary, however, for branching morphogenesis to progress: this is in contrast to the mouse mammary system where tissue phenotype appears to be dominant to cellular phenotype [22].
TUBULOGENESIS AND RENIN EXPRESSION IN SIMS CELLS
SMG development starts at E11 and continues postnatally. Terminal differentiation of the gland occurs in the mouse at 6 weeks and thereafter the gland is mature. The regulation of SMG cytodifferentiation by thyroid and androgenic hormones postnatally has been well documented and the sexual dimorphism, tissuespecific regulation, and probable endocrine function of the gland have been the subject of much interest for many years [47– 49]. Two studies reporting branching morphogenesis [11, 14, 15] prompted us to examine whether our mouse in vitro model, using homotypic fibroblast– epithelial interactions, would reveal similar organotypic interactions and in addition what effect such an environment would have on the expression and secretion of an SMGspecific marker, the product of the Ren-2 gene renin. Our results indicate that SIMS cells are plastic in their behavior and have the potential to express a number of morphogenetic phenotypes depending on the environmental stimulus. We found, first, that the development of polarity on filter supports allows the secretion of small amounts of mainly renin precursor from both the apical and the basolateral domains. The presence of fibroblast coculture does not induce further secretion. In contrast, when SIMS cells are seeded in collagen type I gels in coculture with homotypic or heterotypic mesenchyme, the mesenchyme induces SIMS cells to form branching tubules and to secrete a significant amount of prorenin, which, from confocal analysis, appears to be secreted into the wide lumen of the tubule. In vivo, collagen I is a vital component of SMG branching morphogenesis and, in concert with collagen III, appears to specify the branch points and, therefore, the distinct branching pattern of the gland. Thus, our in vitro model can mimic the morphogentic pattern found in vivo and induce the expression of a terminal differentiation marker, namely, renin. The morphological behavior of SIMS cells within a Matrigel basement membrane is complex. A variety of phenotypically distinct structures were observed: from relatively simple cyst-like structures when SIMS monocultures were seeded to highly organized multibranched structures in SIMS–fibroblast cocultures. Strikingly, renin expression and secretion were observed in all cell architectures. Coculture with mesenchyme does not increase renin secretion and, in addition, basement membrane alone appears to be sufficient to allow secretion of both renin precursor and of active renin. The percentage of active renin varied depending on the culture medium, the number of days in culture and the time of removal of the culture supernatant, but was always greater than 50% of the total activity and therefore much higher than the activity found under other environmental conditions. It is important in future studies to study the expres-
183
sion of other differentiation markers, in particular, EGF and NGF, to determine whether a variety of mechanisms exist, as in the case of mammary cells when b-casein is expressed in the absence of a fully polarized phenotype while WAP expression requires the presence of a highly organized three-dimensional structure [20, 39, 51]. We also want to determine the molecular nature of renin activation and to understand more fully the role of androgens in the control of cell cytodifferentiation and gene expression. We are very grateful to R. Hellio for the confocal analysis; C. Rougeot for purification of the anti-renin antibody, for preparation of the 125I-labeled renin peptide, and for many fruitful discussions; Ruth Ladenheim for generating the anti-renin antibody; J-C. Benichou for help in preparing the semithin sections; T. Reudelheuber and I. Jutras for sheep substrate; I. Mowszowicz for anti-AR antibody; Roussel Uclaf for RU1881 Metribolone; M. Fahnestock for sharing unpublished results; and M. Bissell’s laboratory for their cryostat preparation protocol. We would like to thank the following for stimulating discussions and or reading of the manuscript: C. Papanicolaou, O. Kellermann, I. Chupin, and A. Poliard. We are grateful to Laurence Boutout for secreterial assistance. B.L. also thanks Fred, Claire, Aindrias, and Jeanne for their valued contributions and especially for the night hawk discussions. Financial support came from the Institut Pasteur and the Centre National de la Recherche Scientifique (Unite´ de Recherche Associe´e CNRS 1960).
REFERENCES 1.
Nogawa, H., and Mizuno, T. (1981). Mesenchymal control over elongating and branching morphogenesis in salivary gland development. J. Embryol. Exp. Morph. 66, 209 –221.
2.
Denny, P. C., Ball,W. D., and Redman, R. S. (1997). Salivary glands: A paradigm for diversity of gland development. Crit. Rev. Oral Biol. Med. 8, 51–75.
3.
Macauley, S. P., Tarnuzzer, R. W., Schultz, G. S., Chegini, N., Oxford, G. E., and Humphreys-Beher, M. G. (1997). Extracellular-matrix gene expression during mouse submandibular development. Arch. Oral Biol. 42, 443– 454.
4.
Banerjee, S. D., Cohn, R. H., and Bernfield, M. R. (1977). The basal lamina of embryonic salivary epithelia: production by the epithelium and role in maintaining lobular morphology. J. Cell Biol. 73, 445– 463.
5.
Fitch, J. M., and Linsenmayer, T. F. (1994). Interstitial basement membrane components in development. In “Extracellular Matrix Assembly and Structure” (P. D. Yurchenco, D. E. Birk, and R. P. Mecham, Eds.), pp. 441– 462. Academic Press, San Diego.
6.
Grobstein, C. (1953). Epithelio-mesenchymal specificity in the morphogenesis of mouse submandibular rudiments in vitro. J. Exp. Zool. 124, 383– 413.
7.
Kratochwil, K. (1969). Organ specificity in mesenchymal induction demonstrated in the embryonic development of the mammary gland of the mouse. Dev. Biol. 20, 46 –71.
8.
Lawson, K. A. (1974). Mesenchyme specificity in rodent salivary gland development: the response of salivary epithelium to lung mesenchyme in vitro. J. Embryol. Exp. Morph. 32, 469 – 478.
9.
Cutler, L. S. (1980). The dependent and independent relationships between cytodifferentiation and morphogenesis in developing salivary gland secretory cells. Anat. Rec. 196, 341–348.
184 10.
LAOIDE, GASTINNE, AND ROUGEON Nogawa, H., and Takahashi, Y. (1991). Substitution for mesenchyme by basement-membrane-like substratum and epidermal growth factor in inducing branching morphogenesis of mouse salivary epithelium. Development 112, 855– 861.
11.
Takahashi, Y., and Nogawa, H. (1991). Branching morphogenesis of mouse salivary epithelium in basement membrane-like substratum separated from mesenchyme by the membrane filter. Development 111, 327–335.
12.
Cutler, L. S. (1990). The role of extracellular matrix in the morphogenesis and differentiation of salivary glands. Adv. Dent. Res. 4, 27–33.
13.
Cutler, L. S., and Gremski, W. (1991). Epithelial-mesenchymal interactions in the development of salivary glands. Crit. Rev. Oral Biol. Med. 2, 1–12.
14.
Montesano, R., Schaller, G., and Orci, L. (1991). Induction of epithelial tubular morphogenesis in vitro by fibroblast-derived soluble factors. Cell 66, 697–711.
15.
Montesano, R., Matsumoto, K., Nakamura, T., and Orci, L. (1991). Identification of a fibroblast-derived epithelial morphogen as hepatocyte growth factor. Cell 67, 901–908.
16.
Laoide, B. M., Courty, Y., Gastinne, I., Thibaut, C., Kellermann, O., and Rougeon, F. (1996). Immortalised mouse submandibular epithelial cell lines retain polarised structural and functional properties. J. Cell Sci. 109, 2789 –2800.
17.
Gresik, E. W. (1980). Postnatal developmental changes in submandibular glands of rats and mice. J. Histochem. Cytochem. 28, 860 – 870.
18.
Gresik, E. W., Hosoi, K., Kurihara, K., Maruyama, S., and Ueha, T. (1996). The rodent granular convoluted tubule cell- an update. Eur. J. Morphol. 34, 221–224.
19.
Gresik, E., and Barka, T. (1977). Immunocytochemical localization of renin in the submandibular gland of the mouse. J. Histochem. Cytochem. 25, 1027.
20.
21.
22.
Sato, Y., Mukai, K., Watanabe, S., Goto, M., and Shimosato, Y. (1986). The AMeX Method: A simplified technique of tissue processing and paraffin embedding with improved preservation of antigens for immunostaining. Am. J. Pathol. 125, 431– 435. Streuli, C. H., Schmidhauser, C., Bailey, N., Yurchenco, P., Skubitz, A. P. N., Roskelley, C., and Bissell, M. J. (1995). Laminin mediates tissue-specific gene expression in mammary epithelia. J. Cell. Biol. 129, 591– 603. Weaver, V. M., Peterseben, O. W., Wang, F., Larabell, C. A., Briand, P., Damsky, C., and Bissell, M. J. (1997). Reversion of the malignant phenotype of human breast cells in three-dimensional culture and in vivo by integrin blocking antibodies. J. Cell Biol. 137, 231–245.
23.
Chang, C., Whelan, C. T., Popovich, T. C., Kokontis, J., and Liao, S. (1989). Prostate androgen receptor: immunohistological location and mRNA characterization. J. Steroid Biochem. 34, 311–313.
24.
Bra¨ndli, A. W., Adamson, E. D., and Simons, K. (1991). Transcytosis of epidermal growth factor. J. Biol. Chem. 266, 8560 – 8566.
25.
Jovov, B., Wills, N. K., and Lewis, S. A. (1991). A spectroscopic method for assessing confluence of epithelial cell cultures. Am. J. Physiol. 261, C1196 –C1203.
26.
Boshart, M., Klu¨ppel, M., Schmidt, A., Schu¨tz, G., and Luckow, B. (1992). Reporter constructs with low background activity utilizing the cat gene. Gene 110, 129 –130.
27.
Kellermann, O., and Kelly, F. (1986). Immortalization of early embryonic cell derivatives after the transfer of the early region
of simian virus 40 into F9 teratocarcinoma cells. Differentiation 32, 74 – 81. 28.
Kelly, F., Kellermann, O., Mechali, F., Gaillard, J., and Babinet, C. (1986). Expression of simian virus 40 oncogenes in F9 embryonal carcinoma cells, in transgenic mice and in transgenic embryos. Cold Spring Harbor Symp. DNA tumor viruses: Cancer Cells 4, 363–372.
29.
Kurth, B. A., Hazen-Martin, D. J., Sens, M. A., and Sens, D. A. (1988). Ultrastructural and immunohistochemical characterization of submandibular duct cells in culture and modification of outgrowth differentiation by manipulation of calcium ion concentration. In Vitro Cell Dev. Biol. 24, 593– 600.
30.
Yang, J., Larson, L., and Nandi, S. (1982). Three-dimensional growth and morphogenesis of mouse submandibular epithelial cells in serum-free primary culture. Exp. Cell Res. 137, 481– 485.
31.
Panthier, J. J., Foote, S., Chambraud, B., Strosberg, A. D., Corvol, P., and Rougeon, F. (1982). Complete amino acid sequence and maturation of the mouse submaxillary gland renin precursor. Nature 298, 90 –92.
32.
Gresik, E. W. (1994). The granular convoluted tubule (GCT) cell of rodent submandibular glands. Micro Res. Tech. 27, 1–24.
33.
Kaiho, M., Nakamura, T., and Kumegawa, M. (1975). Morphological studies on the synthesis of secretory granules in convoluted tubules of mouse submandibular gland. Anat. Rec. 183, 405– 420.
34.
Pinkstaff, C. A. (1980). The cytology of salivary glands. Int. Rev. Cytol. 63, 141–261.
35.
Maratos-Flier, E., Kao, C. Y. Y., Verdin, E. M., and King, G. L. (1987). Receptor-mediated vectorial transcytosis of epidermal growth factor by madin-darby canine kidney cells. J. Cell Biol. 105, 1595–1601.
36.
Yang, J., Flynn, D., Larson, L., and Hamamoto, L. (1982). Growth in primary culture of mouse submandibular epithelial cells embedded in collagen gels. In vitro 18, 435– 442.
37.
Durban, E. M. (1990). Mouse submandibular salivary epithelial cell growth and differentiation in long-term culture: influence of the extracellular matrix. In Vitro Cell Dev. Biol. 26, 33– 43.
38.
Gumbiner, B. M. (1996). Cell adhesion: The molecular basis of tissue architecture and morphogenesis. Cell 84, 345–357.
39.
Schmidhauser, C., Bissell, M. J., Myers, C. A., and Casperson, G. (1990). Extracellular matrix and hormones transcriptionally regulate bovine B-casein 59 sequences in stably transfected mouse mammary cells. Proc. Natl. Acad. Sci. USA 87, 9118 – 9122.
40.
Roskelley, C. D., Desprez, P. Y., and Bissell, M. J. (1994). Extracellular matrix-dependent tissue-specific gene expression in mammary epithelial cells requires both physical and biochemical signal transduction. Proc. Natl. Acad. Sci. USA 91, 12378 –12382.
41.
Lin, C. Q., Dempsey, P. J., Coffey, R. J., and Bissell, M. J. (1995). Extracellular matrix regulates whey acidic protein gene expression by suppression of TGF-alpha in mouse mammary epithelial cells: studies in culture and in transgenic mice. J. Cell. Biol. 129, 1115–1126.
42.
Boudreau, N., Reddy, S. T., Stoker, A. W., Fairman, C., and Bissell, M. J. (1995). The embryonic environment and the extracellular matrix suppress oncogenic transformation by rous sarcoma virus in the chick embryo. Mol. Cell. Differ. 3, 261–274.
43.
Boudreau, N., Werb, Z., and Bissell, M. J. (1996). Suppression of apoptosis by basement membrane requires three-dimen-
TUBULOGENESIS AND RENIN EXPRESSION IN SIMS CELLS
44.
45.
46.
47.
sional tissue organization and withdrawal from the cell cycle. Proc. Natl. Acad. Sci. USA 93, 9309 –9313. Dunn, J. F., and Wilson, J. D. (1974). Developmental study of androgen responsiveness in the submandibular gland of the mouse. Endocrinology 96, 1571–1578. Mowszowicz, I., Berthaut, I., Cussenot, O., Carrance, A., and Mestayer, C. (1994). Androgen receptor in human prostate epithelial cells in culture requires the presence of stromal cells for optimal expression. J. Androl. 15, 40. Yamishina, S., and Barka, T. (1973). Development of endogenous peroxidase in fetal rat submandibular gland. J. Histochem. Cytochem. 21, 40 – 42. Tsutumi, O., Kurachi, H., and Oka, T. (1986). A physiological role of epidermal growth factor in male reproductive function. Science 233, 975–977.
Received August 3, 1998 Revised version received November 30, 1998
185
48.
Sheffield, L. G., and Welsch, C. (1987). Influence of the mouse salivary glands on hormone responsiveness of mouse mammary glands. Proc. Soc. Exp. Biol. Med. 186, 368 –377.
49.
Jones, D. E., Jr., Trans-Patterson, R., Cui, D. M, Davin, D., Estell, K. P., and Miller, D. M. (1995). Epidermal growth factor secreted from the salivary gland is necessary for liver regeneration. Am. J. Physiol. 268, G872–G878.
50.
Rougeot, C., Vienet, R., Cardona, A., Le Doledec, L., Grognet, J. M., and Rougeon, F. (1997). Targets for SMR1-pentapeptide suggest a link between circulating peptide and mineral transport. Am. J. Physiol. 273, R1309 –R1320.
51.
Roskelley, C. D., Srebrow, A., and Bissell, M. J. (1995). A hierarchy of ECM-mediated signalling regulates tissue-specific gene expression. Curr. Opin. Cell Biol. 7, 736 –747.
Tubular Morphogenesis and Mesenchymal Interactions Affect Renin Expression and Secretion in SIMS Mouse Submandibular Cells Brı´d M. Laoide, 1 Isabelle Gastinne, and Franc¸ois Rougeon Unite´ de Ge´ne´tique et Biochimie du De´veloppement, URA CNRS 1960, Institut Pasteur, 25, rue du Dr. Roux, 75724 Paris Ce´dex 15, France
We have previously immortalized a mouse submandibular gland (SMG) ductal epithelial cell line, SIMS, from pubertal male mice transgenic for the SV40 large T antigen under the control of the adenovirus 5 E1A promoter. Here we demonstrate the role of the extracellular environment in directing not only the morphogenetic behavior of the cells, but also their functional differentiation in terms of renin expression and secretion. First, we measured renin activity of polarized SIMS cells. Low levels of renin are secreted from both the apical and the basolateral domains; the mechanism appears to be direct as no renin was found to be transcytosed across the cell. Second, we studied homotypic and heterotypic mesenchymal cell interactions with SIMS cells. We found that epithelial–mesenchymal coculture in collagen I gels results in branching tubular morphogenesis of SIMS cells and that significant amounts of renin are secreted, probably into the lumen, as the precursor form, prorenin. Third, we investigated the effects of the basement membrane on SIMS cell morphology and function and found that this structure alone is sufficient to allow expression and secretion of both prorenin and active renin. Finally, we established that SIMS cells can express androgen-regulated genes in a transient transfection assay. In addition, in Matrigel cultures androgen receptor expression appears to be induced, suggesting that the SIMS cell line will be useful for further studies on the molecular basis of the observed high-level expression of SMG-specific genes in male mice. © 1999 Academic Press
Key Words: immortalized cells; differentiation; extracellular matrix; collagen; androgens.
INTRODUCTION
Developmental interactions between the mesenchyme and the epithelium induce both the morphogenesis and the cytodifferentiation of the mouse subman1 To whom correspondence and reprint requests should be addressed. Fax: 1 33 1 40 61 34 40. E-mail: [email protected].
0014-4827/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.
dibular gland [1–3]. Branching occurs following a mesenchymal stimulus which results in cleft formation and the subdivision of the epithelial rudiment into a branched epithelial tree [4, 5]. Submandibular morphogenesis is supported by a small number of heterotypic mesenchyme [6] and, conversely, submandibular gland (SMG) 2 mesenchyme can influence branching of mammary [7] and lung [8] epithelia. Mesenchyme, however, despite its crucial role in branching, appears to have a lesser role in the terminal cytodifferentiation of epithelial cells. In fact, the two processes can be partially uncoupled, although early branching of the epithelial rudiment appears to be a requisite for mesenchyme-independent cytodifferentiation [9, 10]. Takahashi and Nogawa [11] demonstrated by transfilter experiments that, in the absence of direct mesenchymal– epithelial interactions, branching morphogenesis of E13 day mouse glands does not occur unless an appropriate extracellular environment is provided. Proteoglycans, in particular, chondroitin sulfate, play a vital role in the regulation of SMG morphogenesis but do not appear to be required for secretory cell differentiation. In contrast, type IV collagen and laminin appear to be important for both processes, and indeed type IV collagen appears to couple the processes of branching and cytodifferentiation [12, 13]. In vitro studies of tubular morphogenesis have been hampered by the lack of characterized cell lines. Many of the major observations have come from studies using an adult dog kidney cell line, MDCK [14, 15]. However, in contrast to the SMG, during kidney development polarized epithelia arise from the conversion of mesenchymal cells surrounding the uteric bud by inductive cell– cell interactions. We, therefore, decided to take advantage of our well-characterized mouse SMG ductal epithelial cell line, SIMS, to analyze the process of tubulogenesis in this system and, in addition, to study 2 Abbreviations used: SMG, submandibular gland; GCT, granular convoluted tubule; E-C-L, entactin– collagen–laminin, EHS, Engleberth–Holm–Swarm mouse tumor matrix; HDM, hormonally defined medium; TLC, thin liquid chromatography.
172
TUBULOGENESIS AND RENIN EXPRESSION IN SIMS CELLS
the effects of such an architecture on gene specific expression and secretion. The SIMS line used in this study is derived from 21-day-old male littermates transgenic for the SV40 T antigen under the control of the early expressed E1A promoter of adenovirus 5 [16]. The 21-day gland is still immature in terms of cytodifferentiation and is responsive to hormonal influences. The gland shows a striking sexual dimorphism and the male mouse has a highly developed specialized ductal segment, the granular convoluted tube (GCT), which develops postnatally, under both thyroid and androgen hormonal control [17, 18]. GCT cells synthesize and secrete a number of biologically important peptides, including NGF, EGF, and renin [19]. Here we demonstrate that the morphogenetic behavior of SMG-derived SIMS ductal epithelial cells is influenced both by its extracellular environment and by mesenchymal (homotypic and heterotypic) interactions. Renin, a terminal differentiation marker, is not only expressed in these cells but is also secreted in both its precursor (prorenin) and its active forms. MATERIALS AND METHODS Production of transgenic mice (previously described in 16). Briefly, a 3.1-kb EcoRI–BamHI fragment containing the adenovirus E1A promoter fused to the SV40 T gene was microinjected into the pronuclei of fertilized oocytes. Two founder lines were bred by crossing to DBA/2 mice (strain that has two renin genes, Ren-1 and Ren-2) and subsequent progeny generations by backcrossing to F1 hybrids to obtain offspring which are homozygous for E1A-T and Ren-2. Establishment of FS10 fibroblast-like cell line. SMGs were removed from transgenic adult male mice under sterile conditions. For a given experiment three to four SMGs from male siblings were pooled. The glands were finely chopped and then dissociated in the following buffer: 13 collagenase (0.16% collagenase type 2, 0.16% collagenase type 3 (Worthington) were dissolved in MEM, filtered and stored at 220°C), 0.5 U dispase (grade I, Boehringer) per milliliter, 0.002 U DNase (Boehringer) per milliliter. Epithelial clusters were eliminated by discarding cell pellets following differential sedimentation. Supernatants containing individual cells or cell clusters of less than 10 cells were poured onto plastic dishes, and then the cells were allowed to adhere for 1 h and washed abundantly with DMEM. Fibroblast-like cells adhered easily and were fed DMEM 1 15% fetal calf serum (Gibco). After 10 passages the cell nuclei were stained histochemically for the presence of the T antigen. Those cells staining positive and showing a fibroblast-like phenotype were selected and grown in DMEM 1 10% fetal calf serum. When a homogenous population was obtained we tested these cells, which we call FS10, for the presence of the intermediate filament subunit of mesenchymal cells, vimentin, by immunohistochemical staining and for the expression of the fibroblast-specific gene, HGF/scatter factor by RT-PCR. Total RNA from 80% confluent FS10 cultures was prepared and RT-PCR carried out using the primers 59GAAAGTTGGGTTCTTACTGC39 and 59GAGGCCAGTGTATTTGAAGC39 and the internal probe was 59GGTTGTACAATCCCTGAAAAG39. Cell culture. SIMS cells were grown routinely in hormonally defined medium (HDM), containing DMEM/F12 with insulin, transferrin, and selenium (Boehringer Mannheim, 2.5 mg/ml of each), prostaglandin E1 (Sigma, 2.5 mg/ml), and EGF (Sigma, 10 –30 ng/ml).
173
For differentiation experiments, the medium was supplemented (1 mg/ml of each hormone) with thyroxine (T3), androgen hormone, DHT, or Metribolone (RU1881, a kind gift from Roussel Uclaf, France) and dexamethasone (Dex). The filter supports used were Transwell clear polycarbonate 0.4 mm pore size (Costar). The filters were coated with E-C-L matrix (matrix derived from Englebreth– Holm–Swarm mouse tumor and containing collagen IV, entactin, and laminin; Promega). For three-dimensional studies, Cellagen AC-3 (ICN, 0.3% solution of acid-solubilized type I collagen, pH3) was neutralized with 0.34 N NaOH and mixed with 103 RPMI. The collagen mixture was added to cells (2 3 10 5/ml gel) and the mixture allowed to gel. Cultures were then fed with HDM containing hormones. MRC-5 human embryonic lung fibroblast cell line (ATCC collection) was used for heterotypic mesenchymal interactions and cultured on plastic with MEM containing 10% fetal calf serum. Histological techniques and immunohistochemistry. SMG tissue was fixed using the AMeX method (acetone, methyl benzoate, and xylene; 20) and was paraffin embedded. Five-micrometer sections were used for immunohistochemical staining. Cells were fixed with paraformaldehyde (4% in PBS) and permeabilized with saponin for all other immunofluorescence studies. Matrigel cultures were fixed in 2% paraformaldehyde, embedded in sucrose (30% final solution), and frozen in Tissue-Tek [as described in 21, 22] and 6-mm sections were prepared for confocal analysis. The following primary antibodies were used: mouse monoclonal anti-SV40 T antigen (Hybridolab, Institut Pasteur, Paris, France); goat anti-human vimentin (Sigma); rabbit anti-human hAR specific to NH 2 terminal 27 amino acids [23] (kind gift from Ire`ne Mowszowicz, Necker Hospital, Paris, France); and rabbit anti-mouse renin-2 C-terminal-specific antibody, generated by Ruth Ladenheim and purified by Catherine Rougeot (Institut Pasteur, Paris, France) from a synthetic peptide (CT 9292, Ile-His-Tyr-Gly-Ser-Gly-Arg-Val-Lys-Gly) synthesized by Jean Igolen (Institut Pasteur). Confocal microscopy. For confocal microscopy of cells, the nuclei were stained with propidium iodide (1:50 dilution; Boehringer Mannheim) and actin filaments were detected with FITC-labeled phalloidin (Sigma). Samples were mounted in 50% glycerol and observed with a confocal microscope (Wild Leitz) at low magnification (40X objective). Measurement of renin activity. We used a commercially available kit, angiotensin I 125I radioimmunoassay kit from DuPont NEN, to indirectly measure renin by determining the generation of angiotensin I, the primary metabolite of renin activity. The substrate used in our reaction conditions was either sheep substrate derived from the plasma of nephrectomized sheep (a gift from Tim Reudelheuber, IRCM, Montreal, Quebec, Canada) or commercially available porcine angiotensinogen (Sigma). Total renin activity (prorenin and renin) was measured by an initial trypsin digestion of the samples at room temperature for 60 min. A standard curve using angiotensin I standards (provided in the kit) was determined for each experiment. The average net counts for each standard (and for each sample) was expressed as a percentage of the average net counts of the zero standard (which contains the angiotensin I antiserum but no angiotensin I) following substraction from the blank (which does not contain angiotensin I antiserum or angiotensin I) and plotted against the known angiotensin I concentrations in nanograms per milliliter or picograms per milliliter. The concentration of angiotensin I for each culture supernatant tested was interpolated from the standard curve and renin activity expressed as nanograms per milliliter per hour or picograms per milliliter per hour of generated angiotensin I. We used culture medium as an additional control blank in our assays. We defined a sample as having “not significant” amounts of renin activity if the concentration of angiotensin I extrapolated did not lie within the straight area of the curve. Each sample was tested in duplicate in each experiment and each experiment was carried out at least three times. Standard deviations were then calculated.
174
LAOIDE, GASTINNE, AND ROUGEON
Transcytosis experiments. Transcytosis experiments were carried out essentially as previously described for EGF transcytosis across MDCK cells [24]. The cells were grown to confluency on 0.4-mm Transwell clear (Costar) filters. Confluency was assessed by using a phenol red-free medium on one side of the filter and determining spectroscopically (absorbance at 479 nm) the transfer of phenol red from the medium on the other side of the filter [25]. A total of 200,000 cpm of 125I-labeled renin (gift from Catherine Rougeot, Institut Pasteur) was added to either the apical or the basal medium and at various time points samples were removed from the opposite medium and the cpm was measured. 125I-EGF (Amersham) was used as a positive control and [ 3H]inulin was used as a marker of passive diffusion. Transient transfections and CAT assays. Cells were transfected by the calcium phosphate coprecipitation technique. The CAT reporter plasmid carrying an ARE (androgen receptor element) was constructed by fusing a double-stranded oligonucleotide. The sequence of the sense strand is as follows: 59TCGACGTCTGGTACAGGGTGTTCTTTTTG39, which contains a consensus ARE element flanked by SalI and BamHI sites for cloning into pBLCAT5 vector (which has an HSV tk promoter, 59 and 39 polylinkers and minimized background “vector effects”) [26]. CAT activity was assayed by standard methods using [ 14C]chloramphenicol (Amersham). Unreacted chloramphenicol was separated from its acetylated derivatives by TLC and the spots were visualized by autoradiography.
RESULTS
Establishment of an SMG Fibroblast-like Cell Line, FS10, from Mice Transgenic for the SV40 Large T Antigen We wanted to have an SMG-derived cell line to study homotypic mesenchymal– epithelial interactions with our SIMS epithelial cell line. We therefore isolated fibroblast-like cells from male mice carrying the E1ASV40 T antigen construct, previously described elsewhere [16, 27, 28]. After 10 passages in culture containing 15% serum the phenotypically fibroblast-like population was tested for the expression of the T antigen (Fig. 1A) and of the intermediate filament vimentin (Fig. 1B) by indirect immunoflorescence and for expression of the scatter factor/HGF by RT-PCR (Fig. 1C). Cells positive for all three markers are routinely maintained on plastic and are designated FS10 cells. Growth and Differentiation of SIMS Cells in HDM We developed a serum-free medium to allow the growth and differentiation of SIMS cells (Fig. 2). The culture medium, DMEM/F12 (v/v) has a Ca 21 concentration of 1.05 mM which is optimal for SMG epithelial cell differentiation [29, 30]. The cells have an absolute requirement for insulin, transferrin, and selenium as well as for one of the following growth factors: EGF, KGF, or bFGF. KGF and bFGF are not as efficient in promoting growth as EGF but can be substituted following an adaptation period. T3 and testosterone (DHT or Metribolone, a stable synthetic androgen) are not required for growth and were slightly inhibitory at the
FIG. 1. Immortalization of FS10 fibroblast-like mouse SMG cell line derived from male mice transgenic for the SV40 large T antigen under the control of the E1A promoter. (A) Immunohistochemical staining using an antibody directed against the large T antigen. The nuclei of all cells are stained. (B) Immunohistochemical staining using an antibody directed against the intermediate filament, vimentin (scale 5 mm). (C) RT-PCR analysis using HGF/scatter factor specific primers. Lane 1, FS10 PCR product; lane 2, 3T3 PCR product used as a positive control of HGF expression.
concentrations used (1 mg/ml; Fig. 2). These hormones were added in differentiation medium when studying renin expression and secretion and androgen receptor expression in confluent cultures. The cells have an overall doubling time of 48 h in this defined medium. The cells grow slowly until a minimum density is reached and thereafter confluency is attained and maintained for many days on plastic, on E-C-L-coated plastic, or on filter supports. Renin Expression and Secretion in SIMS Cells Grown on Filter Supports The SIMS cell line is derived from the SMG of a 21-day-old male mouse carrying two renin genes, Ren-1
TUBULOGENESIS AND RENIN EXPRESSION IN SIMS CELLS
175
FIG. 2. Definition of a serum-free, hormonally defined medium (HDM) for the proliferation and differentiation of SIMS cells. Cells were allowed to grow for 6 days in medium (ALL 1 EGF) containing DMEM/F12 supplemented with insulin, transferrin, and selenium (ITS), prostaglandin E1, dexamethasone (Dex), thyroxine (T3), and EGF (30 ng/ml). Each component was succesively removed to determine the effect on cell growth (100% represents ALL 1 EGF medium). KGF (30ng/ml) and bFGF(20ng/ml) were not as efficient growth promoters as EGF but could be substituted after an adaptation period.
and Ren-2 [16]. The product of the Ren-2 gene, renin, is highly expressed in the mouse SMG GCT cells [31, 32] and has previously been shown to be expressed in this cell line, using RT-PCR. A heterogenous staining of the cell line, using an anti-renin antibody, was also detected [16]. Here we studied the expression and secretion of renin in polarized cells. SIMS cells were initially cultured on a porous filter support coated with E-C-L matrix (Materials and Methods) to allow the cells to orient their apical– basolateral axes. The cells form domes when confluent after 7–10 days in HDM. Immunohistochemical staining using a mouse anti-renin antibody, which specifically stains GCT cells of mouse SMG sections (Fig. 3A), demonstrates renin synthesis in SIMS cells (Fig. 3B). Using an enzyme radioimmunoassay (RIA) we then determined the amount both of
prorenin and of active renin secreted into the apical and basolateral compartments (Table 1). Prorenin precursor enzyme is found in both compartments, in the presence and in the absence of E-C-L matrix, while active renin appears to be secreted in relatively small amounts only from the apical domain. The presence of mesenchyme, homotypic (FS10) or heterotypic (human embryonic MRC-5 cells), has little or no effect on renin expression (Table 1). In vivo, the GCT cells of the male mouse SMG synthesize large amounts of renin which are released from secretory granules in both the active and the precursor forms and subsequently detected in the saliva [19, 33, 34]. However, under certain conditions (such as male aggressive behavior) SMG-specific enzyme is also found in the blood stream [reviewed 18, 32]. This sug-
176
LAOIDE, GASTINNE, AND ROUGEON
FIG. 3. Renin expression in the adult male mouse SMG (A) and in the SIMS cell line grown on filter supports. The antibody used is directed against the C-terminal peptide of the mouse Ren-2 gene product (Materials and Methods). Only the GCT cells of the SMG are labeled, as expected. (A) SIMS cells form domes at confluency and all the cells stain positive (B). Bar, 50 mm.
gests that GCT cells secrete (pro)renin from both the apical (salivary compartment) and the basolateral (circulation) domains either by a direct mechanism or by transcytosis. We tested whether SIMS cells could transcytose renin across the cell by labeling renin peptide with 125I and adding it to either the basal or the apical culture medium of confluent SIMS cells growing on permeable filter supports. Confluence was assessed spectroscopically using phenol red as an indicator (Materials and Methods). We found that renin is unable to transcytose in either direction: no radioactivity was detectable in the opposite compartment (Fig. 4) when 125 I-renin is added to either the apical or the basal compartments. In contrast, as previously demonstrated [24, 35], 125I-EGF is transcytosed in a timedependent manner in the basal–apical direction. [ 3H]Inulin was used as a control of passive diffusion across SIMS cells (data not shown). These data suggest that prorenin secretion occurs at both the apical and the basolateral surfaces of SIMS cells and that no renin is transported across the cell. Neither was any radioactivity detected in the lysed cell pellet following alkali extraction of the cells from the filter. In conclusion,
SIMS cells secrete predominantly prorenin under the conditions described and, in addition, active renin appears to be secreted exclusively from the apical domain. There is no apparent influence of the mesenchyme in these experiments. SIMS Cells Form Branching Tubular Structures and Secrete Prorenin in Coculture in Collagen Type I Gels We have previously shown that SIMS cells can remodel within collagen type I gels to form three-dimensional cysts of up to 80 mm in diameter with a central lumen surrounded by a single layer of cells [16]. In this study, we investigated, first, whether the morphogenetic behavior of SIMS cells might be influenced in coculture with mesenchymal cells, as has previously been shown for the adult female dog kidney cell line, MDCK [14, 15]; second, whether the cells would respond differently to homotypic than to heterotypic mesenchymal interactions; and third, the effect of the observed morphogenetic behavior on renin expression. Cocultures were prepared as described [14, 15, 36,
TABLE 1 Renin Secretion from SIMS Cells Grown on Filter Supports Total renin a,b
SIMS SIMS 1 FS10 SIMS 1 MRC-5
Active renin a
Total renin a,b
Apical 1 ECL
Apical 2 ECL
Apical 1 ECL
Apical 2 ECL
Basal 1 ECL
Basal 2 ECL
Total renin a,b cell pellet
670 6 110 610 6 96 450 6 60
590 6 105 700 6 110 500 6 108
310 6 95 320 6 85 NS
NS NS 325 6 76
300 6 83 530 6 70 530 6 79
240 6 60 560 6 100 400 6 80
4200 6 230 ND 3200 6 380
Note. NS, not significant; ND, not determined. a Values in pg/ml/h of angiotensin (average of three RIA experiments). b Renin activity following trypsin digestion.
TUBULOGENESIS AND RENIN EXPRESSION IN SIMS CELLS
177
FIG. 4. Renin is not transcytosed across SIMS cells. 125I-labeled renin was added either to the basal or to the apical culture medium of SIMS cells grown to confluency on filter supports (Materials and Methods). After 30 min, 1 h, 2 h, 3 h, 4 h, and 6 h the number of cpm was determined in the opposite medium. No transcytosis is observed. Transcytosis of 125I-EGF (basal to apical) was used as a positive control.
37] (Materials and Methods). Fibroblasts, either FS10 SMG-derived cells (see Fig. 1) or human embryonic lung MRC-5 cells, were first seeded within the gel, a cell-free layer was then added, and finally SIMS cells were suspended in a third layer of collagen. The gels were either fixed in six-well dishes or floated in petri dishes and the cultures allowed to grow and migrate within the gels for 2 to 3 weeks. The gel layer containing SIMS cells was then separated from the remaining gel, the cell nuclei were stained with propidium iodide (Fig. 5), cytoplasmic actin was stained with FITC-labeled phalloidin (Figs. 5C–5D), and then the threedimensional structures were analyzed by confocal microscopy. In both homotypic and heterotypic cocultures, SIMS cells form branching tubular structures: initially the cells migrate to form cyst-like structures reminiscent of SIMS alone embedded in gel; these cysts then develop cavities (Fig. 5A) and elongate (Fig. 5B) within 2 weeks of seeding. Between 2 and 3 weeks an increasingly complex network of branching structures is observed (Fig. 5C) which migrate in all directions within the gel. The size of the lumen of a single branch cord is of the order of 20 – 40 mm and it is surrounded by a monolayer of polarized cells (Fig. 5D). Semithin sections (Fig. 6) confirmed the presence of branching tubules which appear to initiate from spherical struc-
tures (Figs. 6A and 6B) and develop in tubular structures with well-defined lumina (Figs. 6C and 6D). The morphogenetic behavior of SIMS cells in homotypic (FS10) or heterotypic (MRC-5) cocultures was very similar and, indeed, more elaborate structures were observed with MRC-5 fibroblasts. This may be due to the large amounts of HGF/scatter factor secreted by this cell line which has been shown to be responsible for the morphogenetic behavior of MDCK cells in cocultures [14, 15]. We also tested whether different hormones might affect SIMS morphogenesis in collagen gels, either alone or in cocultures, and observed a slight increase in the number of branching cords and in the time of appearance of these structures in the presence of T3 and DHT or Metribolone, known to be important inducers of GCT development in vivo. The addition of Dex to the culture medium had no further visible effect (data not shown). Renin-specific immunoreactive material was detected within the tubular structure following confocal microscopy examination of the stained gel (Fig 5E). The thickness of the gel and the intrinsic properties of the collagen substratum interfere with the immunoflorescence and it is therefore difficult to detect a clear signal. We then determined whether renin is secreted
178
LAOIDE, GASTINNE, AND ROUGEON
FIG. 5. Confocal microscopy images of SIMS cells in coculture within collagen I gels demonstrating the branching morphogenesis (A–D) and renin expression (E). (A) Four images of a SIMS cyst-like structure developing into a tubular structure. The nuclei are stained with propidium iodide (PI) and the numbers represent the image postion within the structure so that number 2 represents a 4-mm image, 6 a 20-mm image, 9 a 32-mm image, and 14 a 52-mm image (40X objective). (B) As in (A) but showing a more advanced stage of tubulogenesis (63X objective). (C) Double staining of cytoplasmic actin with FITC-labeled phalloidin (green) and nuclei with PI (red) showing a network of branching structures. (D) As in (C) but showing a single branch structure with a large central lumen (40 mm) surrounded by a single layer of cells. (E) Renin expression (green) in SIMS tubular structures demonstrated using a mouse anti-renin antibody; nuclear staining with PI. Four sequential images are shown demonstrating the presence of reactive material in the lumen. The collagen interferes with the immunoflorescent signal resulting in a poor image.
TUBULOGENESIS AND RENIN EXPRESSION IN SIMS CELLS
179
FIG. 8. Renin is expressed in SIMS cells embedded in Matrigel. Confocal analysis of a 5-mm cryostat section following double staining of the nuclei with PI and of the cytoplasmic terminal differentiation marker, renin, using a mouse anti-renin antibody. SIMS cells were in coculture for 2 weeks before fixing and staining (63X objective). FIG. 9. Androgen receptor expression in SIMS cells. (A) SIMS cells grown on filters were stained by indirect immunoflorescence using human anti-AR antibody, against the N-terminal region of the receptor (Materials and Methods). The nuclei of a small number of cells are labeled. (B) Confocal analysis of SIMS cells embedded in a Matrigel coculture for 2 weeks. Cryostat section were labeled with anti-AR antibody and the nuclei were stained with PI. Four successive images are shown. Nuclei are positive for the receptor and there is also some weak cytoplasmic staining.
into the culture medium and, if so, whether it is in its active or precursor form. Significant amounts of total renin activity (10 times more than in filter experiments, Tables 1 and 2) were detected, suggesting that the branching tubular morphology, reminiscent of the in vivo structure, induces prorenin expression and secretion. No active renin was detected under these conditions.
An Extracellular Matrix and a Three-Dimensional Structure Are Sufficient for Renin Secretion from SIMS Cells The importance of an intact basement membrane in the differentiation and maintenance of epithelial cellspecific gene expression has been extensively studied [3, 38], particularly using either primary mammary
180
LAOIDE, GASTINNE, AND ROUGEON
FIG. 6. Semithin section of SIMS coculture in collagen I gels. A–D, different stages of tubulogenesis of SIMS cells. In all stages a large central lumen surrounded by a single layer of cells is present (63X objective; bar, 10 mm).
epithelial cells or mouse mammary cell lines [20, 39 – 41]. Bissell and co-workers [42, 43] have demonstrated the role of tissue phenotype and architecture in preventing apoptosis and in supporting the differentiated phenotype of the individual cell within the tissue. In this study, we were interested in determining the structural and functional properties of SIMS cells within a basement membrane support in both the presence and the absence of a mesenchymal coculture and in a hormonally defined medium (HDM, Fig. 2). SIMS cells were grown within, below, or on top of a Matrigel support and the morphogenetic behavior of the cells between 10 and 14 days after seeding was examined by light microscopy. In all cases, the cells rounded up and formed clusters both in the presence and in the absence of hormones. Thus, basement membrane alone is sufficient to allows cyst-like formation of SIMS cells (Figs. 7A and 7B). A growth factor-reduced TABLE 2 Renin Secretion from SIMS Cells Seeded within Collagen Type I Gels Total renin a,b SIMS 1 MRC-5 coculture SIMS 1 FS10 coculture
6.4 6 0.8 4.3 6 0.5
Active renin a NS NS
Note. NS, not significant. a Values in ng/ml/h of angiotensin I (average of three RIA experiments). b Renin activity following trypsin digestion.
gel also sustains cyst formation (Fig. 7A), although the initial proliferation of the cells in HDM is slower. We then grew the cells in the presence and absence of mesenchymal homotypic and heterotypic cocultures avoiding heterocellular contact by separation with a cell-free Matrigel layer. We found extensive three-dimensional formation which, after about 14 days in culture, resulted in structures which were macroscopically visible, including individual ring-like structures (Figs. 7C–7E), complex multilobed cysts (Figs. 7F and 7G), and branched tubules (Fig. 7H). Cryostat sections of the epithelial gel layer demonstrated the presence of lumen in all cases (Figs. 7I, 7J and 8). Similar cell migration and morphogenetic behavior was found using either homotypic or heterotypic fibroblast cocultures. The diversity of phenotypes observed appears to depend on the initial cell density as well as the number of days in culture. We determined renin expression by immunohistochemical staining with a mouse anti-renin antibody of cryostat sections of Matrigel cultures and found that renin is expressed and cytoplasmically located in all SIMS cells organized in a three-dimensional structure (Fig. 8). When we measured renin secretion following HDM renewal we found a time-dependent increase in both prorenin and renin secretion as measured by RIA (Table 3). Both prorenin and active renin activities were detected in culture supernatants from SIMS grown alone in Matrigel and from SIMS homotypic and heterotypic cocultures. Similarily, NGF activity, which is also a terminal differentiation marker of SMG GCT
TUBULOGENESIS AND RENIN EXPRESSION IN SIMS CELLS
181
FIG. 7. Diverse morphological structures of SIMS cells in Matrigel. (A) SIMS embedded in growth factor reduced Matrigel after 2 weeks (32X objective). (B) As in (A) but in Matrigel. (C, D) SIMS with mesenchymal coculture after 8 days in Matrigel (20X objective). (E) As in (C) but with growth factor reduced matrigel. (F–H) As in (C) but after 2 weeks in culture. (I, J) Cryostat sections (5 mm) of Matrigel cocultures demonstrating the presence of a lumen (40X objective).
cells, has also been detected by others (M. Fahnestock, personal communication) in our culture supernatants. We conclude that Matrigel creates a suitable and sufficient environment for renin expression and secretion from SIMS cells, both in its active and in its precursor forms. Androgen Receptor Expression in SIMS Cells The sexual dimorphism of the mouse SMG has been extensively documented: male mice SMGs contain a
highly developed GCT system which can occupy up to 50% of the gland in an adult mouse (see Fig. 3A). The differentiation of GCT cells from striated duct cells is under hormonal control, initially in both sexes by thyroxine, and at puberty, by androgens in males [18, 42]. Certain strains of male mice carry two renin genes, Ren-1 and Ren-2, Ren-2 being highly expressed, along with the genes encoding NGF and EGF, in the male adult gland. However, to date, no androgen-responsive cis-acting element has been characterized upstream of
182
LAOIDE, GASTINNE, AND ROUGEON
the corresponding genes and the molecular mechanism of the high level of transcription remains to be elucidated. We used either DHT or a nonmetabolizable derivative, Metribolone (Materials and Methods) as a source of androgen hormone in our HDM culture medium but were unable to demonstrate a strong induction in renin expression under a variety of environmental conditions tested (data not shown). We determined whether the androgen receptor is present in SIMS cells seeded either on filter supports or in Matrigel cocultures. Between 3–5% of SIMS cells grown for 1 week to confluency on filters stained positive for the receptor using a polyclonal anti-human androgen receptor antibody [23] (Materials and Methods). Immunoreactive material appears exclusively nuclear (Fig. 9A): it is unclear why only a small number of individual cells in a confluent monolayer are positive. SIMS cells in Matrigel cocultures with fibroblasts show a higher, more homogenous level of expression of the receptor (Fig. 9B). Staining of cryostat sections with propidium iodide and indirect immunoflorescence using the same anti-androgen receptor antibody demonstrates mainly nuclear localization of the receptor but also some staining in the cytoplasm. It has previously been demonstrated that expression of the androgen receptor in human prostate epithelial cells is induced by coculture with fibroblasts [45]. Finally, to test whether a classical ARE is recognized in a transfection assay, we constructed a vector carrying an ARE element upstream from the CAT reporter gene (Materials and Methods). A similar construct lacking the ARE was used as a negative control while the SV40 promoter-enhancer fused to CAT was used as a positive control. SIMS cells grown on plastic in the presence of androgens were transiently transfected and the results shown in Fig. 10 demonstrate that the ARE–CAT construct is activated in SIMS cells in both the presence and the absence of cotransfected vector carrying the gene encoding the androgen receptor. These data suggest that the SIMS cell line expresses the androgen receptor and can therefore activate, at TABLE 3 Renin Secretion from SIMS Cells in Matrigel
SIMS SIMS SIMS SIMS SIMS a
within Matrigel on top of Matrigel with Matrigel overlay 1 MRC-5 coculture 1 FS10 coculture
Total renin a,b
Active renin a
1.6 6 0.2 0.7 6 0.1 0.8 6 0.1 1.0 6 0.1 0.8 6 0.1
1.4 6 0.2 0.7 6 0.1 0.72 6 0.2 0.84 6 0.1 0.61 6 0.1
Values in ng/ml/h of Angiotensin I (average of three RIA experiments). b Renin activity following trypsin digestion.
FIG. 10. Transient transfection of SIMS cells and CAT assay demonstrating the expression of a CAT reporter gene fused to an androgen receptor element (ARE). Lane 1, positive control using the SV40 promoter-enhancer fused to the CAT gene; lanes 2 and 4, activation of an ARE–CAT construct in transfected SIMS cells grown in the presence of DHT and cotransfected (lane 2) or not (lane 4) with a vector carrying the AR gene; lane 3, Background control plasmid.
least to some extent, the expression of androgen-regulated genes. DISCUSSION
This report demonstrates the structural and functional relationship of an immortalized mouse epithelial cell line in homotypic and heterotypic interactions under a variety of organotypic and environmental contexts. Mouse SMG development begins during the last third of fetal life and continues until adulthood is attained. The development of the gland is characterized initially by branching morphogenesis, leading to a branching pattern which is characteristic of the SMG. Once the pattern is established cytodifferentiation of secretory cells begins although undifferentiated cells are already capable of synthesizing gland-specific secretory proteins [46]. Cutler and Gremski [13] described the role of the mesenchyme in regulating the SMG branching pattern as “instructive” in that epithelial mesenchymal interactions tend to restrict the cell’s developmental options. They suggested that the control of cytodifferentiation, on the other hand, is “permissive” in nature because epithelial mesenchymal interactions appear to modulate basic processes which are already established. Cutler [9] demonstrated that the rat SMG can cytodifferentiate in the absence of mesenchyme at 16 days pc, when early branching has commenced, but cannot differentiate before then due to the complete lack of branching. Interestingly, it appears that the commitment to cytodifferentiation of SMG cells may be necessary, however, for branching morphogenesis to progress: this is in contrast to the mouse mammary system where tissue phenotype appears to be dominant to cellular phenotype [22].
TUBULOGENESIS AND RENIN EXPRESSION IN SIMS CELLS
SMG development starts at E11 and continues postnatally. Terminal differentiation of the gland occurs in the mouse at 6 weeks and thereafter the gland is mature. The regulation of SMG cytodifferentiation by thyroid and androgenic hormones postnatally has been well documented and the sexual dimorphism, tissuespecific regulation, and probable endocrine function of the gland have been the subject of much interest for many years [47– 49]. Two studies reporting branching morphogenesis [11, 14, 15] prompted us to examine whether our mouse in vitro model, using homotypic fibroblast– epithelial interactions, would reveal similar organotypic interactions and in addition what effect such an environment would have on the expression and secretion of an SMGspecific marker, the product of the Ren-2 gene renin. Our results indicate that SIMS cells are plastic in their behavior and have the potential to express a number of morphogenetic phenotypes depending on the environmental stimulus. We found, first, that the development of polarity on filter supports allows the secretion of small amounts of mainly renin precursor from both the apical and the basolateral domains. The presence of fibroblast coculture does not induce further secretion. In contrast, when SIMS cells are seeded in collagen type I gels in coculture with homotypic or heterotypic mesenchyme, the mesenchyme induces SIMS cells to form branching tubules and to secrete a significant amount of prorenin, which, from confocal analysis, appears to be secreted into the wide lumen of the tubule. In vivo, collagen I is a vital component of SMG branching morphogenesis and, in concert with collagen III, appears to specify the branch points and, therefore, the distinct branching pattern of the gland. Thus, our in vitro model can mimic the morphogentic pattern found in vivo and induce the expression of a terminal differentiation marker, namely, renin. The morphological behavior of SIMS cells within a Matrigel basement membrane is complex. A variety of phenotypically distinct structures were observed: from relatively simple cyst-like structures when SIMS monocultures were seeded to highly organized multibranched structures in SIMS–fibroblast cocultures. Strikingly, renin expression and secretion were observed in all cell architectures. Coculture with mesenchyme does not increase renin secretion and, in addition, basement membrane alone appears to be sufficient to allow secretion of both renin precursor and of active renin. The percentage of active renin varied depending on the culture medium, the number of days in culture and the time of removal of the culture supernatant, but was always greater than 50% of the total activity and therefore much higher than the activity found under other environmental conditions. It is important in future studies to study the expres-
183
sion of other differentiation markers, in particular, EGF and NGF, to determine whether a variety of mechanisms exist, as in the case of mammary cells when b-casein is expressed in the absence of a fully polarized phenotype while WAP expression requires the presence of a highly organized three-dimensional structure [20, 39, 51]. We also want to determine the molecular nature of renin activation and to understand more fully the role of androgens in the control of cell cytodifferentiation and gene expression. We are very grateful to R. Hellio for the confocal analysis; C. Rougeot for purification of the anti-renin antibody, for preparation of the 125I-labeled renin peptide, and for many fruitful discussions; Ruth Ladenheim for generating the anti-renin antibody; J-C. Benichou for help in preparing the semithin sections; T. Reudelheuber and I. Jutras for sheep substrate; I. Mowszowicz for anti-AR antibody; Roussel Uclaf for RU1881 Metribolone; M. Fahnestock for sharing unpublished results; and M. Bissell’s laboratory for their cryostat preparation protocol. We would like to thank the following for stimulating discussions and or reading of the manuscript: C. Papanicolaou, O. Kellermann, I. Chupin, and A. Poliard. We are grateful to Laurence Boutout for secreterial assistance. B.L. also thanks Fred, Claire, Aindrias, and Jeanne for their valued contributions and especially for the night hawk discussions. Financial support came from the Institut Pasteur and the Centre National de la Recherche Scientifique (Unite´ de Recherche Associe´e CNRS 1960).
REFERENCES 1.
Nogawa, H., and Mizuno, T. (1981). Mesenchymal control over elongating and branching morphogenesis in salivary gland development. J. Embryol. Exp. Morph. 66, 209 –221.
2.
Denny, P. C., Ball,W. D., and Redman, R. S. (1997). Salivary glands: A paradigm for diversity of gland development. Crit. Rev. Oral Biol. Med. 8, 51–75.
3.
Macauley, S. P., Tarnuzzer, R. W., Schultz, G. S., Chegini, N., Oxford, G. E., and Humphreys-Beher, M. G. (1997). Extracellular-matrix gene expression during mouse submandibular development. Arch. Oral Biol. 42, 443– 454.
4.
Banerjee, S. D., Cohn, R. H., and Bernfield, M. R. (1977). The basal lamina of embryonic salivary epithelia: production by the epithelium and role in maintaining lobular morphology. J. Cell Biol. 73, 445– 463.
5.
Fitch, J. M., and Linsenmayer, T. F. (1994). Interstitial basement membrane components in development. In “Extracellular Matrix Assembly and Structure” (P. D. Yurchenco, D. E. Birk, and R. P. Mecham, Eds.), pp. 441– 462. Academic Press, San Diego.
6.
Grobstein, C. (1953). Epithelio-mesenchymal specificity in the morphogenesis of mouse submandibular rudiments in vitro. J. Exp. Zool. 124, 383– 413.
7.
Kratochwil, K. (1969). Organ specificity in mesenchymal induction demonstrated in the embryonic development of the mammary gland of the mouse. Dev. Biol. 20, 46 –71.
8.
Lawson, K. A. (1974). Mesenchyme specificity in rodent salivary gland development: the response of salivary epithelium to lung mesenchyme in vitro. J. Embryol. Exp. Morph. 32, 469 – 478.
9.
Cutler, L. S. (1980). The dependent and independent relationships between cytodifferentiation and morphogenesis in developing salivary gland secretory cells. Anat. Rec. 196, 341–348.
184 10.
LAOIDE, GASTINNE, AND ROUGEON Nogawa, H., and Takahashi, Y. (1991). Substitution for mesenchyme by basement-membrane-like substratum and epidermal growth factor in inducing branching morphogenesis of mouse salivary epithelium. Development 112, 855– 861.
11.
Takahashi, Y., and Nogawa, H. (1991). Branching morphogenesis of mouse salivary epithelium in basement membrane-like substratum separated from mesenchyme by the membrane filter. Development 111, 327–335.
12.
Cutler, L. S. (1990). The role of extracellular matrix in the morphogenesis and differentiation of salivary glands. Adv. Dent. Res. 4, 27–33.
13.
Cutler, L. S., and Gremski, W. (1991). Epithelial-mesenchymal interactions in the development of salivary glands. Crit. Rev. Oral Biol. Med. 2, 1–12.
14.
Montesano, R., Schaller, G., and Orci, L. (1991). Induction of epithelial tubular morphogenesis in vitro by fibroblast-derived soluble factors. Cell 66, 697–711.
15.
Montesano, R., Matsumoto, K., Nakamura, T., and Orci, L. (1991). Identification of a fibroblast-derived epithelial morphogen as hepatocyte growth factor. Cell 67, 901–908.
16.
Laoide, B. M., Courty, Y., Gastinne, I., Thibaut, C., Kellermann, O., and Rougeon, F. (1996). Immortalised mouse submandibular epithelial cell lines retain polarised structural and functional properties. J. Cell Sci. 109, 2789 –2800.
17.
Gresik, E. W. (1980). Postnatal developmental changes in submandibular glands of rats and mice. J. Histochem. Cytochem. 28, 860 – 870.
18.
Gresik, E. W., Hosoi, K., Kurihara, K., Maruyama, S., and Ueha, T. (1996). The rodent granular convoluted tubule cell- an update. Eur. J. Morphol. 34, 221–224.
19.
Gresik, E., and Barka, T. (1977). Immunocytochemical localization of renin in the submandibular gland of the mouse. J. Histochem. Cytochem. 25, 1027.
20.
21.
22.
Sato, Y., Mukai, K., Watanabe, S., Goto, M., and Shimosato, Y. (1986). The AMeX Method: A simplified technique of tissue processing and paraffin embedding with improved preservation of antigens for immunostaining. Am. J. Pathol. 125, 431– 435. Streuli, C. H., Schmidhauser, C., Bailey, N., Yurchenco, P., Skubitz, A. P. N., Roskelley, C., and Bissell, M. J. (1995). Laminin mediates tissue-specific gene expression in mammary epithelia. J. Cell. Biol. 129, 591– 603. Weaver, V. M., Peterseben, O. W., Wang, F., Larabell, C. A., Briand, P., Damsky, C., and Bissell, M. J. (1997). Reversion of the malignant phenotype of human breast cells in three-dimensional culture and in vivo by integrin blocking antibodies. J. Cell Biol. 137, 231–245.
23.
Chang, C., Whelan, C. T., Popovich, T. C., Kokontis, J., and Liao, S. (1989). Prostate androgen receptor: immunohistological location and mRNA characterization. J. Steroid Biochem. 34, 311–313.
24.
Bra¨ndli, A. W., Adamson, E. D., and Simons, K. (1991). Transcytosis of epidermal growth factor. J. Biol. Chem. 266, 8560 – 8566.
25.
Jovov, B., Wills, N. K., and Lewis, S. A. (1991). A spectroscopic method for assessing confluence of epithelial cell cultures. Am. J. Physiol. 261, C1196 –C1203.
26.
Boshart, M., Klu¨ppel, M., Schmidt, A., Schu¨tz, G., and Luckow, B. (1992). Reporter constructs with low background activity utilizing the cat gene. Gene 110, 129 –130.
27.
Kellermann, O., and Kelly, F. (1986). Immortalization of early embryonic cell derivatives after the transfer of the early region
of simian virus 40 into F9 teratocarcinoma cells. Differentiation 32, 74 – 81. 28.
Kelly, F., Kellermann, O., Mechali, F., Gaillard, J., and Babinet, C. (1986). Expression of simian virus 40 oncogenes in F9 embryonal carcinoma cells, in transgenic mice and in transgenic embryos. Cold Spring Harbor Symp. DNA tumor viruses: Cancer Cells 4, 363–372.
29.
Kurth, B. A., Hazen-Martin, D. J., Sens, M. A., and Sens, D. A. (1988). Ultrastructural and immunohistochemical characterization of submandibular duct cells in culture and modification of outgrowth differentiation by manipulation of calcium ion concentration. In Vitro Cell Dev. Biol. 24, 593– 600.
30.
Yang, J., Larson, L., and Nandi, S. (1982). Three-dimensional growth and morphogenesis of mouse submandibular epithelial cells in serum-free primary culture. Exp. Cell Res. 137, 481– 485.
31.
Panthier, J. J., Foote, S., Chambraud, B., Strosberg, A. D., Corvol, P., and Rougeon, F. (1982). Complete amino acid sequence and maturation of the mouse submaxillary gland renin precursor. Nature 298, 90 –92.
32.
Gresik, E. W. (1994). The granular convoluted tubule (GCT) cell of rodent submandibular glands. Micro Res. Tech. 27, 1–24.
33.
Kaiho, M., Nakamura, T., and Kumegawa, M. (1975). Morphological studies on the synthesis of secretory granules in convoluted tubules of mouse submandibular gland. Anat. Rec. 183, 405– 420.
34.
Pinkstaff, C. A. (1980). The cytology of salivary glands. Int. Rev. Cytol. 63, 141–261.
35.
Maratos-Flier, E., Kao, C. Y. Y., Verdin, E. M., and King, G. L. (1987). Receptor-mediated vectorial transcytosis of epidermal growth factor by madin-darby canine kidney cells. J. Cell Biol. 105, 1595–1601.
36.
Yang, J., Flynn, D., Larson, L., and Hamamoto, L. (1982). Growth in primary culture of mouse submandibular epithelial cells embedded in collagen gels. In vitro 18, 435– 442.
37.
Durban, E. M. (1990). Mouse submandibular salivary epithelial cell growth and differentiation in long-term culture: influence of the extracellular matrix. In Vitro Cell Dev. Biol. 26, 33– 43.
38.
Gumbiner, B. M. (1996). Cell adhesion: The molecular basis of tissue architecture and morphogenesis. Cell 84, 345–357.
39.
Schmidhauser, C., Bissell, M. J., Myers, C. A., and Casperson, G. (1990). Extracellular matrix and hormones transcriptionally regulate bovine B-casein 59 sequences in stably transfected mouse mammary cells. Proc. Natl. Acad. Sci. USA 87, 9118 – 9122.
40.
Roskelley, C. D., Desprez, P. Y., and Bissell, M. J. (1994). Extracellular matrix-dependent tissue-specific gene expression in mammary epithelial cells requires both physical and biochemical signal transduction. Proc. Natl. Acad. Sci. USA 91, 12378 –12382.
41.
Lin, C. Q., Dempsey, P. J., Coffey, R. J., and Bissell, M. J. (1995). Extracellular matrix regulates whey acidic protein gene expression by suppression of TGF-alpha in mouse mammary epithelial cells: studies in culture and in transgenic mice. J. Cell. Biol. 129, 1115–1126.
42.
Boudreau, N., Reddy, S. T., Stoker, A. W., Fairman, C., and Bissell, M. J. (1995). The embryonic environment and the extracellular matrix suppress oncogenic transformation by rous sarcoma virus in the chick embryo. Mol. Cell. Differ. 3, 261–274.
43.
Boudreau, N., Werb, Z., and Bissell, M. J. (1996). Suppression of apoptosis by basement membrane requires three-dimen-
TUBULOGENESIS AND RENIN EXPRESSION IN SIMS CELLS
44.
45.
46.
47.
sional tissue organization and withdrawal from the cell cycle. Proc. Natl. Acad. Sci. USA 93, 9309 –9313. Dunn, J. F., and Wilson, J. D. (1974). Developmental study of androgen responsiveness in the submandibular gland of the mouse. Endocrinology 96, 1571–1578. Mowszowicz, I., Berthaut, I., Cussenot, O., Carrance, A., and Mestayer, C. (1994). Androgen receptor in human prostate epithelial cells in culture requires the presence of stromal cells for optimal expression. J. Androl. 15, 40. Yamishina, S., and Barka, T. (1973). Development of endogenous peroxidase in fetal rat submandibular gland. J. Histochem. Cytochem. 21, 40 – 42. Tsutumi, O., Kurachi, H., and Oka, T. (1986). A physiological role of epidermal growth factor in male reproductive function. Science 233, 975–977.
Received August 3, 1998 Revised version received November 30, 1998
185
48.
Sheffield, L. G., and Welsch, C. (1987). Influence of the mouse salivary glands on hormone responsiveness of mouse mammary glands. Proc. Soc. Exp. Biol. Med. 186, 368 –377.
49.
Jones, D. E., Jr., Trans-Patterson, R., Cui, D. M, Davin, D., Estell, K. P., and Miller, D. M. (1995). Epidermal growth factor secreted from the salivary gland is necessary for liver regeneration. Am. J. Physiol. 268, G872–G878.
50.
Rougeot, C., Vienet, R., Cardona, A., Le Doledec, L., Grognet, J. M., and Rougeon, F. (1997). Targets for SMR1-pentapeptide suggest a link between circulating peptide and mineral transport. Am. J. Physiol. 273, R1309 –R1320.
51.
Roskelley, C. D., Srebrow, A., and Bissell, M. J. (1995). A hierarchy of ECM-mediated signalling regulates tissue-specific gene expression. Curr. Opin. Cell Biol. 7, 736 –747.