Two cDNAs coding for the porcine CD51 (αv) integrin subunit: Cloning, expression analysis, adhesion assays and chromosomal localization

Gene 481 (2011) 29–40

Contents lists available at ScienceDirect

Gene j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / g e n e

Two cDNAs coding for the porcine CD51 (αv) integrin subunit: Cloning, expression analysis, adhesion assays and chromosomal localization☆ Noemí Yubero, Ángeles Jiménez-Marín, Manuel Barbancho ⁎, Juan J. Garrido “Unidad de Genómica y Mejora Animal”, Departamento de Genética, Universidad de Córdoba, Campus de Rabanales, 14071 Córdoba, Spain

a r t i c l e

i n f o

Article history: Accepted 15 April 2011 Available online 27 April 2011 Received by A.J. van Wijnen Keywords: Pig CD51 Cloning Gene expression Adhesion assays Chromosomal localization

a b s t r a c t CD51 (αv) is an integrin chain that associates with multiple β integrin chains to form different receptor complexes that mediate important human processes. Pigs show substantial physiological, immunological and anatomical similarities to humans, and are therefore a good model system to study immunological and pathological processes. Here we report the cloning and characterization of two cDNAs produced by alternative splicing that encode two different porcine CD51 proteins that differ in five amino acid residues. Pig CD51 cDNAs encode polypeptides of 1046 or 1041 amino acid residues, respectively, that share with other mammalian homologous proteins a high percentage amino acid identity and the functional domains. Expression analysis of CD51 was carried out at two different levels. RT-PCR analysis revealed that both CD51 transcripts were expressed ubiquitously but heterogeneously, with the exception of some platelets in which only the smallest CD51 transcript was detected. A specific monoclonal antibody against a pig CD51 recombinant protein was made and used in the immunohistochemical localization of CD51 proteins. It showed that CD51 was mainly expressed in hematopoietic cells of myeloid linage, epithelial and endothelial cells, osteoclasts, nervous fibers and smooth muscle. Adhesion assays showed that in the presence of Mn++ pig αv-CHO-B2 transfected cells increased their attachment to fibronectin and vitonectin, but not to fibrinogen. Finally, we localized the CD51 gene on the porcine chromosome 15 (SSC15), q23–q26. © 2011 Elsevier B.V. All rights reserved.

1. Introduction Integrins are a long family of heterodimeric transmembrane glycoproteins, consisting of varying combinations of noncovalently bound α and β chains generating several receptor complexes with different expression patterns and distinct ligand binding profiles (Hynes et al., 2002). To date, 18 α and 8 β chains that can form more than 20 functional combinations have been described, and most of the genes coding them have been cloned and sequenced (Hynes et al., 2002; Sheppard, 2003). Each integrin binds to only a limited series of ligands, ensuring that cell adhesion and migration are precisely regulated. The heterodimeric association of α and β subunits allows

Abbreviations: DIG, digoxigenin; DMSO, dimethylsulfoxide; DCT, Distal convoluted tubuli; EDTA, ethylene diamine tetraacetic acid; FB, Fibrinogen; FCS, fetal calf serum; FN, Fibronectin; HPA, human platelet alloantigen; IRES, internal ribosome entry site; mAb, monoclonal antibody; PBMC, peripheral blood mononuclear cells; PBS, phosphate buffered saline; PAM, pulmonary alveolar macrophages; PCT, Proximal convoluted tubuli; PIM, pulmonary intravascular macrophages; PMSF, phenyl methyl sulphonyl fluoride; PRP, platelet-rich plasma; RGD, arginine–glycine–aspartic acid; RT-PCR, reverse transcriptase polymerase chain reaction; TGF, Transforming growth factor; VTN, Vitronectin. ☆ Sequence data from this article have been deposited with the GenBank Data Libraries under Accession Nos.EU888270 and EU888271. ⁎ Corresponding author. Tel./fax: + 34 957 212195. E-mail address: [email protected] (M. Barbancho). 0378-1119/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2011.04.006

the integrins to act as bidirectional signaling molecules, mediating a wide variety of biological processes (Yamada, 1991). Mammalian integrins have been divided into sub-families according to their β subunit. αv chain has been associated with five β integrins (Sheppard, 2003) generating five different αVβx receptors that bind to a wide variety of extracellular matrix ligands: αVβ3 (CD51/CD61) to vitronectin, fibronectin, fibrinogen, thrombospondin, collagen, von Willebrand factor and osteopontin (Tomasini and Mosher, 1991; Horton, 1997), αVβ1 (CD51/CD29) to fibronectin, vitronectin, fibrinogen and osteopontin (Bodary and McLeaan, 1990; Vogel et al., 1990), αvβ5 and αvβ6 RGD-dependent integrins to vitronectin and fibronectin, respectively (Cheresh et al., 1989; Sheppard et al., 1990; Wada et al., 1996), and αvβ8 to vitronectin (Nishimura et al., 1994), and like αVβ6 for the LAP of TGF-β1 and -β3 (Cambier et al., 2000). On the other hand, αVβx integrins are used as receptors by different viruses: αVβ3 is used by the human adenovirus (Nemerow and Stewart, 1999), and by the foot-and-mouth disease virus in swine and cattle (Neff et al., 2000), αvβ1 seems to be also a receptor for foot-and-mouth disease virus (Jackson et al., 2002), and αvß5 has also been involved in the internalization of adenovirus (Nemerow and Stewart, 1999). Furthermore, αVβx integrins are involved in many other processes: αVβ3, in wound healing, arterial restenosis, osteoporosis, tumor angiogenesis and tumor progression (Brooks et al., 1994; Legler et al., 2004), αvß5, in tumor angiogenesis (Kumar et al., 2001), αVβ1, in fertilization (Linfor and Berger, 2000) and in cellular migration (Milner

30

N. Yubero et al. / Gene 481 (2011) 29–40

et al., 1996), αVβ6, in the regulation of renal fibrosis (Hahm et al., 2007), and αvβ8, in the inhibition of cell proliferation (Mu et al., 2002). Consequently, αv has been involved in many different and important functions. In fact, mice lacking αv integrins suffer malformations and embryonic or postnatal death (Bader et al., 1998). However, most of the studies related with αv integrin have been made in human and mouse tissues, but little is known about the expression of αv subunit in porcine tissues and cell types, although pig is generally accepted as an optimal experimental model which is being used in different areas as immunology, xenotransplantation, artherosclerosis, cancer or cardiovascular disease because of its similarity to humans (Misdorp, 2003; Lunney, 2007). So, the aim of this study was to clone and molecular characterize the full length cDNAs encoding the porcine αv (CD51) integrin, to study its expression pattern in a wide variety of porcine cells and tissues, to study the role of the expressed porcine αv integrin, and, additionally, to identify the chromosomal localization of the CD41 gene. 2. Materials and methods 2.1. Tissues and cells Porcine tissues were recovered from adult healthy pigs immediately after slaughtering at the local abattoir and frozen in liquid nitrogen until use. Peripheral blood mononuclear cells (PBMC) were isolated from heparinized whole blood using Ficoll-Hypaque (density 1077 g/ml, Sigma) centrifugation at 900 g for 30 min and washed twice in PBS. Porcine alveolar macrophages were collected by bronchoalveolar lavage, washed with Hanks buffer containing 2 mM EDTA, resuspended at 5 × 107 cells/ml in FCS containing 10% DMSO and frozen in liquid nitrogen until use. Porcine platelets were pelleted from platelet-rich plasma by centrifugation at 2200 rpm for 7 min and washed three times with PBS containing 5 mM EDTA. Platelets were pelleted from PRP by centrifugation at 2200 ×g for 7 min and washed three times with PBS containing 5 mM EDTA. 2.2. Porcine-specific CD51 probe A CD51 cDNA probe was synthesized by RT-PCR using 10 μg of total RNA from porcine pulmonary alveolar macrophages. 10 μg RNA, resuspended in 9.5 μl water, was heated for 3 min at 65 °C in the presence of random hexamers (7.5 μM final concentration; Pharmacia), then cooled in ice. RNA was reverse transcribed using 200 U of Moloney murine leukemia virus reverse transcriptase (GibcoBRL) for 1 h at 42 °C in a final volume of 20 μl containing 4 μl of 5× reverse transcriptase buffer, 25 U ribonuclease inhibitor (Roche), 1 μl 20 mM dNTP (Pharmacia) and 2 μl 0.1 M dithiothreitol. At the end of the

reaction, the solution was heated for 10 min at 95 °C and cooled in ice. 2 μl of this mixture was subjected to PCR using Tth DNA polymerase (Biotools) and two oligonucleotide primers (F7 and R8) based on the human and cattle CD51 cDNA sequences (Table 1). The amplification consisted in 35 cycles of PCR using Tth DNA polymerase (Biotools, Madrid, Spain) and each cycle consisted of incubations at 94 °C for 1 min, 52.1 °C for 1 min, and 72 °C for 1 min. The 597 bp amplified product was subcloned into pGEM-T vector (Promega, Madison, WI, USA) and sequenced using ABI PRISM Terminator Cycle Sequencing Kit (PE Applied Biosystems). 2.3. Screenings of pig cDNA library About 106 plaque forming units (pfu) of a porcine smooth muscle Uni-Zap XR vector cDNA library (Stratagene, La Jolla, CA, USA) was screened using the 597 bp CD51 specific probe labeled using PCR DIG Probe Synthesis Kit (Roche, Basel, Swizerland) according to the manufacturer instructions. The screening was performed as previously described by us (Jiménez-Marín et al., 2000). 20 positive clones were obtained, and from these the CD51–A14 clone, which contained the longest insert, was isolated as representative of the smaller CD51 cDNA. When we compared the CD51 coding sequence in CD51-14 clone with CD51from humans and cows we detected that the porcine one lacked of 15 bp in a site adjacent to the boundary between intron 25 and exon 26 from humans. Two new primers, CD51-F11 and CD51R12, flanking the lacked 15 bp (Table 1) were used to amplify mRNAs from different tissues by RT-PCR. When the PCR products were sequenced, two different transcripts were detected: one was lacking and the other was containing the 15 bp. As none of the clones isolated from the library contained the 15 bp, a second screening of the library was carried out with a homologous porcine CD51 230 bp long DIGlabeled probe, obtained by PCR with two new oligonucleotides (F13 and R14) deduced from the CD51–A14 clone sequence (Table 1). 20 new positive clones were obtained, from which 14 showed a positive amplification with F11/R12 primers. Four were sequenced; two contained the 15 bp and two lacked them. CD51–A2.5 clone was isolated as representative of the longer CD51 cDNA. 2.4. RNA isolation and RT-PCR analysis Total RNA from cells and tissues was purified according to the Tripure Isolation Reagent method (Roche) and quantified by adsorption spectrometry at A260/A280. RT-PCR was performed as described above in Section 2.2, using 20 μg of RNA from lymphoid (spleen, thymus, PBL, bone marrow, ganglion, alveolar macrophages and platelets) and nonlymphoid (lung, intestine, smooth muscle, testis, heart, uterus, skin, kidney and liver) tissues, and CD51-specific pairs of primers F7/R8, to

Table 1 Primers used in PCRs. Primers

Primer sequences 5′–3′

Template, localization (5′–3′)

Product size (bp)

Annealing temperature (°C)

F7 R8 F11 R12 F13 R14 SF1 SR1 RP-BamHI RP-HindIII CF1 CR2 TF1-EcoRI TR2-XhoI

TTGCAACCCATTCTTAACCA AACGTCTTCCTCAGTCTCAG TAGCTGCTGTTGAGATAAGAGG AAAACAAAAACAAATTCCAACATA CTTCGGCGATGGCTTCTCTG AGTGTTTGCTTTGGGTGCTC CACTTCAGATATGGAGATCAACCC CATTCAGCAATTCCACAACCC GGTCGGATCCGATTCAACCTAGACGTGGACAT GGTAAGCTTCTCAAACCCATTCAGCTTGGT TTACGCTACATCCTGACC ATTTAATAGCATGTGCCCAA CGCGAATTCGCGATGGCTTCTCTGCCGC CTTGAGCTCTTAAGTTTCTGAGTTTCCTTC

A2.5 cDNA, 2071–2667

597

52.2

A2.5 cDNA, 2567–3760

1194

58.0

A2.5 cDNA, 257–486

230

58.1

A2.5 cDNA, 2817–2984

168 and 153

54

A2.5 cDNA, 341–1343

1003 + 12

54.5

Genomic DNA, 3421–4006 in A2.5

586

48.1

A2.5 cDNA, 262–3405

3144

52.8

N. Yubero et al. / Gene 481 (2011) 29–40

generate a band of 597-bp, or new CD51-specific pairs of primers SF1/ SR1 to generate specific bands for the long (168-bp) or the small (153bp) CD51 transcripts (Table 1). Three replicates of RT-PCR analysis were carried out with no significant changes. RT-PCR on RNA 18S cDNA was used as a control. The 168-bp and 153-bp amplified products with SF1/ SR1 primers were electrophoresed using the high resolution electrophoresis GenePhor system following instructions of GeneGel HyRes Native Geles and GeneGel HyRes Native Buffer Kit (Amersham Pharmacia). Specific amplifications on cDNA form CD51–A2.5 (168-bp) and CD51/-14 (153-bp) were used as controls. CD51 specificity of the mRNA tissue amplifications was confirmed by blotting the PCR products onto a nylon membrane that was hybridized with the same 597-bp DIG-labeled probe used in the library screening (data not shown). 2.5. DNA sequencing and sequence analysis Sequencing was performed using ABI PRISM Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) on a thermal DNA cycler GeneAmp PCR System 2400 (Applied Biosystems, Foster City, CA, USA), according to the instructions of the manufacturer, and analyzed on an ABI PRISM 3100 Sequencer (Applied Biosystems, Foster City, CA, USA). Porcine CD51 sequences have been deposited at GenBank under numbers EU888270 and EU888271. Sequences were analyzed using the analysis software LaserGene (DNAstar, Londo, UK) and the analysis tools provided by the expasy website bhttp://www.expaxy. orgN. Primers design was performed with Oligo 6 (MBI, Cascade, CO, USA) and Amplify 3 (bhttp://www.engels.genetics.wisc.edu/amplify/N). Multiple alignment of deduced CD51 peptide sequences from pigs (EU888270 and EU888271), humans (M14648), cattle (AF239958), mice (U14135), chickens (M60517), zefrafish (DQ178648) and xenopus (U92006) was performed by using MUSCLE program (Edgar, 2004). Accession numbers correspond to GenBank. 5′ UTR and 3′ UTR motives in porcine CD51 cDNA were detected by using UTRScan program (bhttp://www.ba.itb.cnr.it/UTR/N), an internet resource for the functional analysis of 5′ and 3′ untranslated regions of eucariotic mRNAs (Mingone et al., 2005).

2.6. Recombinant CD51 protein (rpCD51) DNA encoding an extracellular domain of the porcine CD51 containing the putative functionally region was amplified by PCR from CD51/A2.5 clone. Primers used for amplification contained restriction sites (indicated underlined in Table 1) enabling ligation into the expression vector pET28b (Novagen) following digestion of the PCR product and the vector with BamHI and HindIII. Primers were as follows: (RP-BamHI and RP-HindIII). PCR product was ligated into the expression vector pET28b and used to transform Escherichia coli strain BL21 (DE3) (Novagen). Recombinant protein expression and purification were carried out following previously procedures described by us (Jiménez-Marín et al., 2000). 2.7. Monoclonal antibody production 5H2 monoclonal antibody was produced using previously described immunization and cell fusion procedures (Arce et al., 2002). Briefly, female BALB/c mice were immunized with 50 μg of rpCD51. Spleen cells from immune mice were fused with Sp2/0 myeloma cells. Hybridoma clones were selected on the basis of binding secreted antibody to rpCD61 by indirect ELISA. Antibody-producing hybridomas reacting positively were cloned at least twice by limiting dilution. Immunoglobulin classes and subclasses were determined in solid-phase ELISA using rabbit antisera specific for mouse heavy and light chains and a peroxidase-conjugated goat anti-rabbit immunoglobulin (Sigma). Monoclonal antibody 5H2 was of the IgM subclass.

31

2.8. Immunohistochemistry Expression of CD51 protein from healthy animals was studied following procedures previously described by us (Jiménez-Marín et al., 2000) using mAb 5H2 supernatant (1/1000 dilution in PBS) or an irrelevant mAb (as negative control). Briefly, all tissue specimens were fixed in Bouin liquid for 16 h. Tissues were dehydrated in ascending concentrations of ethanol and xylene and embedded in paraffin. Sections of 5 μm were placed on slides coated with Vectabound (Vector Laboratiores, Inc.). The tissue slides were kept at 55 °C for 45 min to improve the adherence of sections to glass, and then deparaffinized and rehydrated in xylene and descending concentrations of ethanol, respectively. Cells were washed several times in PBS, extended in slides treated with Vectabound (Vector Laboratories) and fixed in acetone (Sharlau) for 10 min. Endogenous peroxidase activity was inhibited with 3% hydrogen peroxidase. The sections were incubated with normal goat serum (1:10 dilution in PBS) (Vector), and after removing the serum, mAb 5H2 supernatant (1/1000 dilution in PBS) or an irrelevant mAb (as negative control) were added for 18 h at 4 °C in a wet chamber. The sections were incubated with biotinylated anti-mouse Ig (Dako) diluted 1/50 in PBS for 30 min at room temperature. Tissue sections were covered with avidin–biotin– peroxidase complex (Sigma) diluted 1/50 with PBS for 1 h in a wet chamber at room temperature, washed and then developed with 3, 3′diaminobenzidine (Sigma) (5 μg in 10 ml PBS). Sections were counterstained with Mayer hematoxylin and mounted with Eukitt. JM2E5 monoclonal antibody anti-porcine CD61used in this study was previously produced in our laboratory (Pérez de la Lastra et al., 1997). 2.9. Chromosome localization The INRA somatic cell hybrid panel (Yerle et al., 1996) was screened with porcine primers (CF1 and CR2), which specifically amplify a 586 bp fragment (Table 1). For genotyping of the hybrid panel, 10 ng of DNA from each cell line and control sample (pig, hamster, and mouse) was amplified using the same primers. PCR products were evaluated on a 1% agarose gel and individual cell lines were evaluated for the presence or absence of a fragment of the correct size. Statistical calculations of the assignment were performed using the software developed by Chevalet et al. (1997) (bhttp://www. inra.toulouse.frN). 2.10. Transfection of CD51 cDNA CHO-B2, a α5β1-deficient CHO cell line which expresses about 2% of the wild type level of α5β1 (Schreiner et al., 1989), was used for transfection experiments. A full pig CD51 integrin cDNA, which included the complete CD51 coding sequence, was generated by PCR using the primers TF1-EcoRI and TR2-XhoI (Table 1). The CD51 cDNA was cloned into the mammalian expression vector pcDNA3.1+ (Invitrogen, La Jolla, CA), and the plasmid DNA pCDNA3.1-CD51 was introduced into CHO-B2 cells by following the manufacturer′s instructions (Confast, MBL Dominion). Cells were split 24 h after transfection and grown in a medium supplemented with 800 μg/ml neomycin. The neomycin-resistant colonies were cloned and expanded, and pig CD51 expressing clones were identified by RT-PCR using specific primers, since the monoclonal anti-CD51 antibody we produced was no reactive in flow cytometry, and any of the human anti-CD51 assayed was cross-reactive. The parental vector pcDNA3.1+ was also transfected into CHO-B2 cells to generate control clones (B2 cells). 2.11. Cell adhesion assays The assays of cell adhesion to immobilized human fibronectin (Sigma), human vitronectin (Sigma) and porcine fibrinogen (Sigma)

32

N. Yubero et al. / Gene 481 (2011) 29–40

N. Yubero et al. / Gene 481 (2011) 29–40

33

Fig. 1. Nucleotide and deduced amino acid sequence of full-length porcine αv cDNA form CD51–A2.5 clone. The untranslated regions are shown in lower cases and the coding region is shown in upper cases. The start and the stop codons are in white boxes. The putative polyadenylation sequence is underlined. Signal peptide is marked in clear grey. Transmembrane domain is shown in underlined letters. Potential N-glycosylation sites are indicated in grey boxes. Cysteine residues are marked as C in grey. Putative cleavage sites are shown as ▲. The seven FG-GAP tandem repeats are shown in boxes with arrows marking their initial and final limits. Ca++ binding domains are remarked in clear grey boxes. Nucleotide sequences absent in clone CD51-14 are in bold letters. IRES sequence in 5′ UTR and K-Box in 3′ UTR are shown in cursive underlined letters.

3. Results

residues, five less than that encoded for CD51/A2.5 clone. The first 30 amino acid residues of CD51 are predominantly hydrophobic and correspond to the signal peptide sequence. So, the pig mature preCD51 molecule consists of 1016 amino acid residues (or 1011 in clone CD51/-14), and as this amino acid sequence has a proteolytic cleavage site (KR/D) located between amino acid residues 858 and 859 (Takada et al., 1989), the mature porcine CD51 polypeptides must be composed by two different chains (857 and 159 amino acid residues, the longest, and 851 and 159 the smallest) linked by disulfide bridges, similar to those reported in homologous CD51 integrins (Fitzerald et al., 1987; Bossy and Reichardt, 1990). Other sequences and structural and functional domains contained in other CD51 proteins were also present in the porcine CD51 chains (Figs. 1 and 2). When we used the UTRdb and UTRsite we found in the 5′ UTR sequence of porcine CD51 cDNA, an internal ribosome entry site (IRES) (GAGGCGCGGCGCTG) — which was absent in the CD51/-14 clone — corresponding to an internal ribosome binding sequence used in a mechanism of translation initiation alternative to the conventional 5′-cap dependent ribosome scanning mechanism, and in its 3′ UTR, a sequence that matches in the pattern K-Box (cTGTGATa).

3.1. Cloning and sequence analysis of the porcine CD51 cDNA

3.2. Comparative analysis

Two different cDNA sequences encoding the porcine CD51 were isolated, as described in Section 2. Both types of clones, CD51/A2.5 and CD51/-14 being representatives, contained a CD51 ORF, although two small stretch sequences were absent in CD51/-14 in comparison to that of CD51/A2.5: one in the 5′-UTR region and another one in the ORF that showed the loss of 15 nucleotides (Fig. 1). The complete cDNA sequences of the porcine CD51 mRNA contained in both clones have been deposited at GenBank under accession numbers EU888270 and EU888271 respectively. Sequence analysis of CD51/A2.5 revealed a 4255-bp cDNA sequence containing a 264-bp untranslated 5′ flanking region, a single open reading frame of 3140-bp encoding a polypeptide of 1046 amino acid residues and a 849-bp untranslated 3′ flanking region. The nucleotide sequence contained in clone CD51/-14 is 4232-bp long and differed from that of clone CD51/A2.5 in the absence of nucleotides G2 to G15 in the untranslated 5′ flanking region and nucleotides T2855 to A2869 in the ORF, which encoded a polypeptide of 1041 amino acid

The deduced protein sequence of the porcine CD51 was compared with the sequences of six different species: humans, cattle, mice, chickens, zebrafish and xenopus (Fig. 2 and Table 2). As shown in Table 2, the longest porcine CD51 protein shared 96% amino acid residues identity with that of cattle, 94% humans, 91% mice, 81.5% chickens, 69.5% Xenopus laevis and 57% with that of zebrafish. Table 2 also shows the percentages of amino acid residue identity that the different regions of the porcine CD51 share with those of these different species. The functional binding domains to RGD, Ca++ and fibrinogen in the extracellular region of porcine CD51, deduced from the human CD51 integrin (Suzuki et al., 1987), were also highly conserved.

were based on that described in Faull et al.(1993). 200 μl aliquots of 10 ng/ml of each protein in PBS, pH 7.4 were incubated inside the wells of a 96-well Immulon II plate (Dynatech Laboratories Inc, Chantilly, VA). After washing with PBS, the wells were blocked with 2% BSA in PBS for 2 h at room temperature. Cells were washed three times in PBS and resuspended at 106 cell/ml, and 50 μl aliquots were added to each coated well. To test the effect of Mn++ in the cell adhesion, the cells were preincubated in MnNa2 0.5 M in PBS for 30 min at room temperature and washed twice, before addition to the wells. After 2 h incubation at 37 °C and 5% CO2, the non-adherent cells were washed off with two rounds of gentle pipetting. The residual adherent cells were quantified with a colorimetric reaction using endogenous cellular acid phosphatase activity by adding 50 μl sustrate/lysis solution (6 mg/ml 4nitrophenylphosphate (Sigma) and 1% Triton X-100 (Sigma), in 50 mM sodium acetate buffer, pH 5.0) to each well. After a 1 h incubation at 37 °C, the reaction was terminated by the addition of 50 μl of 1 M NaOH and read in an ELISA plate reader with a 415 nm filter. Background values were determined in wells coated with 2% BSA.

3.3. Cell and tissue expression of porcine CD51 To investigate the pattern of porcine CD51 mRNA expression, RTPCR analysis was conducted with a variety of pig adult tissues and cell

34

N. Yubero et al. / Gene 481 (2011) 29–40

N. Yubero et al. / Gene 481 (2011) 29–40

35

Fig. 2. Comparison of amino acid sequences among the porcine CD51 and other homologous molecules. The sequences were derived from GenBank entries with accession numbers shown in Section 2. Signal peptide is in cursive letters. Heavy and light chains are shown by dark and clear grey lines, respectively. Ca++ binding domains are remarked in clear grey boxes in the upper part of the sequences. Potential N-glycosylation sites (N) and cysteine residues (C) are marked in grey in the respective sequences. Conserved motifs commented in the text are indicated in bold below the sequences. Amino acid residues absent in CD51/-14 clone (863–867) are underlined in the pig sequence.

types using F7/R8 gene-specific primers. CD51 expression was observed in all tissues and cells analyzed, although their levels were very heterogeneous (Fig. 3A). To study the tissue distribution of the two forms of the porcine CD51 transcripts, an RT-PCR analysis was carried out on the same tissue and cell types, although using SF1/SR1 specific primers to generate specific amplified bands of 168 bp for the longer CD51 mRNA and of 153 bp for the smaller one. As shown in Fig. 3B, both CD51 transcripts were found in all tissue and cell types analyzed, although a different level of expression was observed in them. However, interestingly, when platelets from different pig animals were analyzed in the same conditions, three samples of them showed only the small CD51 transcript (data not shown). The precise localization of the CD51 protein was studied by immunohistochemistry with the 5H2 monoclonal antibody developed using a porcine CD51 recombinant protein. The reactivity of this monoclonal antibody was tested on a variety of porcine tissue and cell types. The representative results of this immunohistochemical analyses are shown in Fig. 4. In platelets, reactivity with both 5H2 (anti-CD51) and JM2E5 (anti-CD61) monoclonal antibodies was detected (Figs. 4A and B). However, in polymorphonuclear leucocytes, reactivity was observed with 5H2 but not with JM2E5 (Figs. 4C and D).

In skin, reactivity with 5H2 was observed in all the stratums of the epidermis, being much more intense in both the apical and the basal ones (Fig. 4E). In mammary glands, the 5H2 antibody reacted in the epithelium internally covering the glandular ducts (Fig. 4F). In kidney, the epithelium from both the proximal (PCT) and distal (DCT) convoluted tubuli, and Henle's loop were stained with the 5H2 antibody (Fig. 4G). In cerebellum, the reactivity with 5H2 was restricted to cells in the white matter (Fig. 4H), showing the Purkinje cells a weak reaction (Fig. 4H′). In peripheric nervous, immunoreactivity in nervous fibers, made up of axons and mielinic covering, was detected (Fig. 4I). In lymph node, the monocytes were clearly labeled, whereas lymphoid cells did not show reactivity (Fig. 4J). In bone marrow, the CD51 expression was intense in osteoclasts, and weaker in megacariocytes (Fig. 4K). Finally, CD51 protein was also detected in endotelial cells from ovarium blood vessels (Fig. 4L). 3.4. Cell adhesion assays To study the role of the expressed porcine αv integrin, a full-length pig CD51 (αv) cDNA was introduced into α5β1-deficient CHO cells (B2) (Schreiner et al., 1989), and then the ability of the transfected cells to attach to immobilized fibronectin, vitronectin and fibrinogen was

36

N. Yubero et al. / Gene 481 (2011) 29–40

Fig. 3. A. Expression patterns of CD51 transcripts in different pig cells and tissues. RTPCR results with cDNA from platelets (P), peripheral mononuclear cells (PBMC), intestine (I), lung (L), ganglion (G), liver (Li), spleen (Sp), smooth muscle (Sm), skin (Sk), granulocytes (Gr), testis (T), pulmonary alveolar macrophages (PAM), heart (H), kidney (K), bone marrow (Bm) and uterus (U). 18S RNA amplification was used as a control. B. Expression patterns of long and small CD51 transcripts in different porcine cells and tissues by RT-PCR with SF1/SR1 primers and cDNA from the same cells and tissues described in A. Amplified bands were viewed using GenPhor electrophoresis system. Amplifications on DNA from CD51A2.5 and CD51/-14.3 clones were used as a control.

measured. As neither specific pig αv anibodies nor cross-reacting human αv antibodies existed, we used a primer pig CD51 specific RT-PCR to detect the CD51 transcripts into the transfected cells (data not shown). Since Mn++ ions are known to enhance ligand binding to several integrins (Jackson et al., 2000a,b) we determined the effect of Mn++ on the binding of cells to fibronectin, vitronectin and fibrinogen. Results are shown in Fig. 5. In the absence of Mn++ neither B2 nor B2/αv cells were able to attach to fibronectin. Nevertheless, when cells were grown in Mn++ media, both cell types were able to attach to it, although the transfected B2/αv cells showed a higher affinity for fibronectin than the B2 cells (2.25× vs. 1.65× compared with their controls). When we tested the ability of the transfected B2/αv cells to attach to vitronectin, we found that though cells grown without Mn++ were able to adhere to it with higher affinity than the B2 ones (2.75× vs. 1.5× compared with the respective controls), the presence of Mn++ increased significantly (4.25× vs. 2.9× compared with the respective controls) this attachment. When we tested the ability of the cells to attach to fibrinogen, neither B2 nor B2/αv cells were able to attach to it when compared with their controls. 3.5. Chromosome localization of porcine CD51 gene Chromosomal localization was carried out screening a pig–rodent somatic hybrid cell panel by PCR, using specific porcine CD51 primers. A specific amplification was observed in 5 (2, 4, 5, 16 and 23) of the 27 hybrid cells, which enabled us to localize the porcine CD51 gene in region q23–q26 of chromosome 15 (SSC15), with a probability of 0.97 and an error lower than 0.5%. 4. Discussion In the present study we have cloned and characterized two fulllength cDNAs for porcine CD51 (αv) integrin chains, being the first

time that two different CD51 transcripts were described in animal species. The porcine CD51 proteins share common structural elements, including cytoplasmic, transmembrane and extracellular domains and the position of the proteolytic cleavage sites, with the CD51 protein of other species. The complete conservation of the transmembrane and cytoplasmic regions in mammals must be noted, both exhibiting, in general, higher conservation than the extracellular one in all the species compared. On the other hand, both the 13 potential N-glycosylation sites and the 18 cysteine residues in the extracellular CD51 domain are also highly conserved among the species compared, most of them sharing 100% identity in mammals. Porcine CD51 also contains the four Ca++ binding domains, characteristics of α integrins, and the seven FG-GAP tandem repeats. All the functional binding domains to RGD, Ca++ and fibrinogen show in vertebrates percentages of identity near to or higher than 80%, in accordance with their essential roles in the activity of the CD51 protein. Also in the intracellular region, the GFFKR and PPQEE, involved in the activation of the heterodimeric integrin (Calderwood, 2004) and in the specificity of the binding to vitronectin and fibrinogen (Filardo and Cheresh, 1994), respectively, are highly conserved. On the other hand, it is interesting to note the existence of an internal ribosome entry site (IRES) in the 5′ UTR sequence of porcine CD51–A2.5 cDNA. IRES sequence has also been found in the 5′ UTR of some cellular mRNAs, such as human immunoglobulin heavy chain binding protein (BiP) mRNA (Le and Maizel, 1997) which forms a Y-type stem–loop structure followed by the AUG triplet. IRESs have not been described in any mRNA integrin sequence to date. On the other hand, there is evidence that αv integrins are developmentally regulated (Wada et al., 1996). For this reason, the detection of a K-box sequence in the 3′ UTR of the porcine CD51 transcripts, just after the stop triplet, could be of interest. K-boxes are present in one or more copies in the 3′ UTR of most members of the basic helix–loop–helix repressor family in metazoans, and mediate negative post-transcriptional regulation probably involving the formation of RNA–RNA duplexes with microRNAs (miRNA) (Lai et al., 1998; Lai, 2002). However, we have not found any reference related with miRNA involved in the control of integrin expression. To explain the origin of the two porcine CD51 proteins deduced by us, we compared the ORF sequences contained in both clones with both the genomic sequence of human CD51 gene and the CD51 cDNA sequence of mice (Fig. 6), and we deduced that the two porcine CD51 transcripts must be produced by an alternative splicing in the donor sequence of the intron 25. In fact, the same splicing sites used in humans to eliminate intron 25 seem to be used to splice the longest mature CD51 porcine transcript. However, the splicing sites that seem to be used to splice the smallest porcine CD51 transcript appear to be the same as those used in the only CD41 transcript described in mice to date (Wada et al., 1996), which also lacks the same five triplets. The intron/exon boundary GT/AG rules (Mount, 1982) support this hypothesis. The existence of alternative splicing in integrin transcripts has been described in both β (β1) and α integrins (α6, α7 and αIIb) (Melker and A. Sonnenberg, 1999). However, to date, it has not been described as an alternative splicing to produce different forms of αv integrin chains.

Table 2 Percentages of amino acid identities between the porcine (Po) CD51 constitutive blocks with those from humans (Hu), cattle (Ca), mice (Mi), chicken (Ch), zebrafish (Zf) and Xenopus laevis (Xe). Block

Po vs. Hu

Po vs. Ca

Po vs. Mi

Po vs. Ch

Po vs. Zf

Po vs. Xe

Overall Signal peptide Extracellular domain Transmembrane region Intracellular region

94.2 73.3 94.6 100 100

94.2 73.3 94.6 100 100

94.2 73.3 94.6 100 100

94.2 73.3 94.6 100 100

94.2 73.3 94.6 100 100

94.2 73.3 94.6 100 100

N. Yubero et al. / Gene 481 (2011) 29–40

37

Fig. 4. Immunohistochemical staining of formalin-fixed paraffin-embedded sections of different porcine tissues and extended cell types with 5H2 (anti-CD51) or JM2E5 (CD61) monoclonal antibodies. Platelets (40×) stained with 5H2 (A) and JM2E5 (B). Polymorphonuclear leucocytes (40×) stained with 5H2 (C) and JM2E5 (D). (E) Skin (40×). (F) Mammary gland (40×). (G) Kidney (40×). (H) Cerebellum (40×). (H′) Purkinje cells. (I) Femoral nerves (40×). (J) Lymph node (40×): Monocytes (MO). (k) Bone marrow (40×): Osteoclasts (Os) and megacariocytes (Mk). (L) Ovarian artery (40×): Tunica intima (TI), tunica elastica (TE) and tunica media (TM).

Both CD51 transcripts were, however, ubiquitously detected in all tissues and cells analyzed which is in accordance to previous results. This ubiquitous detection must be related with the variety of heterodimeric integrins in which it is involved. In fact, αv has been detected in all tissues, cellular differentiation stage, developmental phase or tumoral growth level studied (Wada et al., 1996). However, we have found that the level of porcine CD51 transcripts is higher in spleen, testis, kidney, liver, lung, ganglion and intestine, and lower in granulocytes and skin cells. On the other hand, the longest transcript was usually more present, with the exception of PBMC, bone marrow and uterus where both transcripts were detected at a similar level, and skin and granulocytes where the small transcript showed a higher

presence. The fact that both transcripts were detected in all tissues and cells analyzed increases the interest in the fact that in some platelet cells only the small CD51 transcript was detected. Differential expression of integrins by alternative splicing seems to be common and has been related with regulation of developmental stages (Melker and Sonnenberg, 1999). However, the five amino acids absent in the small form of pig CD51 protein seem not to affect any of the functional motifs, and the fact that the only CD51 form detected in mouse corresponds to the smaller in pig supports that both CD51 molecules must be functional. Nevertheless, all of these observations could suggest a different role for both CD51 transcripts in pigs, but this needs to be investigated, the same that if the IRES sequence — present

38

N. Yubero et al. / Gene 481 (2011) 29–40

Fig. 5. Adhesion of CHO-B2 (white boxes) and CHO-B2/αv transfected (grey boxes) cells grown in the presence (+ Mn) or absence of Mn++ to fibronectin (FN), vitronectin (VTN) and fibrinogen (FB). Non-coated wells were used as controls (C). Results are expressed as the mean absorbance at 415 nm of quadruplicate samples. Bars represent ±s.d.

in the longer, but not in the smaller mRNA — plays some role in their translation levels, or if any preference for CD51 α integrin to link to different β chains to form the different heterodimeric complexes exists. When we used immunohistochemisty to test accuracy of the CD51 protein localization we found that it was mainly detected in platelets, hematopoietic cells from the myeloid linage, epithelial cells, osteoclasts, nervous fibers, vascular endothelia and smooth muscle. αv, in association with different β chains, has been involved in many different functions as osteoclastogenesis, bone resorption, migration and activation of macrophages, angiogenesis or apoptosis (Lessey et al., 1992; McHugh et al., 2000; Stupack et al., 2001; Staquet et al., 2006). In platelets, αv integrin must be expressed in association with β3, detected by the anti-β3 mAb JM2E5 in this study, and previously detected by us with an anti-recombinant porcine β3 antibody (Jiménez-Marín et al., 2008). Although the function of the αvβ3 complex in platelets is not known, some authors have reported that the complex is involved in the coagulation process (Katagiri et al., 1995). We also detected αv integrin in monocytes and in alveolar macrophages, the same as in humans where αv is expressed in complexes with β3 and β5 (Blystone et al., 1994; Pons et al., 2005). We have also detected αv in both glandular and structural epithelial cells of all tissues analyzed, which can be associated with β3 (Jiménez-Marín et al., 2008), β6 or β8 (Huang et al., 1996). In the nervous system, αv has been detected in nervous fibers and myelin sheath from both central and periphery nerves, where the complex αvβ8 is associated with the interaction of the blood vessels with the parenchyma of the brain (McCarty et al., 2005). On the other hand, the angiogenesis processes are highly related with the expression of αv integrin (Eliceri and Cheresh, 1999) which can explain the αv expression — probably associated to β3— observed in this study in the endothelium and smooth muscle of the blood vessels. In fact, we have also detected a high expression of αv in human melanoma and mammary carcinoma with 5H2 (data not shown). Finally, we have detected a high expression of αv in osteoclasts, probably associated

with β1 and β3, the main receptors for the osteopontine. The expression of αv in bone reabsortion regions, and more precisely in osteoclasts, has also been detected in humans (Faccio et al., 1998; Staquet et al., 2006). To confirm the functionality of the pig αv integrin cDNA cloned, and as the same time, to study the role of the expressed porcine CD51 integrin, we assayed the ability of CHO-B2/αv(pig) transfected cells to attach to fibronectin, vitronectin and fibrinogen. Our results showed that transfected B2/αv cells increased their affinity for fibronectin and vitronectin but not for fibrinogen when they were grown in the presence of Mn++. As the endogenous αv in the CHO-B2 cells seems to be associated with β5 or β1 when the αv concentration exceeds that of β5, as is the case with the αv transfectants (Zhang et al., 1993), the increased attachment to fibronectin detected in the B2/αv transfected cells could be explained by the association of the pig αv with the endogenous β1 subunit to form the hybrid αv(pig)β1(hamster) fibronectin receptor. The same effect has been described in human αv CHO-B2transfected cells (Zhang et al., 1993). On the other hand, the B2/αv(pig) cells also showed higher affinity for vitronectin than the nontransfected ones. Even more, the αv(pig)-transfected cells showed much higher affinity for vitronectin than for fibronectin, specially when cells were grown with Mn++ ions. This suggests that in the transfected cells, αv(pig)β1(hamster) integrin, or another αv(pig) containing integrin, has a higher affinity for vitronectin than for fibronectin. This result is not in agreement with those of Zhang et al. (1993) which observed that the parental B2 cells attached to vitronectin with higher affinity than the human αv B2-transfected cells. However, Bodary and McLeaan (1990) have reported αvβ1 as a vitronectin receptor in a human embryonic kidney cell line, and Marshal et al. (1995) have detected that the adherence to both vitronectin and fibrinogen correlated closely with the αvβ1 expression in human melanoma cell lines that failed to express the αvβ3 receptor but express the αvβ1 one. On the other hand, we have observed that neither B2 nor B2/αv transfected cells showed affinity for fibrinogen. Finally, using PCR on DNA of the INRA somatic cell hybrid panel we have mapped the pig CD51 gene into swine chromosome 15 (SSC5), region D or q23–q26. This is in total concordance with heterologous painting data that have demonstrated the correspondence between SSC15q23–q26 and human chromosome 2 (HSAP 2), region 2q31–q32 where the human CD51 has been mapped together with genes GAD1, HOXD, GDF8 and STAT1 that have also been found in pig region 15q22–q26 (http://www-lgc.toulouse.inra.fr/pig/cyto/genmar/htm/ 15GM.HTM; http://www-lgc.toulouse.inra.fr/pig/compare/SSCHTML/ SSC15S.HTM). The chromosomal localization of the porcine CD51 (αv) gene by somatic cell hybrid mapping is also in concordance with that of ITGAV gene which has recently been mapped by RH mapping between markers CL356064 and CL360872 corresponding to a position of 75 cM on chromosome SSC15 (Bruun et al., 2008). Therefore, the chromosomal assignment of pig CD51 gene provides additional evidence of the conserved linkage homology in these chromosome regions among pigs and humans. In conclusion, our results are of particular interest because the pig is an animal model system for a variety of immunological, developmental

Fig. 6. Comparison of CD51 cDNA nucleotide sequences among porcine A2.5 and 14 clones, humans and mice. Sequences of introns correspond to the human CD51 genomic sequence. GT-AT rules are indicated in grey boxes.

N. Yubero et al. / Gene 481 (2011) 29–40

and pathological studies. Thus, αv integrins have a differential expression in normal tissues and tumors and several authors have found that the altered expression of integrins can change their adhesive properties and biological behavior. Additionally, adenovirus internalization involves interaction with αvβ3 and αvβ5 (Nemerow and Stewart, 1999), and αvβ3 seems to be the only integrin that acts as receptor for the internalization of FMDV (Berinstein et al., 1995), besides those other αv integrins, like αvβ6 (Jackson et al., 2000b) and αvβ1 (Jackson et al., 2002), could serve as cellular receptors for it. So, our work contributes to the knowledge about the similarity between swine and human surface integrin receptors, key information in the context of the pig as a model to study different diseases. Acknowledgments The authors thank Dr. Juliano (Department of Pharmacology, University of North Caroline School of Medicine) who generously provided CHO-B2 cells used in this study, and Reyes Álvarez and María Friend for excellent technical assistance. This work was supported by the Spanish Ministry of Science and Technology, grant no. AGL200200529. References Arce, C., Moreno, A., Millán, Y., de las Mulas, J. Martín, Llanes, D., 2002. Production and characterization of monoclonal antibodies against dog immunoglobulin isotypes. Vet. Immunol. Immunopathol. 88 (1–2), 31–41. Bader, B.L., Rayburn, H., Crowley, D., Hynes, R.O., 1998. Extensive vasculogenesis, angiogenesis, and organogenesis precede lethality in mice lacking all alpha V integrins. Cell 95, 507–519. Berinstein, A., Roivainen, M., Hovi, T., Mason, P.W., Baxt, B., 1995. Antibodies to the votronectin receptor (integrin αvβ3) inhibit binding and infection of boot-andmouth disease virus to cultured cells. J. Virol. 69, 2664–2666. Blystone, S.D., Graham, I.L., Lindberg, F.P., Brown, E.J., 1994. Integrin alpha V beta 3 differentially regulates adhesive and phagocytic functions of the fibronectin receptor alpha 5 beta 1. J. Cell Biol. 127 (4), 1129–1137. Bodary, S.C., McLeaan, J.W., 1990. The integrin β1 subunit associates with the vitronectin receptor αv subunit to form a novel vitronectin receptor in a human embryonic kidney cell line. J. Biol. Chem. 265, 5938–5941. Bossy, B., Reichardt, L.F., 1990. Chick integrin alpha V subunit molecular analysis reveals high conservation of structural domains and association with multiple subunits in embryo fibroblasts. Biochem. 29 (44), 10191–10198. Brooks, P.C., et al., 1994. Integrin αvβ3 antagonists promote tumor regression by inducing apoptosis of angiogenic blood vessels. Cell 79, 1157–1164. Bruun, C.S., et al., 2008. Phenotypic and genetic characterization of a novel phenotype in pigs characterized by juvenile hairlessness and age dependent emphysema. BMC Genomics 9, 283. Calderwood, D.A., 2004. Integrin activation. J. Cell Sci. 117, 657–666. Cambier, S., et al., 2000. A role for the integrin αvβ8 in the negative regulation of epithelial cell growth. Cancer Res. 60, 7084–7093. Cheresh, D.A., Smith, J.W., Cooper, H.M., Quaranta, V., 1989. A novel vitronectin receptor integrin (αVβ5) is responsible for distinct adhesive properties of carcinoma cells. Cell 58, 59–69. Chevalet, C., Gouzy, J., San Cristóbal-Gaudy, M., 1997. Regional assignment of genetic markers using a somatic cell hybrid panel: a WWW interactive program available for the pig genome. Comput. Appl. Biosci. 13 (1), 69–73. Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32 (5), 1792-1297. Eliceri, B.P., Cheresh, D.A., 1999. The role of alpha V integrins during angiogenesis: insights into potential mechanisms of action and clinical development. J. Clin. Invest. 103 (9), 1227–1230. Faccio, R., Grano, M., Colucci, S., Zallone, A.Z., Quaranta, V., Pelletier, A.J., 1998. Activation of alpha beta3 integrin on human osteoclast-like cells stimulates adhesion and migration in response to osteopontin. Biochem. Biophys. Res. Commun. 249 (2), 522–525. Faull, R.J., Kovach, N.L., Harlan, J.M., Ginsberg, M.H., 1993. Affinity modulation of integrin α5β1: regulation of the functional response by soluble fibronectin. J. Cell Biol. 121 (1), 155–163. Filardo, E.J., Cheresh, D.A., 1994. A β turn in the cytoplasmic tail of the integrin αv subunit influences conformation and ligand binding of αvβ3. J. Biol. Chem. 269, 4641–4647. Fitzerald, L.A., et al., 1987. Comparison of cDNA-derived protein sequences of human fibronectin and vitronectin receptor alpha-subunits and platelets glycoprotein IIb. Biochem. 26 (25), 8158–8165. Hahm, K., et al., 2007. αvß6 integrin regulates renal fibrosis and inflammation in Alport mouse. Am. J. Pathol. 170, 110–125. Horton, M.A., 1997. The αvβ3 integrin “vitronectin receptor”. Int. J. Biochem. Cell Biol. 29, 721–725.

39

Huang, X.Z., et al., 1996. Inactivation of the integrin beta6 subunit gene reveals a role of epithelial integrins in regulating inflammation in the lung and skin. J. Cell Biol. 133 (4), 921–928. Hynes, R.O., Lively, J.C., McCarty, J.H., Taverna, D., Xiao, Q., Hodivala-Dilke, K., 2002. The diverse roles of integrins and their ligands in angiogenesis. Cold Spring Harb. Symp. Quant. Biol. 67, 143–153. Jackson, T., et al., 2000a. Foot-and-mouth disease virus is a ligand for the high-affinity binding conformation of integrin α5β1: influence of the leucine residue within the RGD motif on selectivity of integrin binding. J. Gen. Virol. 81, 1383–1391. Jackson, T., Sheppard, D., Denyer, M., Blakemore, W.E., King, A.M.Q., 2000b. The epithelial integrin αvβ6 is a receptor for foot-and-mouth disease virus. J. Virol. 74, 4949–4956. Jackson, T., Paul Mould, A., Sheppard, D., King, A.M.Q., 2002. Integrin αvβ1 is a receptor for foot-and-mouth disease virus. J. Virol. 76/3, 935–941. Jiménez-Marín, A., Garrido, J.J., De Andrés, D.F., Morera, L., LLanes, D., Barbancho, M., 2000. Molecular cloning and characterization of the pig homologue to human CD29, the integrin β1 subunit. Transplant. 70 (4), 649–655. Jiménez-Marín, A., et al., 2008. Molecular characterization and expression analysis of the gene coding beta3 integrin subunit (CD61). Gene 408, 9–17. Katagiri, Y., Hiroyama, T., Akamatsu, N., Suzuki, H., Yamazaki, H., Tanoue, K., 1995. Involvement of alpha V beta 3 integrin in mediating fibrin gel retraction. J. Biol. Chem. 270 (4), 1785–1790. Kumar, C.C., et al., 2001. Inhibition of angiogenesis and tumor growth by SCH221153, a dual α(v)ß3 and α(v)ß5 integrin receptor antagonist. Cancer Res. 61, 2232–2238. Lai, E.C., 2002. Micro RNAs are complementary to 3′ UTR sequence motifs that med post-transcriptional regulation. Nat. Genet. 30, 363–364. Lai, E.C., Burks, C., Posakony, J.W., 1998. The K box, a conserved 3′ UTR sequence motif, negatively regulates accumulation of enhancer of split complex transcripts. Development 125, 4077–4088. Le, S.Y., Maizel Jr., J.V., 1997. A common RNA structural motif involved in the internal initial of cellular mRNAs. Nucleic Acids Res. 25, 362–369. Legler, D.F., Johnson-Léger, C., Wiedle, G., Bron, C., Imhof, B.A., 2004. The αvβ3 integrin as a tumor homing ligand for lymphocytes. Eur. J. Immunol. 34, 1608–1616. Lessey, B.A., et al., 1992. Integrin adhesion molecules in the human endometrium. Correlation with the normal and abnormal menstrual cycle. J. Clin. Invest. 90 (1), 188–195. Linfor, J., Berger, T., 2000. Potential role of alpha V and beta 1 integrins as oocyte adhesion molecules during fertilization in pigs. J. Reprod. Fertil. 120, 65–72. Lunney, J.K., 2007. Advances in swine biomedical model genomics. Int. J. Biol. Sci. 3 (3), 179–184. Marshal, J.F., Rutherford, D.C., McCartney, A.C., Mitjans, F., Goodman, S.L., Hart, I.R., 1995. αvβ1 is a receptor for vitronectin and fibrinogen, and acts with α5β1 to mediate spreading on fibronectin. J. Cell Sci. 108, 1227–1238. McCarty, J.H., et al., 2005. Selective ablation of alphav integrins in the central nervous system leads to cerebral hemorrhage, seizures, axonal degeneration and premature death. Development 132 (1), 165–176. McHugh, K.P., et al., 2000. Mice lacking beta3 integrins are osteoclorotic because of dysfunctional osteoclasts. J. Clin. Invest. 105 (4), 433–440. Melker de, A.A., Sonnenberg, A., 1999. Integrins: alternative splicing as a mechanism to regulate ligand binding and integrin signalling events. Bioessays 21 (6), 499–509. Milner, R., Eduards, G., Streuli, C., French-Constant, F., 1996. A role in migration for αvβ1 integrin expressed on oligodendrocyte precursors. J. Neurosci. 16, 7240–7252. Mingone, F., et al., 2005. UTRdb and UTRsite: a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNNs. Nucleic Acid Res. 33, D141–D146 Database issue. Misdorp, W., 2003. Congenital and hereditary tumors in domestic animals, 2 pigs: a review. Vet. Q. 25, 17–30. Mount, S.M., 1982. A catalogue of splice junction sequences. Nucleic Acids Res. 10, 459–472. Mu, D., et al., 2002. The integrin alpha(v)beta8 mediates epithelial homeostasis through MT1-MMP-dependent activation of TGF-beta1. J. Cell Biol. 157, 493–507. Neff, S., Mason, P.W., Baxt, B., 2000. High-efficiency utilization of the bovine integrin αvβ3 as a receptor for foot-and-mouth disease virus is dependent on the bovine β3 subunit. J. Virol. 74 (16), 7298–7306. Nemerow, G.R., Stewart, Ph.L., 1999. Role of alpha (v) integrins in adenovirus cell entry and gene delivery. Microbiol. Mol. Biol. Rev. 63, 725–734. Nishimura, Sl, Sheppard, D., Pytela, R., 1994. Integrin alpha V beta 8. Interaction with vitronectin and functional divergence of the beta 8 cytoplasmic domain. J. Biol. Chem. 269, 28708–28715. Pérez de la Lastra, J.M., Moreno, A., Pérez, J., Llanes, D., 1997. Characterization of the porcine homologue to human platelet glycoprotein IIb–IIIa (CD41/CD61) by a monoclonal antibody. Tissue Antigens 49, 588–594. Pons, A.R., Noguera, A., Blanquer, D., Sauleda, J., Pons, J., Agustí, A.G.N., 2005. Phenotypic characterization of alveolar macrophages and peripheral blood monocytes in COPD. Eur. J. Respir. Dis. 25 (4), 647–652. Schreiner, C.L., Bauer, J.S., Danilov, Y.N., Hussein, S., Sczekan, M.M., Juliano, R.L., 1989. Isolation and characterization of Chinese hamster ovary cell variant deficient in the expression of fibronectin receptor. J. Cell Biol. 109 (6 Pt 1), 3157–3167. Sheppard, D., 2003. Functions of pulmonary epithelial integrins: from development to disease. Physiol. Rev. 83, 673–686. Sheppard, D.C., Rozzo, C., Starr, L., Quaranta, V., Erle, D.J., Pytela, R., 1990. Complete aminoacid sequence of a novel integrin β subunit (β6) identified in epithelial cells using the polymerase chain reaction. J. Biol. Chem. 265, 11502–11507. Staquet, M.J., et al., 2006. Expression and localization of alphav integrins in human odontoblasts. Cell Tissue Res. 323 (39), 457–463. Stupack, D.G., Puente, X.S., Boutsaboualoy, S., Storgard, C.M., Cheresh, D.A., 2001. Apoptosis of adherent cells by recruitment of caspase-8 to unligated integrins. J. Cell Biol. 155, 459–470.

40

N. Yubero et al. / Gene 481 (2011) 29–40

Suzuki, S., Argraves, W.S., Arai, H., Languino, L.R., Pierschbacher, M.D., Ruoslahti, E., 1987. Amino acid sequence of the vitronectin receptor alpha subunit and comparative expression of adhesion receptor mRNAs. J. Biol. Chem. 262 (29), 14080–14085. Takada, Y., Elices, M.J., Crouse, M.E., Helmer, C., 1989. The primary structure of the alpha 4 subunit of VLA-4: homology to other integrins and a possible cell–cell adhesion function. EMBO J. 8 (5), 1361–1368. Tomasini, R., Mosher, D.F., 1991. Vitronectin. Prog. Hemost. Thromb. 10, 269–305. Vogel, B.E., Tarone, G., Giancotti, F.G., Gailit, J., Ruoslahti, E., 1990. A novel fibronectin receptor with an unexpected subunit composition (αVβ1). J. Biol. Chem. 265, 5934–5937.

Wada, J., et al., 1996. Cloning of mouse integrin αv cDNA and role of αv-related matrix receptors in metanephic development. J. Cell Biol. 132 (6), 1161–1176. Yamada, K.M., 1991. Adhesive recognition sequences. J. Biol. Chem. 266, 12809–12812. Yerle, M., et al., 1996. A somatic cell hybrid panel for pig regional gene mapping characterized by molecular cytogenetics. Cytogenet. Cell Genet. 73 (3), 194–202. Zhang, Z., Morla, A.O., Vuory, K., Bauer, J.S., Juliano, R.L., Ruoslahti, E., 1993. The αvβ1 integrin functions as a fibronectin receptor but does not support fibronectine matrix assembly and cell migration on fibronectin. J. Cell Biol. 122 (1), 235–242.