Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease

Article

Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease Highlights d

Forward genetics identifies a hypomorphic allele of Tulp3 in the mouse

d

Tulp3 loss of function causes ciliopathy-associated polycystic kidney disease

d

Tulp3 is essential for trafficking of Arl13b into cilia in kidney cells

d

Tulp3 deletion ameliorates renal cysts in a Pkd1 mouse model of ADPKD

 & Liem, 2019, Current Biology 29, 1–10 Legue March 4, 2019 ª 2019 Elsevier Ltd. https://doi.org/10.1016/j.cub.2019.01.054

Authors , Karel F. Liem, Jr. Emilie Legue

Correspondence [email protected]

In Brief  and Liem show that the cilia gene Legue Tulp3 prevents kidney cystogenesis in development and homeostasis by controlling ciliary protein transport. Loss of Tulp3 in a Pkd1 model of ADPKD ameliorates cystogenesis. Therefore, Tulp3 and its cargoes regulate a ciliadependent cyst activation signal active in ADPKD.

 and Liem, Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease, Current Biology (2019), Please cite this article in press as: Legue https://doi.org/10.1016/j.cub.2019.01.054

Current Biology

Article Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease 1 and Karel F. Liem, Jr.1,2,* Emilie Legue 1Vertebrate Developmental Biology Program, Department of Pediatrics, Yale University School of Medicine, 333 Cedar Street, New Haven, CT 06520, USA 2Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.cub.2019.01.054

SUMMARY

The primary cilium is an organelle essential for cell signaling pathways. One of the most common human genetic diseases is autosomal dominant polycystic kidney disease (ADPKD), which is caused by mutations in the PKD1 or PKD2 genes that encode Polycystin 1 and 2 (PC1/2), transmembrane proteins that translocate to the cilium. Mutations in genes that disrupt ciliogenesis also cause kidney cysts as part of a ‘‘ciliopathic’’ disease spectrum. The molecular mechanisms that link cilia function with renal cystic diseases are not well understood, and the mechanistic relationship between ADPKD and ciliopathic PKD is not known. Here we identify the gene Tubby-like protein-3 (Tulp3) as a key regulator of renal cystic disease from a forward genetic screen in the mouse. Mice homozygous for a hypomorphic missense mutation within the conserved Tubby domain of Tulp3 develop cysts at late embryonic stages, leading to severe postnatal loss of kidney function. In contrast to other ciliopathic disease models, Tulp3 mutations do not affect ciliogenesis. Instead, we demonstrate that Tulp3 is essential for the trafficking of the Joubert syndrome-associated small GTPase Arl13b into kidney cilia. We show that reduction of Pkd1 dosage promotes cystogenesis in the Tulp3 conditional ciliopathic PKD model. However, in an adult model of ADPKD utilizing inducible conditional Pkd1 deletion, concomitant removal of Tulp3 surprisingly ameliorates cystic disease. Therefore, Tulp3 controls distinct ciliary pathways that positively or negatively regulate cystogenesis depending on the cellular context. INTRODUCTION Renal cystic disease is characterized by the formation of fluidfilled cysts that compromise kidney function, leading to renal fibrosis and end-stage renal disease [1]. Autosomal dominant polycystic kidney disease (ADPKD; OMIM 173900) is one of the most common monogenic diseases, affecting
1:1,000 live births, and is caused by mutations in the genes PKD1 or

PKD2, which encode the proteins Polycystin 1 (PC1) and Polycystin 2 (PC2), respectively. PC1/2 are thought to form a receptor-channel complex that transduces a calcium signal in response to mechanical stimuli [2]. Kidney homeostasis requires PC1/2 function, and loss of PC1 or PC2 results in cyst formation. A second form of renal cystic disease arises from mutations in genes that encode proteins required for primary cilium biogenesis. Cilia are small microtubule organelles present on the surface of most cells in the body, including the kidney. Mutations in cilia genes cause a spectrum of pediatric disorders that disrupt multiple organ systems including nervous, skeletal, retinal, and reproductive systems [3, 4], collectively termed ‘‘ciliopathies.’’ Ciliopathic mutations also cause renal cystic disease (referred to here as ciliopathic PKD; cPKD), which is inherited recessively. PC1/2 cilia localization in the kidney highlights the importance of this organelle to the cystic disease process [5], but, unlike ciliopathic mutations, Pkd1/Pkd2 mutations do not disrupt cilia structure. Cilia are sensory organelles essential for signal transduction, and disruption of cilia causes developmental phenotypes including cyst formation through aberrant signaling. Although some of the molecular pathways leading to ciliopathic phenotypes have been identified, the pathways involved in renal cyst formation are not well understood. In addition, it is not known whether cysts in ADPKD and cPKD are caused by similar mechanisms. Pkd1 and Pkd2 mouse knockouts, as well as cilia gene knockouts, result in embryonic lethality. Therefore, conditional genetic approaches have been traditionally used to study ADPKD and cPKD in the mouse. Conditional deletion of multiple cilia genes causes cPKD, including Ift88 [6, 7], Ift20 [8], Kif3a [7, 9], Ift139 [10], Ift140 [11], and Arl13b [12, 13]. These genes control essential processes required for cilia biogenesis and cause severe cilia structural defects when mutated. The relationship of ADPKD and cilia is complex, as genetic studies in the mouse have identified a cilia-dependent cyst activation (CDCA) pathway that is active in the absence of PC1/2 but requires an intact cilium to function [14, 15]. The molecular nature and the ciliary components of this pathway remain elusive. In this study, we identify Tubby like protein-3 (Tulp3) as a regulator of renal cystic disease from a forward genetic screen in the mouse. Tulp3 has been characterized as an adaptor protein that traffics membrane proteins into cilia [16, 17], and we demonstrate here that Tulp3 regulates the trafficking of the small GTPase Arl13b into kidney cilia. We show that unlike other models of cPKD, mutations in Tulp3 cause cystic disease Current Biology 29, 1–10, March 4, 2019 ª 2019 Elsevier Ltd. 1

 and Liem, Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease, Current Biology (2019), Please cite this article in press as: Legue https://doi.org/10.1016/j.cub.2019.01.054

Figure 1. Identification of Tulp3K407, a Novel Allele of Tulp3 (A) Ciliopathic phenotypes in the Tulp3K407I mouse: kidney cysts. H&E with higher magnification of cortex (black box) and medulla (yellow box), and skeletal defects without polydactyly (Alcian blue, alizarin red) at E18.5. (B) Schematic representation of the lysine-to-isoleucine missense mutation at Tulp3 position 407. (C) Western blot for Tulp3 detects an
60-kDa protein in Tulp3K407I E18.5 kidneys that is absent in E10.5 Tulp3null embryos, at similar levels to WT. Loading control: anti-b-actin. See also Figure S1.

without disrupting ciliogenesis. We use inducible conditional approaches in the mouse to define the genetic relationship of Tulp3 and Pkd1. We find that Tulp3 and Pkd1 pathways converge to form cysts during the development of the kidney. However, in the absence of Pkd1, Tulp3 regulates a CDCA pathway and deletion of Tulp3 ameliorates adult-onset PKD. RESULTS A Hypomorphic Tulp3 Mutation in the Mouse Causes Ciliopathic Phenotypes We performed a three-generation forward genetic screen in the mouse using N-ethyl N-nitrosourea (ENU) [18] and identified a mouse line that developed recessive kidney cysts along with skeletal deformities and neural patterning defects (Figure 1A and data not shown). Next-generation exome sequencing identified a missense mutation that caused a lysine-to-isoleucine amino acid substitution at position 407 (K407I) of the gene Tulp3 (Figure 1B). Tulp3 was previously shown to be a ciliary trafficking gene that links G protein-coupled receptors to intraflagel2 Current Biology 29, 1–10, March 4, 2019

lar transport protein complex A (IFTA) [16, 17]. To verify that the Tulp3K407I missense was causative of the observed phenotypes, we performed a complementation test by crossing carriers of the mutation with mice heterozygous for a targeted null allele of Tulp3 (Tulp3null) and generated compound heterozygous animals. Tulp3K407I/null animals displayed renal cystic phenotypes similar to Tulp3K407I homozygous mutants (Figure S1A), demonstrating that the alleles failed to complement and that the Tulp3K407I mutation caused the observed phenotypes. Tulp3 mouse knockouts (Figure S1B) [19–21] or strong loss-offunction [22] mutants die around embryonic day 14.5 (E14.5) with severe skeletal defects including polydactyly, neural patterning defects, and edema. In contrast, homozygous Tulp3K407I mutants showed a milder phenotype, surviving up to weaning age with variable perinatal lethality and incompletely penetrant skeletal abnormalities such as rib duplications and cleft palate (Figure 1A and data not shown). The ENU-induced missense mutation lies within the C-terminal tubby domain, and K407 is a conserved residue among all tubby family members [23]. To determine whether the mutation affected Tulp3 protein levels, we generated protein extracts from Tulp3K407I mutant kidneys and performed western blot analysis using an anti-Tulp3 antibody [20]. A single
60-kDa band was detected that was absent in extracts derived from Tulp3null embryos (Figure 1C). Because Tulp3 protein levels in kidneys were not altered in the Tulp3K407I mutant compared to the wild-type (WT), the Tulp3K407I mutation did not alter protein stability. Due to the milder phenotype compared with the knockout alleles, these data show that the K407I mutation is a hypomorphic allele of Tulp3. Tulp3K407I Mutants Develop Ciliopathic Polycystic Kidney Disease Tulp3 is a cilia-associated gene, and loss-of-function alleles of Tulp3 lead to phenotypes typical of ciliopathies. The milder phenotype in Tulp3K407I mutants allowed us to uncover a novel role for Tulp3 in the kidney, which we sought to characterize in more detail. Analysis of Tulp3K407I mutant mice at postnatal day 14 (P14) revealed grossly enlarged kidneys and cysts in histological sections stained with H&E (Figures 2A and 2B). We tested whether specific nephron segments were cystic by staining for Lotus tetragonolobus lectin (LTL) and Dolichos biflorus agglutinin (DBA) to identify proximal tubules and collecting ducts, respectively. We found that both cell types lined cysts in the Tulp3K407I mutants at P14 (Figures 2C and 2D). We quantified the cystic phenotype by calculating the kidney-to-body weight ratio (KW:BW) and cystic index (% of cystic area in total kidney area on section), and assessed kidney physiological function by measuring the concentrations of blood urea nitrogen (BUN) and creatinine in sera. The KW:BW, cystic index, and BUN and creatinine levels were all significantly increased in Tulp3K407I mutants compared with controls (Figures 2E–2H). Therefore, loss of Tulp3 function leads to enlarged kidneys due to renal cysts with functional impairment, characteristic of polycystic kidney disease (PKD). We next characterized earlier stages of cyst development in Tulp3K407I mutants. We had found that renal cysts were apparent histologically in Tulp3K407I mutant kidneys at E18.5 (Figure 1A). We found a significant increase in cystic index in Tulp3K407I mutants compared to WT at E18.5 (Figure 3A). In contrast, we did

 and Liem, Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease, Current Biology (2019), Please cite this article in press as: Legue https://doi.org/10.1016/j.cub.2019.01.054

Figure 2. Tulp3K407I Mutants Develop Kidney Cysts (A and B) Whole-mount kidneys (A) and kidney sections (B) (H&E) of control and Tulp3K407I mutant P14 mice. (C and D) LTL (proximal tubules; green) and DBA (collecting ducts; red) staining in P14 control (C) and Tulp3K407I mutant (D) kidney sections. (E–H) Quantification of the cystic kidney phenotype at P14: KW:BW (E), cystic index (F), and BUN (G) and creatinine (H) concentrations all show a significant increase in Tulp3K407I mutants compared to controls. t test, ****p < 0.0001, **p = 0.0095. Mean ± SEM are shown.

not detect significant cyst formation in E15.5 Tulp3K407I mutant kidneys (Figure S2). We tested whether the loss of function of Tulp3 affected specific segments of the nephron. We found that in contrast with Tulp3K407I kidneys at P14, in which both proximal tubules and collecting ducts formed cysts, cysts were lined with LTL-positive cells, indicating that proximal tubules were affected, whereas the collecting ducts marked with DBA appeared anatomically similar to WT at E18.5 (Figure 3B). This suggested that cysts first form in proximal tubules in Tulp3K407I mutants. Because cyst formation has been linked to higher levels of cell proliferation, we assessed proliferation levels in proximal tubules and collecting ducts of the Tulp3K407I mutant compared to WT. We used Ki67 as a marker of cycling cells in combination with LTL or DBA in E18.5 kidneys (Figure S3). Consistent with the enlargement of proximal tubules, we found a significant increase in the percentage of Ki67 cells in LTL cells in Tulp3K407I mutants compared to controls (Figure 3C). We did not detect an increase in the percentage of Ki67 cells in DBA cells, consistent with the absence of collecting duct dilation (Figure 3D). These data show that the Tulp3K407I mutation led to the early formation of renal cysts during late embryogenesis, beginning in the proximal tubules, and that higher levels of proliferation were associated with cyst formation. Tulp3 Is Not Required for Ciliogenesis but Is Required for Ciliary Arl13b Trafficking Tulp3 has been shown to be required for the transport of a subset of membrane proteins into the cilium in vitro [16, 17]; however, its role in kidney cilia has not been analyzed in vivo. We first determined whether Tulp3K407I mutation affected ciliogenesis in the kidney, as deletion of other cPKD genes caused severe ciliary defects or disorganization of kidney cilia. We performed scanning electron microscopy on P0 kidneys of Tulp3K407I mutants and WT controls. Although the apical surfaces of the epithelial cells lining cysts were flattened due to the cystic process, we found that the Tulp3K407I mutant kidney cells each possessed a single, grossly normal cilium that was not bulbous or kinked (Figure 4A). Immunostaining using the cilia marker acetylated a-tubulin showed the presence of cilia in kidney cells in the Tulp3K407I mutant similar to WT controls (Figures 4B–4D, right). Therefore, cilia morphology was not affected in kidney cells of Tulp3K407I mutants, consistent with previous reports in the embryo [22] or cultured cells [17].

We next tested ciliary membrane-associated proteins and their ability to translocate into Tulp3K407I mutant kidney cilia in vivo. We analyzed the ciliary marker ACIII and found strong staining in cilia of E18.5 Tulp3K407I mutant kidney similar to controls (Figure 4B), consistent with results in cultured cells [16]. We tested whether PC2 was transported normally to kidney cilia in Tulp3K407I mutants. PC2 is required for kidney homeostasis, and previous studies reported defects in PC2 trafficking in Tulp3 null cells in vitro [17]. We found that PC2 was transported into kidney cilia in Tulp3K407I mutants; however, ciliary levels of PC2 were reduced by 30%, without a change in total PC2 levels in the kidney (Figures 4C and S4). Finally, we tested ciliary localization of the small GTPase Arl13b. Strikingly, we found a severe reduction in Arl13b levels in kidney cilia of Tulp3K407I mutants compared to controls (Figure 4D). We determined whether Arl13b levels were diminished as a consequence of the cystic phenotype and analyzed kidney cilia at E15.5, prior to cyst formation. Tulp3K407I mutants also showed reduced Arl13b ciliary levels at E15.5 compared to controls (Figure S2), indicating that the reduced levels of Arl13b in kidney cilia preceded cystogenesis. To test whether overall levels of Arl13b were reduced, we collected protein extracts of mutant and control kidneys and performed a western blot. We identified an
63-kDa protein Arl13b-specific band in WT protein extracts that was absent in control Arl13b knockout tissue [13]. P0 Tulp3K407I mutant kidneys had similar Arl13b protein levels as WT (Figure S4), suggesting that the reduction in Arl13b in kidney cilia was not due to a reduction in overall Arl13b levels but to a ciliary trafficking defect. In sum, the Tulp3K407I mutation did not affect cilia number, organization, or structure but regulated the levels of Arl13b, and to a lesser extent PC2, in kidney cilia. Tulp3 Is Required for Kidney Homeostasis in the Adult To determine whether Tulp3 function was required for kidney homeostasis, we employed an inducible conditional approach to delete Tulp3 in the adult. We utilized the Pax8rtTA/tetO-cre system [24] that targets kidney epithelial cells in conjunction with a floxed Tulp3 allele (Tulp3fl). Deletion was controlled by doxycycline (Dox) administration to induce Cre transcription and subsequent recombination and deletion of Tulp3. Animals were treated with Dox at P28 for 2 weeks and analyzed at 41–42 weeks of age. Kidney sections of Tulp3 conditional knockout (cKO; Pax8rtTA; tetO-cre; Tulp3fl/fl animals) displayed clearly cystic zones and Current Biology 29, 1–10, March 4, 2019 3

 and Liem, Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease, Current Biology (2019), Please cite this article in press as: Legue https://doi.org/10.1016/j.cub.2019.01.054

Figure 3. Kidney Cysts in Tulp3K407I Mutants Are Associated with Increased Proliferation (A) Cystic index of control and Tulp3K407I kidneys at E18.5. t test, *p = 0.0128. (B) LTL (proximal tubules; green) and DBA (collecting ducts; red) staining in E18.5 control and Tulp3K407I kidney sections. (C) The number of Ki67 cells is significantly increased in the LTL (proximal tubule) cells of the Tulp3K407I mutants relative to controls at E18.5. t test, *p = 0.0149. (D) Ki67 proliferating cells are not significantly increased in Tulp3K407I DBA cells (collecting ducts) compared to controls at E18.5. t test, p = 0.2223. Mean ± SEM are shown. See also Figures S2 and S3.

dilated tubules (Figure 5A), and the cystic index was significantly increased in the cKO mutants compared to controls (animals lacking either the rtTA or Cre allele) (Figure 5C). The phenotype was relatively mild, as KW:BW was increased but not significantly due to variability between animals, and kidney function measured by BUN concentration was not significantly affected (Figures 5B and 5D). These results indicated that Tulp3 function is required both during development and later in the adult for kidney homeostasis. The relatively slow developing cysts that arose after adult deletion were consistent with findings reported in other mouse models of cPKD [7] and ADPKD [25]. Pkd1 Dosage Influences the Severity of Cysts in Tulp3 Mutants The mechanistic relationship between cPKD and ADPKD genes is not well understood, and it is unknown whether cysts form in cPKD due to the loss of PC1 function in the disrupted cilia. Because Tulp3 causes cysts without disrupting cilia structure, we performed a genetic analysis to test the effects of reducing PC1 levels in Tulp3 mutants. We reasoned that if the absence of Tulp3 resulted in reduced trafficking of PC1 into the cilium, as suggested by analyses in vitro [17], further reduction of PC1 levels by removal of one copy of Pkd1 would worsen the cystic phenotype of the Tulp3 cKO. We used the Pax8rtTA; tetO-cre system with Tulp3fl and a floxed allele of Pkd1 (Pkd1fl) and used animals that did not carry the Cre or rtTA alleles as controls. We first examined the phenotype in a developmental model and administered Dox at P0 and analyzed kidneys at P14. Tulp3 cKO (Pax8rtTA; tetO-cre; Tulp3fl/fl) animals displayed a modest kidney phenotype with no significant increase in KW:BW, cystic index, or BUN concentration compared to controls (Figure 6). Histological sections revealed a mild phenotype with tubule dilations and the presence of a few cysts. Interestingly, deletion of a single copy of Pkd1 in Tulp3 cKO (Pax8rtTA; tetO-cre; Tulp3fl/fl; Pkd1fl/+ or Tulp3 Pkd1het cKO) animals displayed a more severe cystic phenotype compared to Tulp3 cKO animals. They had a significantly elevated KW:BW compared to the control and the Tulp3 cKO animals (Figure 6E). In contrast to Tulp3 cKO animals, the cystic index and BUN concentration of Tulp3 Pkd1het cKO animals were significantly elevated compared to controls (Figures 6F and 6G), indicating a loss of kidney physiological function not observed in Tulp3 cKO animals. Moreover, they displayed more numerous and larger cysts than Tulp3 cKO animals (Figures 6B and 6C). Pax8rtTA; tetO-cre; Pkd1fl/+ animals did not 4 Current Biology 29, 1–10, March 4, 2019

develop cysts and were comparable in histology to controls, showing that removal of a single copy of Pkd1 alone did not lead to cyst formation. Therefore, the severity of the Tulp3induced cystic phenotype is affected by the dosage of Pkd1, suggesting a genetic interaction between Tulp3 and Pkd1 or an additive effect of each mutation converging on cystic phenotypes. We next tested whether the removal of a single copy of Pkd1 worsened the phenotype of Tulp3 cKO animals in the adult model of gene deletion (Dox at P28 for 2 weeks) and analyzed the kidney phenotype at 18 weeks of age [14]. As expected, the Tulp3 cKO animals did not show a cystic phenotype at this stage (Figure S5). The Tulp3 Pkd1het cKO animals displayed a modest but significant elevation in KW:BW compared to controls, but no significant difference in cystic index or BUN concentration (Figure S5). Histological analysis showed the presence of larger tubule dilations in the Tulp3 Pkd1het cKO animals than in Tulp3 cKO animals and control animals (Figures S5A–S5C). These results show the presence of a mild phenotype in the Tulp3 Pkd1het cKO animals, consistent with a worsening of the phenotype of Tulp3 cKO animals when Pkd1 dosage was reduced. In sum, the removal of a single copy of Pkd1 in Tulp3 mutant kidneys exacerbated the cystic phenotype, showing levels of PC1 influenced the cystic phenotype in Tulp3 animals. Tulp3 Deletion Does Not Alter the Pkd1 Phenotype in a Developmental Cystic Model We next determined whether Tulp3 levels can affect cystic disease in Pkd1 mutants. We first analyzed cystogenesis in the developmental context and generated animals in which both Pkd1 and Tulp3 were conditionally deleted in kidney epithelial cells (Tulp3 Pkd1 double cKO). Dox was administered at P0 and kidneys were analyzed at P14. These animals showed a severe cystic phenotype, with significantly increased KW:BW, cystic index, and BUN concentration compared to control animals (Figure S6). This phenotype was similar to that of Pkd1 cKO and Tulp3het Pkd1 cKO animals, and much more severe than that of the Tulp3 cKO and Tulp3 Pkd1het cKO animals (compare Figures 6 and S6), indicating that the cystic phenotype resulting from Pkd1 deletion was not influenced significantly by Tulp3 levels in a developmental model of PKD. The finding that the Tulp3 Pkd1 double cKO cystic phenotype was much more severe than the Tulp3 cKO also indicated that PC1 retains function in kidney epithelial cells in the absence of Tulp3.

 and Liem, Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease, Current Biology (2019), Please cite this article in press as: Legue https://doi.org/10.1016/j.cub.2019.01.054

Figure 4. Tulp3K407I Affects Ciliary Arl13b Levels, but Not Ciliary Morphology (A) Scanning electron microscopy of control and Tulp3K407I P0 kidneys. (B–D) Adenylate cyclase III (ACIII; green) (B), PC2 (green) (C), and Arl13b (green) (D) staining in kidney cilia of control and Tulp3K407I mutant E18.5 mice. Acetylated a-tubulin (red) stains for cilia. See also Figures S2 and S4.

Current Biology 29, 1–10, March 4, 2019 5

 and Liem, Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease, Current Biology (2019), Please cite this article in press as: Legue https://doi.org/10.1016/j.cub.2019.01.054

Figure 5. Adult Tulp3 Conditional KO in Kidney Epithelium Leads to Cysts Tulp3 conditional deletion induced by Dox administration from P28 to P42 and analysis at 42 weeks of age. (A) H&E staining of sections of control (Tulp3fl/fl) and Tulp3 cKO (Pax8-rtTA; tetO-cre; Tulp3fl/fl) kidneys. (B) Kidney-to-body weight ratio (t test, p = 0.0644). n.s., not significant. (C and D) Cystic index (t test, **p = 0.0013) (C) and BUN (t test, p = 0.2669) (D) of controls and Tulp3 cKO animals. Mean ± SEM are shown.

Tulp3 Deletion Ameliorates the Pkd1 Phenotype in Adult-Onset Disease Finally, we determined whether Tulp3 levels affected the cystic phenotypes of Pkd1 in the adult context. We again used the inducible Pax8rtTA; tetO-cre system (Dox administered at P28 for 2 weeks and analysis at 18 weeks) to induce deletion of Pkd1 alone or in combination with heterozygous or homozygous deletion of Tulp3, and used animals that did not carry rtTA or Cre as controls. Paradoxically, we found that deletion of Tulp3 led to a striking amelioration of the cystic phenotype (Figure 7A). KW:BW, cystic index, and BUN concentration in double cKO animals were significantly reduced compared to those of the Pkd1 cKO animals, and were not statistically different from those of non-cystic control animals (Figures 7B–7D). Moreover, we found that Tulp3het Pkd1 cKO animals displayed an intermediate phenotype between the Pkd1 cKO and Pkd1 Tulp3 double cKO animals. Their KW:BW and cystic index were lower than that of Pkd1 cKO animals but higher than that of the double cKO, and their BUN levels were significantly reduced compared to that of the Pkd1 cKO animals (Figure 7D). Analysis of Tulp3; Pkd1 double knockout (dKO) kidneys showed that cilia were present but did not contain Arl13b, whereas Pkd1 cKO and WT kidney cilia contained Arl13b (Figure S7). Taken together, these studies indicated that unlike developmental Tulp3 deletion,

reduction in Tulp3 levels alleviated the cystic phenotype in an adult model of ADPKD in a dosage-dependent manner. DISCUSSION A Hypomorphic Allele of Tulp3 We identified Tulp3 as a new gene associated with cPKD from an unbiased genetic screen in the mouse. The ENU-induced Tulp3 K407I mutation behaved recessively with respect to kidney and skeletal phenotypes and acted similar to the null allele in the complementation test. These data argue against the possibility that Tulp3K407I was a gain-of-function allele. Rather, because the phenotype of the Tulp3K407I mutants is less severe than the Tulp3 KO, the Tulp3K407I allele most likely partially abrogates the tubby domain function, resulting in hypomorphic behavior. The Tulp3 K407I missense mutation disrupts a conserved lysine in the tubby domain, and K407 is common to all vertebrate tubby family proteins, as well as tubby homologs in Arabidopsis, Drosophila, and C. elegans [23]. The tubby domain has been shown to mediate interactions with membrane inositol phosphates, and plays an essential role in the association of Tulp3 with specific ciliary membrane-associated proteins for transport into the cilium [16]. Because the Tulp3 K407I mutant protein is expressed, we hypothesized that it enters the cilium via its Figure 6. Developmental Deletion of a Single Copy of Pkd1 Exacerbates the Tulp3 cKO Phenotype Dox administration at P0–P14 with analysis at P14. White: controls (animals that did not carry Cre or Pax8rtTA); blue: Pax8rtTA; tetO-cre; Tulp3fl/fl; green: Pax8rtTA; tetO-cre; Tulp3fl/fl; Pkd1fl/+; magenta: Pax8rtTA; tetO-cre; Pkd1fl/+. (A–D) H&E staining of P14 kidney sections of the indicated genotypes: control (A), Tulp3fl/fl (B), Tulp3fl/fl; Pkd1fl/+ (C), and Pkd1fl/+ (D). (E) Kidney-to-body weight ratios (****p < 0.0001, *p = 0.0152). (F) Cystic index (****p < 0.0001). (G) BUN (****p < 0.0001, **p = 0.0026). Mean ± SEM are shown. Statistical differences were calculated using one-way ANOVA followed by Tukey for multiple comparisons; comparisons showing statistical difference (p < 0.05) are shown. See also Figure S5.

6 Current Biology 29, 1–10, March 4, 2019

 and Liem, Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease, Current Biology (2019), Please cite this article in press as: Legue https://doi.org/10.1016/j.cub.2019.01.054

Figure 7. Adult Deletion of Tulp3 Ameliorates the Cystic Phenotype of Pkd1 cKO Dox administration at P28–P14 with analysis at 18 weeks. White: controls (animals that did not carry Cre or Pax8rtTA); yellow: Pax8rtTA; tetO-cre; Pkd1fl/fl; orange: Pax8rtTA; tetO-cre; Pkd1fl/fl; Tulp3fl/+; red: Pax8rtTA; tetO-cre; Pkd1fl/fl; Tulp3fl/fl. (A) H&E staining of 18-week kidney sections of the indicated genotypes. (B) Kidney-to-body weight ratios (Tulp3fl/+; Pkd1fl/fl versus control, **p = 0.0028; Pkd1fl/fl versus control, ***p = 0.0002; Tulp3fl/+; Pkd1fl/fl versus Tulp3fl/fl; Pkd1fl/fl, *p = 0.0319; Pkd1fl/fl versus Tulp3fl/fl; Pkd1fl/fl, **p = 0.0012). (C) Cystic index (Pkd1fl/fl versus control, ***p = 0.003; Tulp3fl/+; Pkd1fl/fl versus control, **p = 0.0051; Pkd1fl/fl versus Tulp3fl/fl; Pkd1fl/fl, ***p = 0.0004; Tulp3fl/+; Pkd1fl/fl versus Tulp3fl/fl; Pkd1fl/fl, **p = 0.009). (D) BUN (Pkd1fl/fl versus control, ***p = 0.0003; Pkd1fl/fl versus Tulp3fl/fl; Pkd1fl/fl, ***p = 0.0007; Pkd1fl/fl versus Tulp3fl/+; Pkd1fl/fl, *p = 0.0117). Mean ± SEM are shown. Statistical differences were calculated using one-way ANOVA followed by Tukey for multiple comparisons; comparisons showing statistical difference (p < 0.05) are shown. See also Figures S6 and S7.

N-terminal IFTA domain but is deficient in transporting membrane-associated proteins into the cilium, including Arl13b. The mutation of another conserved lysine within the tubby domain has been shown to abrogate Tulp3 association with phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) [16, 23], which is key for its trafficking function [16]. Interestingly, based on the tubby domain structure, K407 resides at the periphery of the domain and not in the PIP2 binding pocket [23]. Structure/function assays would shed light on K407 biochemical roles in binding Tulp3 cargoes. Interestingly, sequencing studies have identified a recessive mutation affecting the homologous lysine in the related gene Tulp1 in a ciliopathy patient with retinitis pigmentosa [26]. These findings suggest that K407 is a critical residue for tubby domain function in cargo binding. cPKD versus ADPKD The relationship between ADPKD and cPKD is not well understood. Genetic analysis in mice using conditional approaches has been complicated by the inability to separate the effects of

PC1/2 deletion from mutations that delete the cilium. Here we identify a new model of cPKD that offers the opportunity to test the genetic relationship between Pkd1 and cPKD in the context of an intact cilium. Tulp3 deletion in renal epithelial cells in vivo caused cysts that were sensitive to Pkd1 dosage, as deletion of a single copy of Pkd1 worsened Tulp3-associated cystogenesis in both developmental and adult models. These results suggest that the molecular pathways affected by Tulp3 and Pkd1 to form cysts are convergent due to a genetic interaction or, alternatively, are separate and have additive effects to cause cysts. Mutations in Pkd1 behave in a dosage-dependent manner to cause cystic disease in patients and mice [27–29]. PC1 and PC2 localize and function in the kidney cilium [30], and their trafficking to the cilium is thought to be interdependent [30–32]. As a ciliary trafficking protein, Tulp3 could affect PC1/2 transport to the cilium, thereby altering their function. Supporting this idea, Tulp3 knockdown in mIMCD-K2 cells was shown to reduce translocation of endogenous PC2 and transfected hemagglutinin (HA)-tagged PC1 proteins to the cilium [17]. Furthermore, PC2 levels in kidney cilia were mildly reduced in Tulp3K407I mutants. Our genetic data are consistent with the model that in Tulp3 mutants, PC1/2 ciliary levels are reduced, which may contribute to cystogenesis. In Tulp3 cKOs, removal of a single copy of Pkd1 could reduce PC1 levels and enhance the cystic phenotype. However, we found that Tulp3 deletion in the kidney results in a milder phenotype than Pkd1 deletion. This suggests that transport of PC1/2 into Tulp3 mutant kidney cilia is only partially Current Biology 29, 1–10, March 4, 2019 7

 and Liem, Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease, Current Biology (2019), Please cite this article in press as: Legue https://doi.org/10.1016/j.cub.2019.01.054

abrogated or, alternatively, that PC1/2 might have non-ciliary roles in regulating cystic pathways. Tulp3 mutations affect the transport of several proteins into the cilium, including multiple GPCRs [16, 17]. Here we show that Arl13b, a small GTPase associated with Joubert syndrome, depends on Tulp3 for ciliary trafficking. A strong reduction in Arl13b levels in renal cilia accompanied by cyst formation is also observed in other Tulp3 cKO mice (see the accompanying paper by Hwang et al. [33]). Arl13b has been shown to be a guanine nucleotide exchange factor (GEF) for the small G protein Arl3 [34], which is involved in the ciliary trafficking of lipidated cargo proteins. Additionally, conditional deletion of Arl13b in kidney epithelial cells has been shown to disrupt ciliogenesis and cause cysts [12, 13]. Because cilia are not disrupted in Tulp3 mutants, the data indicate that ciliary localization of Arl13b is not required for cilia biogenesis or that the low levels of Arl13b that remain in Tulp3 mutant cilia are sufficient to build and maintain the cilium. Tulp3 loss of function could therefore regulate cyst formation by altering pathways controlled by ciliary Arl13b.

does not appear to transport Smoothened (Smo), the GPCR that activates the Hh pathway, to cilia [16], indicating that defective Smo trafficking is unlikely to underlie the signaling pathways altered in the kidney upon Tulp3 deletion. ADPKD is a highly prevalent disease with a variable presentation. The factors contributing to the variable onset are not well understood, and modifier genes may play a role. In our studies, Pkd1 mutant mice missing a single or both copies of Tulp3 have a milder disease than mice mutant for Pkd1 alone in the adult model system. Depending on the context, absence of Tulp3 can act as a pro-cystic factor (in the presence of Pkd1) or an anti-cystic factor (in the absence of Pkd1). Deciphering the pathways controlled by Tulp3 through transcriptional profiling may therefore be critical not only for understanding the mechanism of the pediatric disease cPKD but also for understanding the CDCA pathway in the more common ADPKD. Tulp3, or pathways controlled by Tulp3, may therefore provide critical targets for therapeutic intervention to ameliorate the progression of ADPKD. STAR+METHODS

Regulation of a Cilia-Dependent Cyst Activation Pathway by Tulp3 Whereas the molecular pathways affected by Tulp3 and Pkd1 deletion appear to favor cyst formation during kidney development, Tulp3 controls an additional pathway that regulates cysts in the absence of Pkd1 in the adult kidney. Remarkably, in this case, deletion of Tulp3 is protective against cysts caused by Pkd1 deletion. Recent work by Somlo and colleagues has shown an unexpectedly complex relationship between cilia and ADPKD, as deletion of Pkd1 concomitant with genes required for cilia formation (IFT20 or Kif3a) led to an amelioration of the Pkd1-dependent cystic phenotype [14]. This led to the hypothesis that in the absence of PC1, a CDCA signal drives cyst formation [15]. Additionally, pharmacological ablation of cilia can ameliorate the cystic phenotype in mouse models of ADPKD [35]. In this study, we found that concomitant Tulp3 deletion ameliorated the Pkd1 cystic phenotype in the adult. Moreover, deletion of a single copy of Tulp3 also ameliorated the Pkd1 cystic phenotype, to a lesser degree, indicating that the pathway is sensitive to Tulp3 dosage. We hypothesize that the CDCA signal that is suppressed by cilia ablation is dependent on Tulp3 function. The pathway that mediates CDCA is currently unknown [15]. However, the identification of Tulp3 as a regulator of this pathway provides information about its nature. Because Tulp3 deletion does not affect ciliary structure, ablation of cilia and disruption of the multiple molecular pathways that signal through cilia [3] are not necessary to suppress CDCA. Tulp3 is a ciliary adaptor protein that transports a subset of membrane-associated proteins into cilia [16]. It is likely that the CDCA signal is controlled by proteins trafficked by Tulp3 into the cilium (Figures S7B–S7E). The signaling pathways regulated by Tulp3 in the kidney are not well characterized. In the mouse embryo, deletion of Tulp3 causes upregulation of the Sonic Hedgehog (Shh) pathway in the neural tube in a Gli-dependent manner and causes skeletal defects consistent with Shh pathway dysregulation [19–22]. In addition, it has been postulated that activation of the Shh pathway is associated with ADPKD [10, 36]. However, Tulp3 8 Current Biology 29, 1–10, March 4, 2019

Detailed methods are provided in the online version of this paper and include the following: d d d

d

d

KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING EXPERIMENTAL MODEL AND SUBJECT DETAILS B Mouse lines B Cell lines METHOD DETAILS B Conditional deletion of genes B Cloning the Tulp3 K407I mutation B Histology and fluorescent staining B Skeletal staining B Quantification of the kidney phenotype B Quantification of proliferation B Scanning Electron Microscopy (SEM) B Quantification of PC2 ciliary levels B Western Blot Analysis QUANTIFICATION AND STATISTICAL ANALYSIS

SUPPLEMENTAL INFORMATION Supplemental Information includes seven figures and can be found with this article online at https://doi.org/10.1016/j.cub.2019.01.054. ACKNOWLEDGMENTS We thank S. Mukhopadhyay for discussions and sharing data prior to publication. We thank S. Somlo, M. Ma, J. Eggenschwiler, and Z. Sun for mice and reagents. We thank N. Lampen for help with scanning electron microscopy. We thank A.R. Gallagher, S. Somlo, M. Caplan, and the Weatherbee lab for helpful discussions, and A.R. Gallagher and S. Mukhopadhyay for comments on the paper. K.F.L. thanks K.V. Anderson (R01NS044385) for generous early support with this project. We thank L. Diggs and the Yale O’Brien Kidney Center for performing mouse serum measurements (P30 DK079310). K.F.L. was supported by a Yale PKD Center pilot grant (P30 DK090744), PKD Research Foundation grants 199G14 and 232G18, and a Norman Siegel Research Scholar Grant from the American Society of Nephrology Foundation for Kidney Research.

 and Liem, Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease, Current Biology (2019), Please cite this article in press as: Legue https://doi.org/10.1016/j.cub.2019.01.054

AUTHOR CONTRIBUTIONS Conceptualization, K.F.L.; Methodology, E.L. and K.F.L.; Investigation, E.L. and K.F.L.; Writing, E.L. and K.F.L.; Visualization, E.L.; Supervision, K.F.L.; Project Administration, K.F.L.; Funding Acquisition, E.L. and K.F.L. DECLARATION OF INTERESTS The authors declare no competing interests. Received: June 18, 2018 Revised: November 12, 2018 Accepted: January 21, 2019 Published: February 21, 2019 REFERENCES 1. Grantham, J.J., Mulamalla, S., and Swenson-Fields, K.I. (2011). Why kidneys fail in autosomal dominant polycystic kidney disease. Nat. Rev. Nephrol. 7, 556–566. 2. Nauli, S.M., Alenghat, F.J., Luo, Y., Williams, E., Vassilev, P., Li, X., Elia, A.E., Lu, W., Brown, E.M., Quinn, S.J., et al. (2003). Polycystins 1 and 2 mediate mechanosensation in the primary cilium of kidney cells. Nat. Genet. 33, 129–137. 3. Goetz, S.C., and Anderson, K.V. (2010). The primary cilium: a signalling centre during vertebrate development. Nat. Rev. Genet. 11, 331–344. 4. Hildebrandt, F., Benzing, T., and Katsanis, N. (2011). Ciliopathies. N. Engl. J. Med. 364, 1533–1543. 5. Yoder, B.K., Hou, X., and Guay-Woodford, L.M. (2002). The polycystic kidney disease proteins, polycystin-1, polycystin-2, polaris, and cystin, are co-localized in renal cilia. J. Am. Soc. Nephrol. 13, 2508–2516. 6. Lehman, J.M., Michaud, E.J., Schoeb, T.R., Aydin-Son, Y., Miller, M., and Yoder, B.K. (2008). The Oak Ridge polycystic kidney mouse: modeling ciliopathies of mice and men. Dev. Dyn. 237, 1960–1971. 7. Davenport, J.R., Watts, A.J., Roper, V.C., Croyle, M.J., van Groen, T., Wyss, J.M., Nagy, T.R., Kesterson, R.A., and Yoder, B.K. (2007). Disruption of intraflagellar transport in adult mice leads to obesity and slow-onset cystic kidney disease. Curr. Biol. 17, 1586–1594. 8. Jonassen, J.A., San Agustin, J., Follit, J.A., and Pazour, G.J. (2008). Deletion of IFT20 in the mouse kidney causes misorientation of the mitotic spindle and cystic kidney disease. J. Cell Biol. 183, 377–384. 9. Lin, F., Hiesberger, T., Cordes, K., Sinclair, A.M., Goldstein, L.S., Somlo, S., and Igarashi, P. (2003). Kidney-specific inactivation of the KIF3A subunit of kinesin-II inhibits renal ciliogenesis and produces polycystic kidney disease. Proc. Natl. Acad. Sci. USA 100, 5286–5291. 10. Tran, P.V., Talbott, G.C., Turbe-Doan, A., Jacobs, D.T., Schonfeld, M.P., Silva, L.M., Chatterjee, A., Prysak, M., Allard, B.A., and Beier, D.R. (2014). Downregulating hedgehog signaling reduces renal cystogenic potential of mouse models. J. Am. Soc. Nephrol. 25, 2201–2212. 11. Jonassen, J.A., SanAgustin, J., Baker, S.P., and Pazour, G.J. (2012). Disruption of IFT complex A causes cystic kidneys without mitotic spindle misorientation. J. Am. Soc. Nephrol. 23, 641–651. 12. Seixas, C., Choi, S.Y., Polgar, N., Umberger, N.L., East, M.P., Zuo, X., Moreiras, H., Ghossoub, R., Benmerah, A., Kahn, R.A., et al. (2016). Arl13b and the exocyst interact synergistically in ciliogenesis. Mol. Biol. Cell 27, 308–320. 13. Li, Y., Tian, X., Ma, M., Jerman, S., Kong, S., Somlo, S., and Sun, Z. (2016). Deletion of ADP ribosylation factor-like GTPase 13B leads to kidney cysts. J. Am. Soc. Nephrol. 27, 3628–3638. 14. Ma, M., Tian, X., Igarashi, P., Pazour, G.J., and Somlo, S. (2013). Loss of cilia suppresses cyst growth in genetic models of autosomal dominant polycystic kidney disease. Nat. Genet. 45, 1004–1012. 15. Ma, M., Gallagher, A.R., and Somlo, S. (2017). Ciliary mechanisms of cyst formation in polycystic kidney disease. Cold Spring Harb. Perspect. Biol. 9, a028209.

16. Mukhopadhyay, S., Wen, X., Chih, B., Nelson, C.D., Lane, W.S., Scales, S.J., and Jackson, P.K. (2010). TULP3 bridges the IFT-A complex and membrane phosphoinositides to promote trafficking of G protein-coupled receptors into primary cilia. Genes Dev. 24, 2180–2193. 17. Badgandi, H.B., Hwang, S.H., Shimada, I.S., Loriot, E., and Mukhopadhyay, S. (2017). Tubby family proteins are adapters for ciliary trafficking of integral membrane proteins. J. Cell Biol. 216, 743–760. 18. Liem, K.F., Jr., He, M., Ocbina, P.J., and Anderson, K.V. (2009). Mouse Kif7/Costal2 is a cilia-associated protein that regulates Sonic hedgehog signaling. Proc. Natl. Acad. Sci. USA 106, 13377–13382. 19. Ikeda, A., Ikeda, S., Gridley, T., Nishina, P.M., and Naggert, J.K. (2001). Neural tube defects and neuroepithelial cell death in Tulp3 knockout mice. Hum. Mol. Genet. 10, 1325–1334. 20. Norman, R.X., Ko, H.W., Huang, V., Eun, C.M., Abler, L.L., Zhang, Z., Sun, X., and Eggenschwiler, J.T. (2009). Tubby-like protein 3 (TULP3) regulates patterning in the mouse embryo through inhibition of Hedgehog signaling. Hum. Mol. Genet. 18, 1740–1754. 21. Cameron, D.A., Pennimpede, T., and Petkovich, M. (2009). Tulp3 is a critical repressor of mouse hedgehog signaling. Dev. Dyn. 238, 1140–1149. 22. Patterson, V.L., Damrau, C., Paudyal, A., Reeve, B., Grimes, D.T., Stewart, M.E., Williams, D.J., Siggers, P., Greenfield, A., and Murdoch, J.N. (2009). Mouse hitchhiker mutants have spina bifida, dorso-ventral patterning defects and polydactyly: identification of Tulp3 as a novel negative regulator of the Sonic hedgehog pathway. Hum. Mol. Genet. 18, 1719–1739. 23. Santagata, S., Boggon, T.J., Baird, C.L., Gomez, C.A., Zhao, J., Shan, W.S., Myszka, D.G., and Shapiro, L. (2001). G-protein signaling through tubby proteins. Science 292, 2041–2050. 24. Traykova-Brauch, M., Scho¨nig, K., Greiner, O., Miloud, T., Jauch, A., Bode, M., Felsher, D.W., Glick, A.B., Kwiatkowski, D.J., Bujard, H., et al. (2008). An efficient and versatile system for acute and chronic modulation of renal tubular function in transgenic mice. Nat. Med. 14, 979–984. 25. Piontek, K., Menezes, L.F., Garcia-Gonzalez, M.A., Huso, D.L., and Germino, G.G. (2007). A critical developmental switch defines the kinetics of kidney cyst formation after loss of Pkd1. Nat. Med. 13, 1490–1495. 26. Gu, S., Lennon, A., Li, Y., Lorenz, B., Fossarello, M., North, M., Gal, A., and Wright, A. (1998). Tubby-like protein-1 mutations in autosomal recessive retinitis pigmentosa. Lancet 351, 1103–1104. 27. Watnick, T., and Germino, G.G. (1999). Molecular basis of autosomal dominant polycystic kidney disease. Semin. Nephrol. 19, 327–343. 28. Hopp, K., Ward, C.J., Hommerding, C.J., Nasr, S.H., Tuan, H.F., Gainullin, V.G., Rossetti, S., Torres, V.E., and Harris, P.C. (2012). Functional polycystin-1 dosage governs autosomal dominant polycystic kidney disease severity. J. Clin. Invest. 122, 4257–4273. 29. Fedeles, S.V., Tian, X., Gallagher, A.R., Mitobe, M., Nishio, S., Lee, S.H., Cai, Y., Geng, L., Crews, C.M., and Somlo, S. (2011). A genetic interaction network of five genes for human polycystic kidney and liver diseases defines polycystin-1 as the central determinant of cyst formation. Nat. Genet. 43, 639–647. 30. Cai, Y., Fedeles, S.V., Dong, K., Anyatonwu, G., Onoe, T., Mitobe, M., Gao, J.D., Okuhara, D., Tian, X., Gallagher, A.R., et al. (2014). Altered trafficking and stability of polycystins underlie polycystic kidney disease. J. Clin. Invest. 124, 5129–5144. 31. Kim, H., Xu, H., Yao, Q., Li, W., Huang, Q., Outeda, P., Cebotaru, V., Chiaravalli, M., Boletta, A., Piontek, K., et al. (2014). Ciliary membrane proteins traffic through the Golgi via a Rabep1/GGA1/Arl3-dependent mechanism. Nat. Commun. 5, 5482. 32. Gainullin, V.G., Hopp, K., Ward, C.J., Hommerding, C.J., and Harris, P.C. (2015). Polycystin-1 maturation requires polycystin-2 in a dose-dependent manner. J. Clin. Invest. 125, 607–620. 33. Hwang, S.-H., Somatilaka, B.N., Badgandi, H., Palicharla, V.R., Walker, R., Shelton, J.M., Qian, F., and Mukhopadhyay, S. (2019). Tulp3 regulates renal cystogenesis by trafficking of cystoproteins to cilia. Curr. Biol. Published online February 21, 2019. https://doi.org/10.1016/j.cub.2019. 01.047.

Current Biology 29, 1–10, March 4, 2019 9

 and Liem, Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease, Current Biology (2019), Please cite this article in press as: Legue https://doi.org/10.1016/j.cub.2019.01.054

34. Gotthardt, K., Lokaj, M., Koerner, C., Falk, N., Gießl, A., and Wittinghofer, A. (2015). A G-protein activation cascade from Arl13B to Arl3 and implications for ciliary targeting of lipidated proteins. eLife 4, e11859. 35. Nikonova, A.S., Deneka, A.Y., Kiseleva, A.A., Korobeynikov, V., Gaponova, A., Serebriiskii, I.G., Kopp, M.C., Hensley, H.H., SeegerNukpezah, T.N., Somlo, S., et al. (2018). Ganetespib limits ciliation and cystogenesis in autosomal-dominant polycystic kidney disease (ADPKD). FASEB J. 32, 2735–2746. 36. Silva, L.M., Jacobs, D.T., Allard, B.A., Fields, T.A., Sharma, M., Wallace, D.P., and Tran, P.V. (2018). Inhibition of Hedgehog signaling suppresses proliferation and microcyst formation of human autosomal dominant polycystic kidney disease cells. Sci. Rep. 8, 4985. 37. Caspary, T., Larkins, C.E., and Anderson, K.V. (2007). The graded response to Sonic hedgehog depends on cilia architecture. Dev. Cell 12, 767–778. 38. Cai, Y., Maeda, Y., Cedzich, A., Torres, V.E., Wu, G., Hayashi, T., Mochizuki, T., Park, J.H., Witzgall, R., and Somlo, S. (1999). Identification and characterization of polycystin-2, the PKD2 gene product. J. Biol. Chem. 274, 28557–28565.

10 Current Biology 29, 1–10, March 4, 2019

39. Shibazaki, S., Yu, Z., Nishio, S., Tian, X., Thomson, R.B., Mitobe, M., Louvi, A., Velazquez, H., Ishibe, S., Cantley, L.G., et al. (2008). Cyst formation and activation of the extracellular regulated kinase pathway after kidney specific inactivation of Pkd1. Hum. Mol. Genet. 17, 1505–1516. 40. Perl, A.K., Wert, S.E., Nagy, A., Lobe, C.G., and Whitsett, J.A. (2002). Early restriction of peripheral and proximal cell lineages during formation of the lung. Proc. Natl. Acad. Sci. USA 99, 10482–10487. 41. Kanki, H., Suzuki, H., and Itohara, S. (2006). High-efficiency CAG-FLPe deleter mice in C57BL/6J background. Exp. Anim. 55, 137–141. 42. Sakai, K., and Miyazaki, Ji. (1997). A transgenic mouse line that retains Cre recombinase activity in mature oocytes irrespective of the cre transgene transmission. Biochem. Biophys. Res. Commun. 237, 318–324. 43. Moran, J.L., Bolton, A.D., Tran, P.V., Brown, A., Dwyer, N.D., Manning, D.K., Bjork, B.C., Li, C., Montgomery, K., Siepka, S.M., et al. (2006). Utilization of a whole genome SNP panel for efficient genetic mapping in the mouse. Genome Res. 16, 436–440. 44. Nagy, A. (2003). Manipulating the Mouse Embryo: A Laboratory Manual, Third Edition (Cold Spring Harbor Laboratory Press).

 and Liem, Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease, Current Biology (2019), Please cite this article in press as: Legue https://doi.org/10.1016/j.cub.2019.01.054

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Rabbit anti-Ki67

Thermo Fisher Scientific

Cat# RM-9106-S1; RRID:AB_149792

Mouse anti-acetylated a-Tubulin

Sigma-Aldrich

Cat# T7451; RRID: AB_609894

Rabbit anti-ACIII

Santa Cruz Biotechnology

Cat# sc-588; RRID:AB_630839

Rabbit anti-Arl13

Gift from T. Caspary [37]

N/A

Rabbit anti-PC2

Gift from S. Somlo [38]

YCC2 169-23w

Mouse anti-Arl13b

UC Davis/NIH NeuroMab Facility

Cat# 75-287; RRID: AB_2341543

Rabbit anti-Tulp3

Gift from J. Eggenschwiler

N/A

Alexa 488 donkey anti-rabbit

Thermo Fisher Scientific

Cat# A-21206; RRID:AB_2535792

Alexa 555 donkey anti-rabbit

Thermo Fisher Scientific

Cat# A-31572; RRID: AB_162543

Alexa 488 donkey anti-mouse

Thermo Fisher Scientific

Cat# A-21202; RRID:AB_141607

Alexa 555 goat anti-mouse

Thermo Fisher Scientific

Cat# A-21422; RRID:AB_2535844

Alexa 594 goat anti-rabbit

Thermo Fisher Scientific

Cat# A-11012; RRID:AB_2534079

Alexa 594 goat anti-mouse

Thermo Fisher Scientific

Cat# A-11005; RRID:AB_2534073

Alexa 568 goat anti-mouse IgG2b

Thermo Fisher Scientific

Cat# A-21144; RRID: AB_2535780

Cy5 goat anti-mouse IgG2a

Jackson Immunoresearch

Cat# 115-175-206

Antibodies

HRP mouse anti-rabbit

Jackson Immunoresearch

Cat# 211-032-171

HRP donkey anti-mouse

Jackson Immunoresearch

Cat# 715-035-150

Rhodamine Dolichos Biflorus agglutinin (DBA)

Vector Laboratories

Cat# RL-1032; CAS Number 26628-22-8

Fluorescein Lotus Tetragonolobus lectin (LTL)

Vector Laboratories

Cat# FL-1321; CAS Number 26628-22-8

Chemicals, Peptides, and Recombinant Proteins

DAPI

Sigma-Aldrich

Cat# D-9542; CAS Number: 28718-90-3

OCT (Tissue-Tek OCT Compound)

Sakura

4583

Mowiol 4-88

Sigma-Aldrich

Cat# 81381; CAS Number 9002-89-5

DMEM

Thermo Fisher Scientific

Cat# 11965092

FBS

Thermo Fisher Scientific

Cat# 10439001

Pen/Strep/Glutamine

Thermo Fisher Scientific

Cat# 10378016

Non Essential Amino Acids

Thermo Fisher Scientific

Cat# 11140050

b-mercaptoethanol

Thermo Fisher Scientific

Cat# 21985023

LIF (ESGRO)

Millipore Sigma

Cat# ESG1107

Mitomycin-C

Sigma-Aldrich

Cat# M4287; CAS Number 50-07-7

Doxycyline

Sigma-Aldrich

Cat# D-9891; CAS Number 24390-14-5

Alizarin Red S

Sigma-Aldrich

Cat# A-5533; CAS Number: 130-22-3

Alcian Blue 8GX

Sigma-Aldrich

Cat# A-5268; CAS Number: 33864-99-2

SureSelect (mouse exome)

Agilent

https://www.agilent.com/en/product/ hybridization-based-next-generationsequencing-(ngs)/exome-probes/ sureselect-non-human-exomes-232868

Urea Nitrogen (BUN) test set

Stanbio

Cat# SB-0580

EuMMCR

Tulp3tm1a(EUCOMM)hmgu

Critical Commercial Assays

Experimental Models: Cell Lines ESCs Tulp3tm1a(EUCOMM)hmgu

(Continued on next page)

Current Biology 29, 1–10.e1–e5, March 4, 2019 e1

 and Liem, Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease, Current Biology (2019), Please cite this article in press as: Legue https://doi.org/10.1016/j.cub.2019.01.054

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Pkd1fl mouse: B6.129S4Pkd1tm2Ggg/J

The Jackson Laboratory

IMSR Cat# JAX:010671, RRID:IMSR_JAX:010671

Pax8rtTA mouse: B6.Cg-Tg (Pax8-rtTA2S*M2)1Koes/J

The Jackson Laboratory

IMSR Cat# JAX:007176, RRID:IMSR_JAX:007176

TetO-cre mouse: STOCK Tg(tetO-cre)1Jaw/J

The Jackson Laboratory

IMSR Cat# JAX:006224, RRID:IMSR_JAX:006224

Experimental Models: Organisms/Strains

Tulp3fl mouse

This paper

N/A

Tulp3null mouse

This paper

N/A

Tulp3K407I mouse

This paper

N/A

CAG-Cre: C57BL/6-Tg (CAG-cre)13Miya

Riken BioResource Research Center

IMSR Cat# RBRC09807, RRID:IMSR_RBRC09807

Actin-Flp: B6.Cg-Tg (ACTFLPe)9205Dym/J

The Jackson Laboratory

IMSR Cat# JAX:005703, RRID:IMSR_JAX:005703

Arl13bnull/null mouse brain tissue

Gift from Z. Sun

N/A

Genotyping primer K407I XmnI digest forward: TTCTCCCTCCACACAGGAAC

This paper

N/A

Genotyping primer K407I XmnI digest reverse: ACTTCTGTGTCTGCCCCAGT

This paper

N/A

GraphPad Software

https://www.graphpad.com/ scientific-software/prism/

ImageJ

NIH

https://imagej.nih.gov/ij/

SmartSEM

Carl Zeiss

https://www.zeiss.com/microscopy/ us/products/microscope-software/ smartsem.html

Axiovision

Carl Zeiss

https://www.micro-shop.zeiss.com/?s= 166274637c37976&l=en&p=us&f=e&i= 10221

Zen

Carl Zeiss

https://www.micro-shop.zeiss.com/?s= 166274637c37976&l=en&p=us&f=e&i= 1010

Oligonucleotides

Software and Algorithms GraphPad Prism

Other Microtome RM2255

Leica

Cat# RM2255

Cryostat CM3050S

Leica

Cat# CM3050S

Zeiss Axiovert microscope

Carl Zeiss

Cat# 491237-0014-000

Axioskop

Carl Zeiss

Cat# 232229

Axiocam

Carl Zeiss

Axiocam 305 Mono

Hamamatsu Orca Flash 4.0 camera

Hamamatsu

Cat# C11440-22CU

Field emission microscope

Carl Zeiss

Supra 25

Plasma Separator Tubes with Lithium Heparin

Becton, Dickinson and Company

Cat# 365987

4000 QTRAP mass spectrometer

AB Sciex

4000 QTRAP

Mini-Protean TGX gel

Bio-Rad

Cat# 456-1084

PVDF membrane

Bio-Rad

Cat# 162-0218

CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Karel F. Liem, Jr ([email protected]).

e2 Current Biology 29, 1–10.e1–e5, March 4, 2019

 and Liem, Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease, Current Biology (2019), Please cite this article in press as: Legue https://doi.org/10.1016/j.cub.2019.01.054

EXPERIMENTAL MODEL AND SUBJECT DETAILS Mouse lines Pkd1fl [39], Pax8rtTA [24], TetO-cre [40] mouse lines have been described previously. The Tulp3fl and the Tulp3null mouse lines were derived from the Knock-out First (with conditional potential) ESC line targeted at the Tulp3 locus (Tulp3tm1a(EUCOMM)hmgu). Mice were generated from the Tulp3tm1a(EUCOMM)hmgu ESCs and crossed with either the CAG-Cre line [41] to obtain the Tulp3lnull null allele or with Actin-flp mouse [42] to obtain the Tulp3fl (floxed) allele (https://www.eummcr.org/products/es-cells). The Tulp3K407I was identified through an ENU forward genetic screen conducted by KFL (see below for details). The Tulp3K407I and Tulp3null allele were maintained on the FVB/NJ background. The other alleles were intercrossed and resulting animals were maintained on a mixed background. Both males and females were included since no differences between sexes were observed. Several litters were used to obtain the necessary number of experimental genotypes, in each litter at least 2 animals of control genotypes were used as ‘‘littermate controls.’’ Embryos were generated by timed-pregnancy (noon of the day when vaginal plug was observed was considered E0.5) and collected at E14.5, E15.5 and E18.5. Post-natal (P14, 18 weeks and 42 weeks) animals were timed from their day of birth that was considered P0. Animals were healthy with normal immune status, were not subject to prior procedures, and were reared by standard husbandry (12 h day/night cycle, unlimited access to food and water) and housed in standard cages at the Yale Animal Resource Facility. All animal studies were performed under an approved Institutional Animals Care and Use Committee mouse protocol according to Yale University institutional guidelines. Cell lines The Tulp3tm1a(EUCOMM)hmgu ESC line was obtained from EuMMCR (European Mouse Mutant Cell Repository, https://www.eummcr. org/products/es-cells) for generation of the mice by the MSKCC Mouse Genetic Core. ESCs were grown in DMEM (11965092, Thermo Fisher Scientific), 15% FBS (10439001, Thermo Fisher Scientific), Pen/Strep/Glutamine (0.5mg/mL)( 10378016, Thermo Fisher Scientific), 1X non essential amino acids (11140050, Thermo Fisher Scientific), b-mercaptoethanol (143mM) (21985023, Thermo Fisher Scientific), LIF (106 U/mL) (ESG1107, Millipore Sigma) on mitomycin-c (M4287, Sigma-Aldrich) treated feeder fibroblasts. METHOD DETAILS Conditional deletion of genes Animals carrying floxed alleles and the Pax8rtTA and TetO-cre alleles were generated and were administered doxycycline (Dox) in drinking water (2mg/L) for 2 weeks starting at either P0 for analysis at P14 (developmental model of gene deletion), or at P28 for analysis at 18 weeks or 42 weeks (adult model of gene deletion). Animals that did not carry either the Pax8rtTA or TetO-cre alleles were used as controls. Cloning the Tulp3 K407I mutation We performed a genetic screen in the mouse to uncover recessive ENU-induced mutations by mutagenizing C57BL6/J (Jackson Laboratory) male mice and out-crossing to FVB/NJ carrying the HB9-GFP transgene which expresses GFP in spinal motor neurons [18]. A mutant mouse line was identified with neural patterning defects (K.F.L., unpublished data) that subsequently developed kidney cysts. DNA was isolated from phenotypic mice and the mutation mapped to a segment of chromosome 6, based on the regions homozygous for C57BL6/J polymorphisms on a genome-wide single nucleotide polymorphisms (SNP) panel [43]. The interval was subsequently refined using positional mapping to a
5 Mb interval between SNP rs30562127 and SNP rs46534582 (NCBI m37). Genomic DNA was amplified and used for in-solution exon capture (Agilent SureSelect) and whole-exome sequencing was performed with 30 3 coverage on the Illumina HiSeq system as 2 3 100 paired-end reads. Exome sequencing identified an adenine-to-thymine transversion in exon 10 of the Tulp3 gene at position 1293, creating the amino acid substitution K407I. The mutation disrupts a Xmn1 restriction site present in the wild-type sequence, creating a restriction fragment–length polymorphism (RFLP) that was used for genotyping. PCR amplification from genomic DNA using primers 50 -TTCTCCCTCCACACAGGAAC-30 and 50 -ACTTCTGTGTCTGCCCCAGT-30 generated a 240 bp PCR product containing the RFLP. Xmn1 digestion cuts the wildtype, but not the mutant amplicon. Histology and fluorescent staining Embryonic kidneys were immersion fixed in cold 4% PFA, rinsed in PBS, one kidney (O/N fix) was dehydrated and paraffin embedded for hematoxylin and eosin staining and the second (20 min fix) was transferred into 30% sucrose O/N and frozen in OCT (TissueTek) for cryo-sectioning for antibody staining. Post-natal animals were weighed and anaesthetized and their blood was collected by cardiac puncture for measurement of BUN and creatinine. Animals were perfused with PBS, their kidneys were dissected, weighed, bisected longitudinally and immersion fixed in cold 4% PFA. One half of each kidney was processed for paraffin embedding and the other half for cryo-sectioning. Paraffin embedded kidneys were sectioned at 7mm using a microtome (Leica RM2255). Frozen tissue was sectioned at 12 mm using a cryostat (Leica CM3050S). Sections were stained with the following antibodies: rabbit anti-Ki67 (1:200) (RM-9106-S1, ThermoScientific), mouse anti-acetylated a-Tubulin (1:2000) (T7451, Sigma-Aldrich), rabbit anti-ACIII Current Biology 29, 1–10.e1–e5, March 4, 2019 e3

 and Liem, Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease, Current Biology (2019), Please cite this article in press as: Legue https://doi.org/10.1016/j.cub.2019.01.054

(sc-588, Santa Cruz Biotechnology), rabbit anti-Arl13 (1:500) (gift from T. Caspary [37]), mouse anti-Arl13b (75-287) (NeuroMab), rabbit anti-PC2 (gift from S. Somlo [38]); and lectin conjugated with fluorophores (Rhodamine Dolichos Biflorus agglutinin (DBA)(1:50), RL-1032, Vector Laboratories, Fluorescein Lotus Tetragonolobus lectin (LTL)(1:500) FL-1321, Vector Laboratories). Secondary antibodies used were donkey anti-rabbit Alexa Fluor-488 (A-21206), donkey anti-rabbit Alexa Fluor-555 (A-31572), donkey anti-mouse Alexa Fluor-488 (A-21202), goat anti-mouse Alexa fluor-555 (A-21422), goat anti-rabbit Alexa Fluor-594 (A-11012), goat anti-mouse Alexa Fluor-594 (A-11005), goat anti-mouse IgG2b Alexa Fluor-568 (A-21144) (Thermofisher Scientific) and goat anti-mouse IgG2a Cy5 (115-175-206) (Jackson Immunoresearch). For all stainings, frozen sections were warmed to room temperature, transferred into PBS and incubated in blocking solution (10% normal goat serum, 0.1% triton PBS) at room temperature for an hour. Sections were incubated in primary antibody in blocking solution O/N at 4 C, rinsed 3 times 5 min in PBS and incubated in secondary antibody in PBS-DAPI for 2 h at room temperature, rinsed 3 times 5 min in PBS and mounted in mowiol solution (10% Mowiol 4-88 (Sigma-Aldrich 81381), 25% glycerol, 0.1M Tris). For PC2 antibody staining, sections were incubated in sodium borohydrate 0.1% for 30 min, rinsed 3 times in TBS, incubated in 1% SDS for 10 min and rinsed 3 times in TBS prior to blocking. All subsequent steps were similar to standard antibody staining described above except that TBS was used instead of PBS. Images were taken on a Zeiss Axiovert microscope and images were taken using an Axiocam driven by Axiovision software or Hamamatsu Orca Flash 4.0 camera driven by Zen software. Skeletal staining E18.5 embryos were skinned and eviscerated and transferred into 70% ethanol first and into 95% ethanol next at room temperature. They were transferred into acetone O/N at room temperature to remove fat and rinse briefly in de-ionized water. The embryos were incubated for 24 h in Alcian Blue stain solution (0.05% Alcian Blue 8GX (Sigma-Aldrich A-5268) 5% acetic acid) then rinsed 6 times 60 min in ethanol 70%. They were incubated in potassium hydroxide until the tissue cleared and counterstained with Alizarin Red solution (0.005% Alizarin red (Sigma-Aldrich A-5533) in 1% potassium hydroxide freshly made) O/N. They were incubated in 1% potassium hydroxide-20% glycerol solution until they cleared and stored in 50% glycerol-50% ethanol solution [44]. Quantification of the kidney phenotype We used the kidney to body weight ratio, the cystic index, blood nitrogen urea (BUN) and creatinine concentrations to assess quantitatively for the kidney cystic phenotype. Cystic index was calculated on H&E stained longitudinal sections of the kidneys. Sections were photographed on a Zeiss Axioskop microscope, images were then processed through ImageJ to measure the surface area of cysts and the total surface area of the section and calculate the % of cystic surface area (cystic index). BUN and creatinine concentrations were measured from sera extracted from blood by centrifugation on Plasma Separator Tubes with Lithium Heparin (Becton, Dickinson and Company, 365987) obtained by cardiac puncture. Creatinine concentration measurements were performed at the O’Brien kidney center at Yale by utilizing a targeted Liquid Chromatography-Multiple Reaction Monitoring (LC-MRM) workflow on a 4000 QTRAP mass spectrometer (AB Sciex). BUN concentrations were measured at the O’Brien kidney center at Yale using Stanbio Laboratory 0580 series Urea Nitrogen Test (Stanbio, SB-0580). Measurements for quantifications were performed blind in respect to the genotype of the animals that were identified by their ID number. No sample size estimation, randomization or stratification of the data were performed and no data or subject were excluded except in the calculations of the cystic indexes of control kidneys and in the measures of the BUN and creatinine concentrations. Only a subset of the total control kidneys (at least 1 control animal per litter was randomly chosen) were sectioned and subsequently quantified. Some blood samples quality did not allow for a measure of BUN or creatinine concentrations and were thus excluded from the analysis of the P14 Tulp3K407I mutants. At least n = 4 animals of each genotype in each post-natal experiment and n = 3 animals at E18.5 were quantified. Animals of the same genotype were considered biological replicates. Significance was attained for p values < 0.05. Quantification of proliferation Proliferating cells were identified by Ki67 immunoreactivity. Double staining for Ki67 and either DBA or LTL with DAPI counterstaining of nuclei was performed. For each animal, 3 sections were quantified using a systematic random sampling procedure (The whole kidney section was photographed at 40X generating a mosaic image, every 6th frame was quantified for the number of DBA (or LTL) cells, and the number of Ki67 positive DBA (or LTL) cells, the % of proliferating cells within the DBA (or LTL) population for that section was then calculated as the total number of double positive cells divided by the total number of DBA (or LTL) cells x100. The mean of the results from 3 sections (spaced by 72mm) was calculated for 3 animals. Cell counting was performed blind in respect to the genotype of the animals. No sample size estimation, randomization or stratification of the data were performed and no data or subject were excluded. n = 3 animals at E18.5 were quantified. Animals of the same genotype were considered biological replicates. Significance was attained for p values < 0.05. Scanning Electron Microscopy (SEM) P0 animals were perfused via cardiac puncture with 0.1 M cacodylate, followed by 2% PFA and 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer. Kidneys were removed and post-fixed with 2% PFA and 2.5% glutaraldehyde/0.1 M sodium cacodylate buffer and bisected in 0.1 M cacodylate buffer. Kidneys were dehydrated in ethanol and prepared for SEM using standard protocols. SEM was performed using a field emission microscope (Supra 25; Carl Zeiss), and images were acquired with SmartSEM (Carl Zeiss).

e4 Current Biology 29, 1–10.e1–e5, March 4, 2019

 and Liem, Tulp3 Is a Ciliary Trafficking Gene that Regulates Polycystic Kidney Disease, Current Biology (2019), Please cite this article in press as: Legue https://doi.org/10.1016/j.cub.2019.01.054

Quantification of PC2 ciliary levels To compare the intensity of PC2 staining in kidney cilia, integrated density values were calculated for individual axonemes by selecting the entire cilium, as marked by acetylated a-tubulin, and normalized to cilia length using ImageJ. At least 30 cilia from each genotype were quantified. Quantification was performed blind in respect to the genotype of the animals. No sample size estimation, randomization or stratification of the data were performed and no data or subject were excluded. Significance was attained for p values < 0.05. Western Blot Analysis Proteins extracts were generated using RIPA buffer and westerns were performed using standard protocols (protein extracts were run on a Mini-Protean TGX gel (Bio-Rad, 456-1084) at 4 C and transferred on PVDF membrane (Bio-Rad Immun-Blot PVDF Membrane Sandwiches 162-0218) for 1 h at 100mV at 4 C. Specific proteins were detected using a rabbit anti-Tulp3 polyclonal antibody (gift from J. Eggenschwiler) a mouse anti-Arl13b antibody (NeuroMab), or a rabbit anti-PC2 antibody (gift from Dr. Somlo). Mouse anti-rabbit (211-032-171) and donkey anti-mouse (715-035-150) HRP conjugated secondary antibodies were used (Jackson Immunoresearch). Protein levels normalized to loading controls were quantified using ImageJ. QUANTIFICATION AND STATISTICAL ANALYSIS Statistical comparisons were performed using Student’s t test (comparison of 2 datasets) or ANOVA followed by Tukey for multiple comparisons in Prism7. Statistical significance was attained for p values < 0.05. Specific n values and statistical tests used are indicated in figures and figure legends. All measurements for quantifications were performed blind in respect to the genotype of the animals. No sample size estimation, randomization or stratification of the data were performed and no data or subject were excluded except in the calculations of the cystic indexes of control kidneys and of the BUN and creatinine concentrations (see Quantification of the Kidney Phenotype).

Current Biology 29, 1–10.e1–e5, March 4, 2019 e5