Tumor-associated macrophages provide a suitable microenvironment for non-small lung cancer invasion and progression

Lung Cancer 74 (2011) 188–196

Contents lists available at ScienceDirect

Lung Cancer journal homepage: www.elsevier.com/locate/lungcan

Tumor-associated macrophages provide a suitable microenvironment for non-small lung cancer invasion and progression Rui Wang a,b , Jie Zhang a,b,∗ , Sufeng Chen a,b , Meng Lu c , Xiaoyang Luo a,b , Shihua Yao a,b , Shilei Liu a,b , Ying Qin c , Haiquan Chen a,b,∗ a

Department of Thoracic Surgery, Shanghai Cancer Hospital, Fudan University, Shanghai 200032, China Department of Oncology, Shanghai Medical College, Fudan University, Shanghai 200032, China c Institute for Nutritional Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Graduate School of the Chinese Academy of Sciences, 200031, China b

a r t i c l e

i n f o

Article history: Received 25 November 2010 Received in revised form 23 March 2011 Accepted 17 April 2011 Keywords: Lung cancer Tumor associated macrophages Invasion Metastasis

a b s t r a c t Objective: It remains largely unknown whether tumor-associated macrophages (TAMs) are involved in invasion and metastasis of human lung cancer. The aim of our study was to obtain an accurate overview of the broad range of changes occurring in monocytes that develop into TAMs, and the roles of TAMs during the progression of non-small cell lung cancer. Methods: TAM was isolated from 98 primary lung cancer tissues by short term cultivation in serum-free medium. The mRNA expression levels of 9 genes, including EGF, Cathepsin K, Cathepsin S, COX-2, MMP-9, PDGF, uPA, VEGFA, HGF, were evaluated by real-time PCR in 98 NSCLC. The relationships between those gene expression levels and clinicopathological features were investigated. The effects of conditioned medium from TAMs on the invasive properties of different lung cancer cell lines were measured using Transwell chambers. Results: We successfully achieved up to 95% purity of TAM, derived from 98 primary lung cancer tissues. TAM expressed high levels of Cathepsin K, COX-2, MMP-9, PDGF-B, uPA, VEGFA, and HGF. Phenotypic expression on TAMs, like MMP9, was shown to be correlated with disease progression by analyzing lung cancer tissues. Conditioned medium from TAM significantly increased cell migration and invasion in SPCA1 cells, H460 cells and A549 cells. Anti-uPA and anti-MMP-9, but not anti-VEGF monoclonal antibodies, can inhibit TAM-induced invasion. The increase of invasiveness in the lung cancer cell lines was also correlated with their gelatinase activity, through MMP9. Conclusions: Short-term culture in serum free medium is an effective way to isolate TAM in NSCLC. The results of this study also demonstrated that those up-regulated genes in TAMs contributed to suitable microenvironments for lung cancer invasion and metastasis. These findings may be useful in developing novel therapeutic strategies to prevent lung cancer progression. © 2011 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Complex interactions between tumor-infiltrating macrophages and tumor cells play an important role in the development of tumors [1]. Predominant infiltration of neoplastic tissue by tumorassociated macrophages (TAMs) has been correlated with a poor prognosis for patients in several malignant tumors [2–5]. TAMs are derived from blood monocytes, that are attracted to a tumor by

∗ Corresponding authors at: Department of Thoracic Surgery, Shanghai Cancer Hospital, Fudan University, Shanghai 200032, China. Tel.: +86 21 64175590 2508. E-mail addresses: [email protected] (H. Chen), [email protected] (J. Zhang). 0169-5002/$ – see front matter © 2011 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.lungcan.2011.04.009

cytokines and chemokines, such as CCL2, CCL3, CCL4, CCL5, CCL8, and VEGF [6]. There are two main classes of macrophages: classically activated macrophages (also called M1) and alternatively activated macrophages (M2). M1 macrophages generally exhibit microbicidal activity and a pro-inflammatory phenotype. In contrast, M2 macrophages are able to tune inflammatory responses and adaptive Th2 immunity, scavenge debris, and promote angiogenesis, tissue remodeling and repair [7]. TAMs produce high amounts of interleukin (IL)-10, but not IL-12, express scavenger receptors, and exhibit anti-inflammatory and tissue repair functions, which resembles M2 macrophages [8]. Several genes were reported to be associated with TAMs, including matrix metalloproteinases-9 (MMP-9) [9], urokinasetype plasminogen activator (uPA) [10], vascular endothelial growth

R. Wang et al. / Lung Cancer 74 (2011) 188–196 Table 1 Primers used in real time PCR.

2.2. Subject characteristics

Genes (Gene Bank accession no.)

Forward primer sequence: F (5 → 3 ) Reverse primer sequence: R (5 → 3 )

MMP9 (NM 004994.2)

F:TCGAACTTTGACAGCGACAAG R:GCACTGAGGAATGATCTAAGC F:CTCATCCTACACAAGGACTAC R:CAGGCAGATGGTCTGTATAGT F:ACGAACGTACTTGCAGATGTGAC R:GCGGCAGCGTGGTTTCTGTA F:GTGCTTAAACAGGAGCATCCT R:GATAGCCACTCAAGTGTTGC F:AACAACCGCAACGTGCAGTG R:GCTGCCACTGTCTCACACTT F:GCTTCTCTTGGTGTCCATAC R:CATTACTGCGGGAATGAGAC F:TGCTTCACAACCTGGAGCAT R:TATTTCTCTGCCACTGGCTG F:CCTCACGAGCATGACATGAC R:GCAGTAGCCAACTCGGATGT F:ATGACACTTGGGAGCCTGATGTT R:ACATTGCGTGGACAGGAAACAAG F:TGACGTGGACATCCGCAAAG R:CTGGAAGGTGGACAGCGAGG F:AGAACCTGAAGACCCTCAGGC R:CCA CGG CCT TGC TCT TGT T F:TGCCCAGAGCAAGATGTGTCAC R:GACCACCATTTCTCCAGGGGCA

uPA (NM 001145031.1) VEGFA (NM 001025366.2) COX-2 (NM 000963.2) PDGF-B (NM 002608.2) Cathepsin K (NM 000396.2) Cathepsin S (NM 004079.3) HGF (NM 001010932.1) EGF (NM 001178131.1) ␤-Actin (NM 001101.3) IL-10 (NM 000572.2) IL-12 (NM 002187.2)

189

factor (VEGF) [11,12], platelet-derived growth factor (PDGF) [13], hepatocyte growth factor (HGF) [14], epidermal growth factor (EGF) [15], Cathepsin B and Cathepsin S [16,17], Cathepsin K [18] and cyclooxygenase-2 (COX-2) [19]. However, little is known about the molecular profiles of TAMs in human cancer, and it is not clear yet whether the expression of these genes by TAMs varies between different tumors [20]. Data regarding their expression in TAMs of human cancer patients and correlation with clinical–pathological factors are currently lacking. The potential importance of TAMs in lung cancer metastasis is supported by reports of an association between high TAM counts and poor prognosis in lung cancer patients [3,21]. Up to now, few studies have attempted to demonstrate the roles of TAMs in the progression of human non-small lung cancer, and little is known about the gene expression in human lung cancer cells exposed to TAMs. To obtain an accurate overview of the broad range of changes occurring in monocytes that develop into TAMs, and the roles of TAMs during the progression of non-small cell lung cancer, we isolated 98 pairs of TAMs and monocytes from primary non-small cell lung cancer tissue/peripheral blood. We examined whether MMP9, uPA, VEGF, COX-2, PDGF, Cathepsin S, Cathepsin K, and EGF (all these factors were reported to be associated with TAM) have a differential expression on TAMs compared to normal monocytes, and then to correlate their level of expression with the clinicopathological features. Furthermore, we explored the underlying molecular mechanisms by which TAMs may promote lung tumor invasion.

98 paired peripheral blood samples and primary lung cancer tissues were collected from patients before or at the time of surgical resection at Shanghai Cancer Hospital from June 2009 to September 2010. A consent form was signed by every patient or his/her legal representatives. This study was approved by the committees for Ethical Review of Research at Shanghai Cancer Hospital. Histological diagnosis and grade of differentiation were determined in accordance with the World Health Organization criteria for lung cancer [22]. The pathologic tumor stage (p stage) was determined according to the revised TNM classification of lung cancer [23]. LVI was defined as the presence of tumor emboli in the lymphatic vessel or blood vessel by H&E staining within a tumor. Blood vessels were identified by the presence of erythrocytes in the lumen and/or an endothelial cell lining. Because it is often difficult to distinguish blood vessels from lymphatic vessel, previous studies combined lymphatic and vascular invasion, as a single prognostic factor [24]. 2.3. Isolation of tumor-associated macrophages Isolation of tumor-associated macrophages was performed as described by Sierra et al. [25]. Tumor tissue was cut into 2 mm fragments, followed by collagenase digestion (0.3 mg/ml type I, Worthington Biochemical Corp, NJ, USA) for 1 h at 37 ◦ C. The suspension was filtered through a 70 ␮m stainless steel wire mesh to generate a single-cell suspension. The suspension was centrifuged and washed twice with PBS. Cells were left to adhere in serum-free RPMI 1640 for 40 min. Non-adherent cells were washed away. Immunofluorescence staining for macrophage markers (CD68) confirmed the identity of the adherent populations. For TAM-conditioned medium collection, the cells remained in serumfree conditions for 24 h prior to medium collection. 2.4. Immunofluorescence TAMs were adhered to 24-well plate, fixed in 4% paraformaldehyde at room temperature for 5 min, washed with PBS twice, incubated with 1% BSA at 37 ◦ C for 30 min to block nonspecific interactions, and then stained with primary antibodies to CD68 (1:100 dilution, sc-20060, Santa Cruz Biotechnology, CA, USA) at 4 ◦ C overnight. Cells were then incubated in rhodamine-labeled goat anti-mouse secondary antibody (Proteintech Group, Inc., Chicago, USA) at room temperature for 1 h. Nuclei were then stained with 4 6-diamidino-2-phenylindole. 2.5. Preparation of normal peripheral monocytes Monocytes were obtained as previously described [26]. In brief, the mononuclear cells were isolated from peripheral blood matched with TAMs by Ficoll-Hypaque density gradient centrifugation (density, 1.077 ± 0.001 g/ml, Axis-Shield, Oslo, Norway) at 2200 rpm for 20 min. The mononuclear cells were washed and plated at 6-cm diameter Petri dishes in DMEM for 2 h. Thereafter, the nonadherent cells were washed thrice with warm PBS and the adherent monocytes were collected.

2. Materials and methods

2.6. RNA isolation and real-time PCR

2.1. Cell culture

Total RNA was isolated from TAMs and their matched monocytes by using RNeasy Mini Kit (Qiagen, Valencia, CA, USA) as described by the manufacturer’s protocol. For mRNA analysis, an aliquot containing 2 ␮g of total RNA was transcribed reversely using M-MLV reverse transcriptase (Promega, Madison, WI, USA). Specific primers (Genery, Shanghai, China) were used to amplify cDNA (Table 1). Real-time PCR was done using

The human lung adenocarcinoma cell line (A549) and human lung large cell carcinoma cell line (H460) were obtained from American Type Culture Collection. The human lung adenocarcinoma cell line (SPC-A1) was purchased from Shanghai Institute of Cell Biology, Chinese Academy of Sciences.

190

Table 2 Patient characteristics and genes expression in relationship with clinicopathologic factors. No.Pts (%)

MMP-9

uPA

VEGFA

COX-2

PDGF-B

CTK

HGF

All patients Sex Male Female p-Value Smoking Smoker Non-smoker p-Value Histology AD SCC Othersa p-Value Stage Early stageb Late stagec p-Value N status N1/N2 N0 p-value PI Present Absent p-Value LVI Present Absent p-Value Graded Well/moderate Poor p-Value

98

84 ± 130

879.8 ± 946

35.7 ± 46

40.8 ± 71.8

20.9 ± 46.1

8.2 ± 16.6

4.6 ± 6.7

64 (65) 34 (35)

92.4 ± 147 68.3 ± 89 0.638

956 ± 942.8 736.5 ± 950 0.104

41 ± 53.8 25.9 ± 25 0.26

46.3 ± 85.8 29.9 ± 30.4 0.566

24.2 ± 56 14.7 ± 14.4 0.536

8.5 ± 19.6 7.8 ± 8.5 0.338

5.1 ± 7.4 3.8 ± 4.9 0.179

57 (58) 41 (42)

92.6 ± 145.5 72 ± 105.5 0.79

907 ± 852 841 ± 1073 0.351

41 ± 54.6 28 ± 30.5 0.374

48.7 ± 90.6 29.3 ± 28.4 0.684

24 ± 59.1 16.5 ± 14.4 0.86

8.1 ± 19.8 8.4 ± 10.8 0.647

5.3 ± 7.8 3.7 ± 4.5 0.308

52 (53) 34 (35) 12 (12)

82.5 ± 120.4 93.7 ± 149.8 92.8 ± 117.7 0.428

770 ± 669 871.4 ± 876.9 1376.6 ± 1786 0.975

33 ± 40.9 38.8 ± 51.5 38.6 ± 56 0.81

32.2 ± 42.8 57.6 ± 107.3 28.7 ± 33.4 0.544

14.7 ± 14.3 29.6 ± 75 23.4 ± 22.8 0.561

4.9 ± 5.3 6.5 ± 7.3 14.5 ± 43 0.051

7.9 ± 8.9 4.2 ± 8.4 4.7 ± 7 0.069

44 (45) 54 (55)

49.4 ± 88.6 112.2 ± 151 0.005

853.5 ± 1108.5 901.3 ± 800 0.081

25 ± 33.3 44.4 ± 5.4 0.006

30.2 ± 39.8 49.0 ± 89.4 0.128

24.9 ± 66.2 17.7 ± 17.8 0.658

6.8 ± 8.6 9.4 ± 21 0.671

5.8 ± 8.1 3.7 ± 5.1 0.119

38 (39) 59 (60)

119.2 ± 162.3 58.4 ± 97.4 0.01

845 ± 575 888.1 ± 1128.7 0.101

44.8 ± 46 29.7 ± 46 0.007

41.7 ± 52.1 41.0 ± 82.9 0.412

15.6 ± 16.5 24.0 ± 57.9 0.894

10.2 ± 24 6.8 ± 9.3 0.231

3.6 ± 5.3 5.3 ± 7.4 0.137

33 (34) 64 (65)

77.9 ± 123.9 84.4 ± 133.2 0.834

747.2 ± 466.8 935.3 ± 1116 0.479

30.6 ± 43 38.1 ± 49 0.15

28.7 ± 34.8 47.3 ± 84.8 0.12

16.1 ± 16.9 23.1 ± 55.8 0.957

11.4 ± 26 6.5 ± 7.9 0.407

5.3 ± 6.2 4.3 ± 7.0 0.124

19 (19) 78 (80)

121.2 ± 151.3 72.7 ± 122.8 0.04

1306.4 ± 1075.8 765.3 ± 889 0.008

52.3 ± 51 31.5 ± 45 0.023

47.5 ± 54.5 39.4 ± 76 0.124

22.3 ± 20.4 20.3 ± 50.8 0.122

5.5 ± 5.9 8.8 ± 18.3 0.408

5.2 ± 7.1 4.5 ± 6.6 0.813

48 (49) 43 (44)

59.9 ± 102.3 112 ± 156.4 0.066

563.5 ± 732.7 1047 ± 698.7 0.0001

29.2 ± 32 45.5 ± 60 0.157

33.5 ± 43.9 51.5 ± 97.4 0.378

18.7 ± 63.6 23.6 ± 17.9 0.0001

7.0 ± 8.1 7.0 ± 8.3 0.54

5.2 ± 7.8 4.5 ± 5.7 0.54

All p by the Mann–Whitney U test. No.Pts: number of patients. AD: adenocarcinoma; SCC: squamous cell carcinoma; PI: pleural invasion; LVI: lymphovascular invasion; CTK: Cathepsin K. a Include 2 adeno-squamous carcinoma, 2 large cell carcinoma, 2 carcinoid, 1 malignant clear cell sugar tumor, 3 sarcomatoid carcinoma, and 2 undefined lung carcinoma. b Include stage I. c Includes stages II, III, and IV. d 7 not available, include carcinoid, malignant clear cell sugar tumor, multiple primary lung cancer.

R. Wang et al. / Lung Cancer 74 (2011) 188–196

Characteristic

R. Wang et al. / Lung Cancer 74 (2011) 188–196

191

Fig. 1. Characterization of tumor-associated macrophages. (A) Representative cell morphology of tumor-associated macrophages after 48-h incubation. (B) Dual immunofluorescent staining with anti-CD68 (to identify tumor-associated macrophages) visualized with rhodamine and nuclei stained with DAPI. (C) Relative expression levels of IL-10 in TAMs relative to Mo as quantified by real-time PCR in 8 pairs of TAMs. (D) Relative expression levels of IL-12 in TAMs relative to Mo. Error bar is SEM.

SYBR Green PCR master mix (Applied Biosystems, Piscataway, NJ, USA). Each sample was assayed in triplicate. Three independent experiments were performed. The comparative CT method (CT method) was used to determine the quantity of the target sequences in TAMs relative both to monocytes (calibrator) and to ␤-actin (an endogenous control). Relative expression levels were presented as the relative fold change and calculated using the formula: 2−CT = 2 − (CT (TAMs) − CT (monocytes) ) where each CT = CT target − CT ␤-actin . 2.7. Cell migration assay Cell mobility was assessed by a scratch wound-healing assay. Lung cancer cells were cultured to confluence in a six-well plate in regular medium. The cell monolayer was mechanically scratched with a sterile pipette tip. Cell mobility was assessed by measuring wound closure by photographing three random fields at time points 0 and 24 h after the cell monolayer was scratched. Representative images were taken at 200× magnification under a light microscope. 2.8. Cells invasion assay The invasion assay was conducted using a 24-well Transwell chamber with 8 ␮m pore size polycarbonate membrane, 6.5-mm diameter (Corning, NY, USA). The membrane was coated with 50 ␮l of 1:3 mixture of Matrigel (BD Biosciences, Bedford, MA, USA) and serum-free RPMI 1640 medium to form a matrix barrier. After the Matrigel solidified at 37 ◦ C for 2 h, the lower chambers of the 24-well plate were filled with 600 ␮L (a) RPMI 1640 medium. (b) TAM-CM (c) TAM-CM supplemented with Mouse anti-human VEGF IgG2B monoclonal antibody (4 ␮g/mL, final concentration) (MAB293, R&D Systems, MN, USA) and (d) TAM-CM supplemented with Mouse anti-human MMP-9 IgG1 monoclonal antibody (Clone: GE-213) (4 ␮g/mL, final concentration) (MAB13415, Chemi-

con, MA, USA). (e) TAM-CM supplemented with Goat anti-human u-plasminogen activator/urokinase antibody (1 ␮g/mL, final concentration) (AF1310, R&D Systems, MN, USA). 5 × 104 lung cancer cells were placed into the upper compartment of wells that were pre-coated with the reconstituted matrix. After incubating for 48 h at 37 ◦ C, a cotton swab was used to remove cells and excess Matrigel from the upper surface of the polycarbonate membrane of the Transwell. The cells that invaded through the Matrigel and passed into the lower compartment were stained with hematoxylin and eosin. The number of cells was counted at 200× magnification under a light microscope in five randomly selected fields. Independent experiments were repeated in triplicate.

2.9. Gelatin zymography MMP enzymatic activities in the medium were determined by SDS-PAGE gelatin zymography, as originally described by Heussen and Dowdle [27]. Cells were cultured in a 6-well tissue-culture plate (5 × 105 cells/well) in TAM conditioned medium or RPMI 1640. After 24 h, cells were washed extensively with PBS and changed to RPMI 1640 medium. After an overnight incubation, medium were collected and centrifuged at 4000 rpm for 20 min. After measurement of protein concentration using BCA Protein Assay Kit (Pierce, Rockford, IL, USA), the medium was mixed with sample buffer and applied directly, without prior boiling, to 10% acrylamide gels containing 1 mg/mL gelatin (Sigma Chemical Co., St Louis, MO, USA) for electrophoresis. The gels were then incubated for 1 h in 50 mM Tris–HCl twice followed by an incubation with development buffer at 37 ◦ C for 42 h. After the gels were stained with Coomassie Brilliant Blue G-250, they were destained in a 30% (vol/vol) methanol/10% (vol/vol) acetic acid solution until the transparent bands were shown on the blue background.

R. Wang et al. / Lung Cancer 74 (2011) 188–196

Cathepsin S p*>0.05

B

10

1

0.1

0.01

Mo

Cathepsin K p*<0.0001

1000

100

10

1

Mo

Relative mRNA expression

Relative mRNA expression

100 10 1

VEGFA p*<0.0001

10

1

0.1

TAM

100

10

1

0.1 Mo

TAM

Mo

TAM

Patients

COX-2 p*<0.0001

HGF p*<0.0001

H

Patients EGF p*<0.01

I

100

100 10 1 0.1

TAM

1000

Relative mRNA expression

Relative mRNA expression

1000

Relative mRNA expression

Mo

PDGF-B p*<0.0001

F

100

TAM

Mo

1

1000

Patients

0.01

10

Patients

1000

1000

G

100

TAM

E

10000

Mo

1000

Patients

uPA p*<0.0001

0.1

MMP-9 p*<0.0001

10000

0.1

0.1

TAM

Patients

D

C

Relative mRNA expression

100

Relative mRNA expression

Relative mRNA expression

A

Relative mRNA expression

192

10

1

0.1

Patients

Mo

TAM

100 10 1 0.1 0.01 0.001

Patients

Mo

TAM

Patients

Fig. 2. mRNA from TAMs and matched Mo. was analyzed by real-time PCR for expression of the indicated genes in 98 patient samples. Results are given as fold increase in mRNA expression with respect to expression in matched Mo. Data were normalized to expression of the ␤-actin gene. Monocytes (Mo.) was used as a calibrator. Bars represent median. *p by the Mann–Whitney U test.

2.10. Statistical analysis

3. Results

Statistical analysis software (Prism 5.0, GraphPad Software Inc, La Jolla, CA and SPSS Version 13.0 software, SPSS Inc, Chicago, IL) was used to perform the analyses. Either the Student’s t test or the Mann–Whitney test was used for the comparison between experimental groups as required. Data are expressed as mean + standard deviation. The P value <0.05 was considered to be statistically significant.

3.1. Patient characteristics The clinicopathological features of the studied subjects are summarized in Table 2. Patients (64 males and 34 females) had a mean age of 59.7 ± 9.7 years. Adenocarcinoma was the most common tumor type (53%) followed by squamous cell carcinoma (35%). 44 patients (45%) were stage I (early stage), and the remain-

R. Wang et al. / Lung Cancer 74 (2011) 188–196

193

Fig. 3. Effects of conditioned medium from TAM on lung cancer cells (SPC-A1, H460, and A549) migration. (A) Representative image of scratch wound in TAM conditioned medium or RPMI 1640 medium (control) cultured SPC-A1, H460, and A549 cells, (B) quantification via Olympus-DSP software analysis measured changes in the area from time 0 h to 24 h. Error bar is SEM, n = 3, *p < 0.05 (by Student’s t-test).

ing 54 patients were (55%) stages II, III or IV (late stage) of the disease. 3.2. Isolation and identification of tumor-associated macrophages TAMs were successfully isolated from 98 primary non-small cell lung cancer tissues by short-term primary culture in serum-free RPMI 1640 medium. TAMs from lung cancer tissue had an irregular shape and projection (Fig. 1A). To confirm that the cell isolated from the lung cancer tissue were TAMs without contamination by fibroblasts or tumor cells, staining for the macrophage specific marker CD68 was performed. Over ninety-five percent of the cells stained positively for CD68 (Fig. 1B). Real-time PCR was used to quantitate the levels of mRNA for IL-10 and IL-12 in 8 pairs of TAMs and their matched monocytes (Fig. 1C and D). The TAMs produced high amounts of IL-10 but not IL-12. Thus, the TAMs isolated from lung cancer tissue might have an M2 macrophage phenotype. 3.3. TAMs overexpressed invasion and metastasis-related cytokines We then characterized the biologic behavior of TAMs derived from primary non-small cell lung cancer tissues. The mRNA expression levels of several genes associated with cell invasion, angiogenesis, extracellular matrix remodeling and metastasis were analyzed using real-time PCR in TAMs and matched monocytes from the 98 patients. Compared with the expression in monocytes, Cathepsin K, MMP-9, uPA, VEGF, PDGF, HGF and COX-2 were

significantly upregulated in TAMs (Fig. 2). The expression levels of each upregulated gene are shown in Table 1. EGF was significantly downregulated compared with monocytes ((0.63 ± 11.3) vs. (1.0 ± 0.03), p = 0.002)). There were no significant differences in the level of Cathepsin S between the TAMs (1.5 ± 2.0) and the monocytes (1.0 ± 0.02) (p = 0.209) (Fig. 2). 3.4. Correlations between the clinicopathological factors and expression of MMP-9, uPA, VEGF, COX-2, PDGF, Cathepsin K, and HGF by tumor-associated macrophages in NSCLC There were no significant correlations between the expression of MMP-9, uPA, VEGFA, COX-2, PDGF-B, Cathepsin K, and HGF by TAMs and sex, tobacco use, visceral pleural invasion and histologic subtypes (all p > 0.05). The MMP-9, VEGFA expression by TAMs was significantly higher in the late stage than the early stage. There were no significant differences between uPA, COX-2, PDGF-B, Cathepsin K, and HGF expression and stage. When multivariate logistic regression analysis was performed, patients with higher expression of MMP-9 in TAMs showed an increased risk for late-stage disease (Table 3). The MMP-9, VEGFA expression by TAMs in patients with lymph node metastasis was significantly higher than those without metastasis (p = 0.01, and 0.007 respectively). Patients with LVI had high levels of MMP-9, uPA and VEGFA expression by TAMs, with a P value of 0.04, 0.008 and 0.023 respectively.u-PA expression but not MMP-9, VEGFA on TAM was significantly associated with poor differentiation (P = 0.0001).

194

R. Wang et al. / Lung Cancer 74 (2011) 188–196

Fig. 4. Effects of conditioned medium from TAM (TAM-CM) on lung cancer cell invasion. (A) Representative image show the SPC-A1, H460, A549 cells that invaded through the Matrigel. (B–D) Changes of invasiveness in lung cancer cells. *p < 0.001, TAM-CM compared with RPMI1640 Medium. # p > 0.05, ## p < 0.001 (TAM-CM supplemented with mAb compared with TAM CM) (all by Student’s t-test). (E) Gelatin zymogram of lung cancer cells (H460, SPC-A1 and A549) cultivated in the presence (T) or in the absence (C) of TAM-CM. The white bands were decomposed gelatin by gelatinase. RPMI 1640 used as negative control (N). TAM-CM used as a positive control. Triplicate independent experiments were repeated.

3.5. CM from TAMs promoted lung cancer cell migration The effect of CM from TAMs on the cell mobility of several lung cancer cell lines (H460, A549, and SPC-A1) was tested by woundhealing assay. As shown in Fig. 3, SPC-A1, H460, and A549 cells grown in media conditioned by TAMs migrated more and covered more of the scratched area within 24 h than cells grown in media conditioned by lung cancer cells. 3.6. CM from TAMs promoted lung cancer cell invasion To assess the ability of CM from TAMs to promote lung cancer cell invasion, lung cancer cells (SPC-A1, H460, and A549) were placed in the top of a Transwell chamber. Invasion through the

Matrigel-coated membrane was assessed after 48 h in culture. CM from the TAMs significantly increased cell invasion in SPC-A1, H460 and A549 cells. Zymographic analysis was used to assess whether the increase of invasiveness of the lung cancer cell lines correlated with their gelatinase activity. Lung cancer cell lines H460, SPC-A1 and A549 were cultured with RPMI 1640 medium or TAMs-CM for 24 h and changed to serum free RPMI 1640 medium. After an overnight incubation, the medium derived from two groups were harvested and subjected to zymographic analysis. TAM-CM from primary lung cancer was chosen as a positive control. In our study, lung cancer cells (H460, SPC-A1 and A549) cultured with TAM-CM expressed higher MMP-9 than those incubated with regular medium. The secretion of MMP2 in the TAM CM treated group was not signif-

R. Wang et al. / Lung Cancer 74 (2011) 188–196

195

Table 3 Logistic regression analysis of the association between tumor stage groups and clinicopathological features (n = 98).

Sex Age Tobacco use Histology High VEGFA expression in TAM High MMP-9 expression in TAM

B

SEM

Chi-squared

p-Value

OR (95% CI)

−1.211 −0.015 0.244 0.026 0.706 1.096

0.726 0.025 0.358 0.362 0.549 0.545

2.784 0.328 0.464 0.005 1.661 4.039

0.095 0.567 0.496 0.942 0.197 0.044

0.298 (0.072–1.236) 0.986 (0.938–1.036) 1.276 (0.633–2.574) 1.027 (0.505–2.086) 2.03 (0.692–5.957) 2.992 (1.027–8.712)

The dependent variable was being in the early- or late-stage group. The independent variables included sex (1 = male; 2 = female), age (continuous variable, in yrs), tobacco use (0 = non-smoker, 1 = smoker), histology (1 = adenocarcinoma; 2 = squamous cell carcinoma; 3 = others), VEGFA expression (1 = low (<23.2); 2 = high (>23.2) and MMP-9 expression (1 = low (<33.3); 2 = high (>33.3). OR: odds ratio; CI: confidence interval.

icantly different compared with controls in all three lung cancer cell lines. To determine the importance of TAMs overexpressed cytokines in TAMs-stimulated-invasion, three of the most significantly upregulated cytokines (VEGF, MMP-9, uPA) activity was blocked with a neutralizing antibody respectively. We found that anti-uPA and anti-MMP-9, but not anti-VEGF monoclonal antibodies can inhibit the increase of invasiveness through Matrigel in different lung cancer cells (SPC-A1, H460, and A549) treated by TAM-CM (Fig. 4). Zometa, which can deplete both osteoclasts and macrophages, was shown to inhibit TAMs-stimulated-invasion in different lung cancer cells too. 3.7. Differentially expressed genes related to tumor invasion and metastasis in lung cancer cells (A549, H460 and SPC-A1) after co-culture with fresh isolated tumor-associated macrophages Because the lung cancer cells revealed a strong increase invasiveness response to TAMs isolated from NSCLC, we attempted to study the underlying molecular mechanisms by which TAMs may promote lung tumor invasion. The expression of 11 genes was evaluated in three lung cancer cell lines after co-culture with fresh isolated TAMs using a six-well plate transwell apparatus. MMP9 showed the greatest expression difference after co-culture with fresh isolated TAMs in all three lung cancer cell lines (Fig. 5). The result showed that TAMs promote lung cancer invasion possibly through upregulating the expression of MMP-9 in cancer cells. 4. Discussion In this study, we successfully achieved up to 95% purity of TAM, derived from 98 primary lung cancer tissues. TAM expressed high levels of Cathepsin K, COX-2, MMP-9, PDGF-B, uPA, VEGFA, and

HGF. Phenotypic expression on TAMs, like MMP9, VEGFA correlated with disease progression in NSCLC patients. Conditioned medium from TAMs significantly increased cell invasion and migration in SPC-A1 cells, H460 cells and A549 cells. Anti-uPA and anti-MMP-9, but not anti-VEGF monoclonal antibodies, can inhibit TAM-induced invasion. Although a few studies reported primary culture of TAMs from cancer tissue, there is no publication about lung cancer. In animal tumor models, the most frequently reported method is to surgically remove a tumor, mince it, and digest in collagenase with or without trypsin. After several washes, the cells are left to adhere in serum free RPMI 1640 medium for 1 h and then nonadherent cells are washed away. The remaining adherent cells are 90% TAM [25,28]. We isolated TAMs from human lung cancer tissue for the first time with the modification to previous reports. In our study, a shorter time of adherence (40 min) was used to prevent contamination of tumor cells, which have begun to adhere after 1 h, and we successfully achieved >95% purity of TAM. To explore gene changes during monocytes maturation to macrophages, several genes associated with TAMs were compared, including IL-12, IL-10, MMP-9, uPA, VEGF, COX-2, PDGF, Cathepsin S, Cathepsin K, and EGF. Among them, IL-10, MMP-9, uPA, VEGF, COX-2, PDGF, Cathepsin K, and HGF were found to be upregulated. It is well known that those genes involved in cancer progression. This might explain why TAMs failed to kill cancer cells after migrating into tumor stroma. They were probably ‘educated’ by the tumor cells, so that they adopted a trophic role that promoted cancer invasion and metastasis. In the present study, the role of TAMs expressing MMP-9, uPA, VEGF, COX-2, PDGF, Cathepsin K and HGF in the prognosis of NSCLC patients was investigated. The results indicated that expression of MMP-9, VEGFA were increased on TAMs of patients with late stage NSCLC compared with those with early stage NSCLC. In addition, the

Fig. 5. Cytokine gene expression levels in lung cancer cells (H460, SPC-A1 and A549) co-cultured with tumor-associated macrophages. Relative expression levels of Cahtepsin K, Cahtepsin B, Cahtepsin S, uPA, MMP-9, VEGF, PDGF, IL-10, HGF, COX-2, and EGF were analyzed by real-time PCR in lung cancer cells (A549, H460 and SPC-A1) co-cultured with tumor-associated macrophages relative to that without. Lung cancer cells cultivated without TAMs were used as a calibrator. Error bar represents SEM.

196

R. Wang et al. / Lung Cancer 74 (2011) 188–196

expression levels of MMP-9, VEGFA in TAMs were higher in patients with lymph node metastases than in those without. To the best of the authors’ knowledge, this study is the first to demonstrate that the phenotypic expression on TAMs, like MMP9, correlates with disease progression in NSCLC patients. The mechanism behind the pro-tumor progression of TAMs expressing MMP-9 might include the upregulation of MMP-9, which can serve to break down basement membrane and as a major contributor and a crucial factor triggering activation of quiescent vasculature [29]. In the present study, we demonstrated that CM from primary isolated TAMs can promote migration, invasion and matrixdegrading activity in lung cancer cell lines. Co-culture of lung cancer cells with TAMs can upregulate invasion and metastasis related genes in lung cancer cells. Accumulating evidence indicates that MMP-9 plays a critical role during tumor invasion and metastasis. MMP-9 activity can be regulated and activated by COX-2, uPA, and it also can stimulate the production of VEGF [30]. Our series of experiments indicated that the expression of MMP-9, VEGF, COX-2, uPA on TAM provides a suitable microenvironment for non-small lung cancer invasion and progression. These experiments included migration and invasion assay, gelatin zymography, co-culture systems and clinical sample analysis. Although this is the first paper of isolation, identification and characterization of TAM derived from primary lung cancer, these findings need to be interpreted with caution since the gene expression levels were evaluated in only 98 NSCLC across all stages, histologic subtypes. As large phagocytic cells, TAMs can produce a variety of cytokines. In the current study, only nine genes and their relationship with lung cancer progression were analyzed. There might be more other potential responsible molecules involved in cancer cells invasion and metastasis. For better understanding the TAMs derived cytokines in cancer progression, proteomics studies of TAMs using mass spectrometry are ongoing in our lab, and more functional and mechanism studies are needed. Conflict of interest None of the authors have conflicts of interest. Acknowledgments This work is supported, in part, by National Natural Science Foundation of China (30800404), Shanghai Rising-Star Program (09QA1401200), Pujiang Talent Grant, (to J. Z), Young Investigator Grant from Shanghai Municipal Health Bureau.and Basic-clinical medicine grant (to H-Q C). We thank Shannon Wyszomierski for her editorial assistance. References [1] Mantovani A, Allavena P, Sica A, Balkwill F. Cancer-related inflammation. Nature 2008;454:436–44. [2] Leek RD, Lewis CE, Whitehouse R, Greenall M, Clarke J, Harris AL. Association of macrophage infiltration with angiogenesis and prognosis in invasive breast carcinoma. Cancer Res 1996;56:4625–9. [3] Takanami I, Takeuchi K, Kodaira S. Tumor-associated macrophage infiltration in pulmonary adenocarcinoma: association with angiogenesis and poor prognosis. Oncology 1999;57:138–42. [4] Hanada T, Nakagawa M, Emoto A, Nomura T, Nasu N, Nomura Y. Prognostic value of tumor-associated macrophage count in human bladder cancer. Int J Urol 2000;7:263–9.

[5] Lissbrant IF, Stattin P, Wikstrom P, Damber JE, Egevad L, Bergh A. Tumor associated macrophages in human prostate cancer: relation to clinicopathological variables and survival. Int J Oncol 2000;17:445–51. [6] Murdoch C, Giannoudis A, Lewis CE. Mechanisms regulating the recruitment of macrophages into hypoxic areas of tumors and other ischemic tissues. Blood 2004;104:2224–34. [7] Coffelt SB, Hughes R, Lewis CE. Tumor-associated macrophages: effectors of angiogenesis and tumor progression. Biochim Biophys Acta 2009;1796: 11–8. [8] Mantovani A, Sica A, Sozzani S, Allavena P, Vecchi A, Locati M. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol 2004;25:677–86. [9] Giraudo E, Inoue M, Hanahan D. An amino-bisphosphonate targets MMP-9expressing macrophages and angiogenesis to impair cervical carcinogenesis. J Clin Invest 2004;114:623–33. [10] Marconi C, Bianchini F, Mannini A, Mugnai G, Ruggieri S, Calorini L. Tumoral and macrophage uPAR and MMP-9 contribute to the invasiveness of B16 murine melanoma cells. Clin Exp Metastasis 2008;25:225–31. [11] Stockmann C, Doedens A, Weidemann A, Zhang N, Takeda N, Greenberg JI, et al. Deletion of vascular endothelial growth factor in myeloid cells accelerates tumorigenesis. Nature 2008;456:814–8. [12] Schoppmann SF, Fenzl A, Nagy K, Unger S, Bayer G, Geleff S, et al. VEGF-C expressing tumor-associated macrophages in lymph node positive breast cancer: impact on lymphangiogenesis and survival. Surgery 2006;139: 839–46. [13] Vignaud JM, Marie B, Klein N, Plenat F, Pech M, Borrelly J, et al. The role of platelet-derived growth factor production by tumor-associated macrophages in tumor stroma formation in lung cancer. Cancer Res 1994;54:5455–63. [14] Galimi F, Cottone E, Vigna E, Arena N, Boccaccio C, Giordano S, et al. Hepatocyte growth factor is a regulator of monocyte–macrophage function. J Immunol 2001;166:1241–7. [15] Wyckoff J, Wang W, Lin EY, Wang Y, Pixley F, Stanley ER, et al. A paracrine loop between tumor cells and macrophages is required for tumor cell migration in mammary tumors. Cancer Res 2004;64:7022–9. [16] Gocheva V, Wang HW, Gadea BB, Shree T, Hunter KE, Garfall AL, et al. IL-4 induces cathepsin protease activity in tumor-associated macrophages to promote cancer growth and invasion. Genes Dev 2010;24:241–55. [17] Lindahl C, Simonsson M, Bergh A, Thysell E, Antti H, Sund M, et al. Increased levels of macrophage-secreted cathepsin S during prostate cancer progression in TRAMP mice and patients. Cancer Genomics Proteomics 2009;6:149–59. [18] Hansen T, Kirkpatrick CJ, Walter C, Kunkel M. Increased numbers of osteoclasts expressing cysteine proteinase cathepsin K in patients with infected osteoradionecrosis and bisphosphonate-associated osteonecrosis—a paradoxical observation? Virchows Arch 2006;449:448–54. [19] Nakao S, Kuwano T, Tsutsumi-Miyahara C, Ueda S, Kimura YN, Hamano S, et al. Infiltration of COX-2-expressing macrophages is a prerequisite for IL-1 beta-induced neovascularization and tumor growth. J Clin Invest 2005;115:2979–91. [20] Joyce JA, Pollard JW. Microenvironmental regulation of metastasis. Nat Rev Cancer 2009;9:239–52. [21] Chen JJ, Lin YC, Yao PL, Yuan A, Chen HY, Shun CT, et al. Tumor-associated macrophages: the double-edged sword in cancer progression. J Clin Oncol 2005;23:953–64. [22] Beasley MB, Brambilla E, Travis WD. The 2004 World Health Organization classification of lung tumors. Semin Roentgenol 2005;40:90–7. [23] Detterbeck FC, Boffa DJ, Tanoue LT. The new lung cancer staging system. Chest 2009;136:260–71. [24] Zhou Q, Suzuki K, Anami Y, Oh S, Takamochi K. Clinicopathologic features in resected subcentimeter lung cancer—status of lymph node metastases. Interact Cardiovasc Thorac Surg 2010;10:53–7. [25] Sierra JR, Corso S, Caione L, Cepero V, Conrotto P, Cignetti A, et al. Tumor angiogenesis and progression are enhanced by Sema4D produced by tumorassociated macrophages. J Exp Med 2008;205:1673–85. [26] Zhang J, Shen KW, Liu G, Zhou J, Shen Q, Shen ZZ, et al. Antigenic profiles of disseminated breast tumour cells and microenvironment in bone marrow. Eur J Surg Oncol 2003;29:121–6. [27] Heussen C, Dowdle EB. Electrophoretic analysis of plasminogen activators in polyacrylamide gels containing sodium dodecyl sulfate and copolymerized substrates. Anal Biochem 1980;102:196–202. [28] Duff MD, Mestre J, Maddali S, Yan ZP, Stapleton P, Daly JM. Analysis of gene expression in the tumor-associated macrophage. J Surg Res 2007;142:119–28. [29] Deryugina EI, Quigley JP. Matrix metalloproteinases and tumor metastasis. Cancer Metastasis Rev 2006;25:9–34. [30] Sun WH, Sun YL, Fang RN, Shao Y, Xu HC, Xue QP, et al. Expression of cyclooxygenase-2 and matrix metalloproteinase-9 in gastric carcinoma and its correlation with angiogenesis. Jpn J Clin Oncol 2005;35:707–13.