Two different clades of copia-like retrotransposons in the red alga, Porphyra yezoensis

Gene 424 (2008) 153–158

Contents lists available at ScienceDirect

Gene j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / g e n e

Methods paper

Two different clades of copia-like retrotransposons in the red alga, Porphyra yezoensis Suresh Peddigari a,1, Wenbo Zhang a, Katsuaki Takechi a, Hiroyoshi Takano a, Susumu Takio b,⁎ a b

Graduate School of Science and Technology, Kumamoto University, Kurokami, Kumamoto 860-8555, Japan Center for Marine Environment Studies, Kumamoto University, Kurokami, Kumamoto 860-8555, Japan

a r t i c l e

i n f o

Article history: Received 15 December 2007 Received in revised form 16 July 2008 Accepted 21 July 2008 Available online 25 July 2008 Keywords: Transposable element Reverse transcriptase Integrase Rhodophyta

a b s t r a c t A copia-like retrotransposon referred to as PyRE1G1 was isolated from the genome of the red alga Porphyra yezoensis. PyRE1G1 is 4807 bp in length, with 204 bp long terminal repeats (LTRs) at both ends. PyRE1G1 has an open reading frame of 1401 residues encoding gag, protease, integrase, reverse transcriptase (RT), and RNase H. From the order of gene arrangement of proteins, PyRE1G1 appears to be a copia-like retrotransposon. Genomic Southern blot analysis suggests that PyRE1G1 consists of a small gene family. From the phylogenetic tree of RT sequences, PyRE1G1 is grouped in the clade of usual copia elements and distinct from the previously isolated red algal copia-like gene PyRE10G in that the latter is closely related to a new clade of aquatic animal-specific copia-like retrotransposons. © 2008 Elsevier B.V. All rights reserved.

1. Introduction Retrotransposons, which transpose through the reverse transcription of their mRNA intermediate, are the most abundant and widespread class of eukaryotic transposable elements (Kumar et al., 1999). They are separated into two broad groups, the long terminal repeat (LTR) and non-LTR retrotransposons. LTR retrotransposons encode a nucleic acid-binding protein (gag) and enzymatic polyproteins (protease, integrase, reverse transcriptase (RT), and RNase H). They are further classified into two major families, the Ty1/copia and Ty3/gypsy groups, which are referred to hereafter as the copia and gypsy groups, respectively. Both can be distinguished by inversed order of the gene arrangement of integrase and RT/RNase H. Non-LTR retrotransposons also consist of two groups, long interspersed elements (LINEs) and short interspersed elements (SINEs). LINEs encode an RT and often an endonuclease, while SINEs lack a discernable open reading frame. Both LTR and non-LTR retrotransposons are widely distributed among vascular plants, but less is known about retrotransposons from algae.

Abbreviations: cDNA, DNA complementary to RNA; CTAB, hexadecyltrimethyl ammonium bromide; DIG, digoxigenin; dNTP, deoxyribonucleoside triphosphate; LINE, long interspersed element; LTR, long terminal repeat; ORF, open reading frame; PCR, polymerase chain reaction; LA PCR, long and accurate PCR; RT, reverse transcriptase; SINE, short interspersed element; bp, base pairs; U, unit(s); h, hour(s); s, second(s). ⁎ Corresponding author. Tel.: +81 96 342 3443; fax: +81 96 342 3443. E-mail address: [email protected] (S. Takio). 1 Present address: Department of Cell and Developmental Biology, Anschutz medical campus, University of Colorado Denver, P.O. BOX 6511, MS-8108, Aurora, CO-80045, USA. 0378-1119/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2008.07.021

Phylogenetic studies of RT sequences have suggested that retrotransposons are derived from bacterial RTs and that non-LTR retrotransposons are older than LTR elements (Xiong and Eickbush, 1990; Malik and Eickbush, 2001). However, there is no information about when and how the different order of gene arrangement between copia- and gypsy-elements was constructed. Characterization of LTR retrotransposons in primitive eukaryotes is necessary to understand the evolutionary history of LTR retrotransposons. Fulllength sequences of LTR retrotransposons have been reported for green algae including Volvox (Lindauer et al., 1993) and Chlamydomonas (Perez-Alegre et al., 2005), cryptomonad algae (Khan et al., 2007) and the diatom Thalasssiosira (Kohany et al., 2006). By contrast, the small unicellular red alga Cyanidioschyzon merolae does not possess LTR retrotransposons (Nozaki et al., 2007). We have recently identified two genes encoding copia-like RTs referred to as PyRE2A (Zhang et al., 2006) and PyRE10G (Peddigari et al. 2008) in the red macro alga Porphyra yezoensis. However, both elements showed an unusual gene structure. PyRE2A contained only RT and RNase H genes and lacked other polyprotein genes. PyRE10G encoded all five protein genes, showing its gene arrangement to that of a copia element. Amino acid sequences of RT and RNase H also support that PyRE10G belongs to a copia group. However, PyRE10G integrase was more related to gypsy than copia retrotransposons. Since both elements contain stop codon(s) in the putative ORF, it remains possible that the unusual structure of these elements is derived from degeneration of the gene. Here we report a retrotransposon gene of P. yezoensis named PyRE1G1 that possesses the typical gene structure of copia elements of seed plants. Most recently, we found that PyRE10G is closely related to a new clade of copia retrotransposons distributed only among aquatic

154

S. Peddigari et al. / Gene 424 (2008) 153–158

Leafy gametophytes of P. yezoensis Ueda (strain TU-1, Kuwano et al. 1996) were kindly provided by Prof. N. Saga (Hokkaido Univ., Japan). The cultures were grown in a medium containing 3.5% (w/v) Sealife powder (Marintech Co., Ltd. Japan) and 1% (v/v) ESS2 stock solution (pH 8.0) (Nikaido et al., 2000). The concentration of nitrate in the medium was changed to 2.8 mM. The gametophytes were maintained at 15 °C on a photoregime of 10-h light/14-h dark with illumination from cool white fluorescent lamps (4500 lx) and constant air bubbling. Young gametophytes (less than 3 cm in length) germinated from monospores were used as samples.

a 50 μl reaction mixture containing 2 μl self ligated DNA, 200 μM dNTPs, 5 μl blend buffer, 20 pmol of each forward and reverse primers, and 0.5 μl of Taq polymerase (2.5 U/μl). The conditions used were: initial denaturation temperature 94 °C for 5 min, 35 cycles of 96 °C for 1 min, 60 °C for 1 min, and 72 °C for 3 min. Final elongation was at 72 °C for 7 min. The resulting PCR fragments were screened by Southern hybridization and sequenced. The full-length element was isolated from genomic DNA using the two step-LA PCR method as described previously (Peddigari et al., 2008) with the primer set of RE1G1-F1: 5′-GGCCATGTTGTGGGGTACGGTCTG-3′) and (RE1G1-R1: 5′-GTCCACATGACCCATGGCCTGTTACG-3′). The PCR product, about 4.8 kb was cloned into the pT7Blue vector using a TA cloning kit (Invitrogen, USA) and sequenced with the CEQ® 2000XL DNA analysis system (Beckman Coulter, USA). The nucleotide sequence of PyRE1G1 was entered into the DDBJ,EMBL, and GenBank databases with the accession number AB371726.

2.2. Isolation of PyRE1G1

2.3. Southern hybridization

Total DNA was extracted with a buffer containing 100 mM Tris– HCl, 1.5 M NaCl, 20 mM EDTA, and 2% hexadecyltrimethyl ammonium bromide (CTAB) according to the method of Apt and Grossman (1993). One microgram of genomic DNA was digested with restriction enzymes (10 U) and self ligated with solution I from a ligation kit (Takara Bio, Japan) overnight at 14 °C. In our previous study, a 287 bp DNA fragment (PyRE1) encoding part of the RT region was isolated by genomic PCR from P. yezoensis. (Zhang et al., 2006). Inverse PCR was carried out on the self ligated DNA sample with outward primers specific to the known region of the PyRE1 element. Inverse PCR was carried out on the self ligated DNA sample with outward primers specific to the known region of the PyRE1 element in

Total genomic DNA (1 μg) was digested with restriction enzymes (10 U). The digested DNA fragments were fractionated on 0.8% (w/v) agarose gel in TAE buffer, and transferred to transferred to nylon membrane (Biodyne®B, PALL, USA). For hybridization, digoxigenin (DIG)-labeled DNA probes complementary to the LTR region (204 bp) and RT region (185 bp), were synthesized using a PCR DIG Probe Synthesis Kit (Roche Diagnostics, Mannheim, Germany). Prehybridization and hybridization were performed as described previously (Suzuki et al., 1998). The hybridized probes were immuno-detected with an alkaline phosphatase-conjugated antiDIG antibody and visualized using CSPD chemiluminescence substrate as per the supplier's instructions (Roche Diagnostics).

animals (Terrat et al., 2008). The gene structure of PyRE1G1 was also compared with that of PyRE10G. 2. Materials and methods 2.1. Plant material

Fig. 1. Gene structure of PyRE1G1. (A) A schematic representation of PyRE1G1. The ORF or LTR is indicated with a white box. Nucleotide sequences of the 3′-and 5′-ends of the LTR were compared with those of other copia elements. Nucleotide sequences of the (−) primer binding site (PBS) and (+) polypurine tract (PPT) are also compared. The region of the domain predicted by the HMMPFAM program is indicated as aa numbers. PFAM ID numbers are shown in parentheses. Deduced aa sequences of the nucleic acid-binding domain of gag proteins (B), protease domains as indicated with bars and roman numerals (C), and integrase HHCC and DDE domains (D) of PyRE1G1 are compared to those of P. yezoensis PyRE10G and other sources. Portions identical to PyRE1G1 are boxed in black. Conserved signatures among retroelements are indicated above the alignment. The accession numbers for genes are as follows: PyRE1G1 (This study, AB371726), PyRE10G (AB286055), Osser (X69552), Tnt1 (X13777), Copia (M11240), Ty3 (M23367), Gypsy (M12927), HIV-1(M93258).

S. Peddigari et al. / Gene 424 (2008) 153–158

2.4. Estimation of copy number of PyRE1G1 by PCR RT region primers RE1-F1 5′-ACCTGTATGCACCGATGGAC-3′ and RE1-R1 5′-GCAATTGTCGGCCTTAGACT-3′, which can produce 185 bp fragments of the RT gene PyRE1G1 harboring plasmid DNAs (0.5, 1, 2, 6, 10 × 10 − 7 pmol) were amplified with the primers RE1-F1 5′ACCTGTATGCACCGATGGAC-3′ and RE1-R1 5′-GCAATTGTCGGCCTTAGACT-3′, which can produce 185 bp fragments of the RT gene, in a 50 μl reaction mixture containing 1 μl plasmid DNA, 200 μM each dNTP, 5 μl Taq buffer, 10 pmol of each primer, and 1.25 U Taq polymerase (Takara Bio). The PCR conditions used were initial denaturing at 94 °C for 2 min followed by 28 cycles of 94 °C for 30 s, 60 °C for 50 s, and 72 °C for 40 s, followed by 5 min at 72 °C for final extension. Genomic DNA of 20 ng was also used for amplification of PyRE1G1 with primer RE1-F1 and RE-1R1 under the same PCR conditions. Signal density of genome DNA was compared with that of plasmid DNA and the copy number of PyRE1G1 in the genome was calculated based on the haploid genome size of P. yezoensis (260 Mb, Kapraun et al. 1991, Le Gall et al. 1993). Recently, we isolated the copia-like RT encoding cDNA (PyRE2A) from P. yezonensis and Southern blot analysis suggested that the genomic sequence of PyRE2A (PyRE2AG) exists as a single copy in the genome (Zhang et al. 2006). To test the reliability of the procedure used, the copy number of PyRE2AG was also estimated by PCR amplification. PyRE2AG harboring plasmid DNA (0.5, 1, 2, 6, 10 × 10− 7 pmol) and genomic DNA (60 ng) were used to amplify with primer RE2-F1 (ATCAAGGCCATCTACGGGCTCAAG) and RE2-R1 (AATCTCCTCTTGCACCTGCT) under same PCR conditions as used for PyRE1G1.

155

bootstrap test with 1000 replications was performed. We could draw the same topology of the trees using the program on DNA Data Bank of Japan website (http://clustalw.ddbj.nig.ac.jp/top-e.html) (data not shown). 3. Results 3.1. PyRE1G1 shows a gene structure typical of copia retrotransposons The genomic PCR product (PyRE1G1) isolated from P. yezoensis contained an ORF encoding 1401 aa and 204 bp-LTRs at both ends (Fig. 1A). The nucleotide sequences of the 5′-LTR are identical to those of the 3′-LTR except a single nucleotide difference. Both LTRs showed identical 5′-TG…CA-3′ dinucleotide end sequences to other retrotransposons. A putative primer binding site (PBS) for minus strand

2.5. PCR for RT region sequence analysis among PyRE1G copies Genomic DNA was digested with KpnI (10 U) restriction enzyme overnight, and samples were run on 0.8% agarose gel. The PyRE1G1 copy regions were gel extracted and purified. The purified gel extraction samples were PCR amplified with the RT region primers RE1-F1 and RE1-R1. The PCR conditions used were initial denaturing at 94 °C for 2 min followed by 35 cycles of 94 °C for 30 s, 60 °C for 40 s, and 72 °C for 50 s. 2.6. RT-PCR Total RNA was isolated with the Sepasol-RNA I super mix kit (Nacalai tesque, Japan) according to the manufacturer's instructions. Gametophytes (25 mg fresh weight) were ground in liquid nitrogen and mixed with 1 ml Sepasol-RNA I Super mix from the kit. After 5 min incubation at room temperature, the solution was treated with 200 μl of chloroform for 3 min and centrifuged at 12,000 ×g for 15 min at 4 °C. RNA was precipitated from the supernatant by adding 500 μl of isopropanol, washed with 70% ethanol, and the resulting pellet was dissolved in diethylpyrocorbonate treated water. For RT-PCR the cDNA was synthesized from 1 μg of total RNA at 42 °C for 30 min with 1 μl Oligo dT adaptor primer from the RT-PCR kit (Takara Bio). Prior to cDNA synthesis, the RNA sample was treated with RNase-free DNase enzyme according to the manufacturer's instructions (Promega, USA). PCR was carried out with the same set of primers and conditions as used for genomic copies. 2.7. Alignment and phylogenetic analysis of sequences Multiple alignments of conserved domains of PyRE1G1 with other retrotransposons were created by ClustalW (Thompson et al., 1994). The sequences of other retrotransposons were obtained from DDBJ and EMBL/GenBank databases and sequence files were created with Genetyx software. Neighbor-joining phylogenetic trees of conserved domains were constructed using MEGA 3.1 software (Kumar et al. 2004). To assess the support for each internal branch of the trees, a

Fig. 2. Estimation of copy number of PyRE1G1. (A) Genomic Southern blot analysis. Total DNA (1 μg) was digested with KpnI (K) or PstI (P). The digested (K or P) and undigested (U) DNAs were transferred to the membrane and hybridized with the each probe. The positions of KpnI and PstI recognition sites are indicated with vertical bars, and DNA probes are indicated with bold lines. (B) PCR was performed using genome DNA and plasmid DNAs harboring the cloned PyRE1G1 [b] and PyRE2AG [c]. Monochrome images of PCR products were inserted in the figure. Genome DNA was indicated as G, and the numbers in plasmid indicate the amount of plasmid DNA (× 10− 7 pmol). The calibration curves of signal density of PCR product versus the amount of plasmid DNA harboring PyRE1G1 (open circle) and PyRE2AG (closed circle) were drawn. Signal density of the PCR product from genome DNA was compared with that from plasmid DNA (dotted line with arrowhead), and the copy number of PyRE1G1 and PyRE2AG in the genome was calculated. (C) Nucleotide sequences (175 bp) of genomic and RT-PCR products amplified with RT primers. Genomic PCR products could be divided into 2 groups referred to as G1-1 and G1-2. All RT-PCR products (11 clones) showed identical sequences to that of G1-1 except at a single nucleotide, which is indicated with triangle. The positions at which nucleotides of G1-1 differ from that of G1-2 are indicated by boxes.

156

S. Peddigari et al. / Gene 424 (2008) 153–158

DNA synthesis was identified next to the end of the 5′-LTR. A putative polypurine tract (PPT) for plus strand DNA synthesis was also identified upstream to the 3′-LTR. These findings suggest that PyRE1G1 possesses intact LTRs at both ends. Fig. 1A also shows the position and ID number of protein motifs identified by HMMPfam program (http://www.ebi.ac.uk/InterProScan/). Two gag protein motifs were identified in the 135–190 aa and 254– 271 aa regions. Catalytic integrase and RT motifs were also identified at 525–686 aa and 910–1165 aa, respectively. As shown in Fig. 1B, the CCHC motif conserved in nucleic acid-binding gag proteins (Mount and Rubin, 1985) was present in PyRE1G1. From a BlastX search and multiple alignment, the PyRE1G1 protease was identified (Fig. 1C). The catalytic motif D-S/T-G conserved in proteases of LTR retrotransposons was identified in PyRE1G1 (Fig. 1C, domain I). Additional domains II and III conserved in the retrovirus protease (McClure, 1991) were also partially conserved in PyRE1G1similarly to other LTR retrotransposons (Fig. 1C). The DNAbinding HHCC domain and the catalytic DD(35)E domain conserved in integrases of LTR retrotransposons (Peterson-Burch and Voytas, 2002) were also completely conserved in PyRE1G1 integrase (Fig. 1D). In addition to these four proteins, the RNase H of PyRE1G1 was also identified by a BlastX search (Data not shown). The results suggest that PyRE1G1 possesses gag, protease, integrase, RT and RNase H sequences (Fig. 1A). Considering the order of gene arrangement of the polyproteins, PyRE1G1 can be grouped with copia-like retrotransposons.

with RT and LTR probes, respectively. Copy number of PyRE1G1 was also estimated by comparing the signal density after PCR of genome DNA and plasmid DNA harboring PyRE1G1 (Fig. 2B[a]). Recently, we isolated the copia-like RT encoding cDNA (PyRE2A) and its genomic DNA (PyRE2AG) from P. yezoensis, and suggested that PyRE2AG exists as a single copy in the genome by Southern blotting (Zhang et al. 2006). For the control, the copy number of PyRE2AG was also estimated by the same method (Fig. 2B[b]). Based on the haploid genome size of P. yezoensis (260 Mb; Kapraun et al. 1991, Le Gall et al. 1993), the estimated copy number of PyRE1G1and PyRE2AG was 8.3 and 1.0, respectively. These results suggest that PyRE1G1 consists of a relatively small gene family. To determine the nucleotide sequence difference among family genes of PyRE1G1, KpnI digested genomic DNA fragments that hybridized with the RT probe were extracted from the agarose gel and their nucleotide sequences were analyzed. A total 25 clones were divided into two groups referred to G1-1 and G1-2 (Fig. 2C). All 11 PCR products of cDNA amplified with RT primers showed identical sequences to G1-1 except a single nucleotide difference, suggesting that the G1-1 group of PyRE1G1 family genes are expressed at low levels under normal conditions. Since no signal for PyRE1G1 was detected by Northern blotting of total RNA, PyRE1G1 transcription was at a very low level.

3.2. PyRE1G1 is a member of a small gene family

Deduced amino acid sequences of the RT region of PyRE1G1 were compared with those of P. yezoensis PyRE10G and other copia and gypsy retrotransposons (Fig. 3A). The RT-like region of PyRE1G1 contained all six conserved motifs recognized in the RT regions of

To identify the copy number of PyRE1G1 in P. yezoensis, Southern blot analysis was performed (Fig. 2A). Six and 12 bands were detected

3.3. PyRE1G1 and PyRE10G occupy different clades among copia elements in an RT-based phylogenetic tree

Fig. 3. Deduced aa sequences and phylogenetic tree of RT domains of PyRE1G1 and other sources. (A) Alignment of RT region. The domains are indicated with bars and roman numerals and conserved regions are highlighted. (B) Neighbor-joining phylogram analysis based on aa sequences of RT. RT sequences of the LINE element Cin4 were defined as the outgroup. Bootstrap values above 60% are indicated on the nodes. Accession numbers of the genes are as follows: Tto1 (D83003), Tal3 (X13291), BARE1 (Z17327), RIRE1 (D85597), PyRE2A (AB248913), Hopscotch (U12626), Sushi (AF030881), Saci-2 (BK004069), MAGGY (L35053), Skippy (L34658), GalEa1 (EU097705), Cico1 (DQ913003), Olco1 (DQ913000), Zeco1 (DQ913001), Cin4 (Y00086). The sequences of Chlamydomonas elements (Copia1-CR and Gypsy1-CR) and Thalassiosira elements (Copia1-TP and Gypsy1-TP) were deposited in Repbase. Accession numbers of other elements were described above.

S. Peddigari et al. / Gene 424 (2008) 153–158

copia type retrotransposons from various organisms (Xiong and Eickbush, 1990). Furthermore, the phylogenetic tree constructed using the amino acid sequences of the RT region suggest that the RT of PyRE1G1 is a copia element (Fig. 3B). In the tree, PyRE1G1 was grouped in the clade of usual copia retrotransposons while PyRE10G was in another clade of the GalEa group. Most recently, Terrat et al. reported that GalEa elements isolated from galatheid crabs are closely related to copia-like elements in phylogenetically distant animals such as Ciona intestinalis, Oryzias latipes, and Danio rerio and concluded that the GalEa group is a new clade of copia-like retrotransposons in aquatic animals (Terrat et al., 2008). The inclusion of PyRE10G in the clade of GalEa elements (Fig. 3B) suggested that P. yezoensis possesses two different clades of copia-like retrotransposons. 3.4. Differences in integrase sequences between PyRE1G1 and PyRE10G In our previous report, we did not detect the unusual property of PyRE10G described above (Peddigari et al., 2008). Instead, we found that the sequences of PyRE10G integrase were more related to those of gypsy retrotransposons than to those of copia elements. Here, we therefore constructed the phylogenetic tree based on the aa sequences of the integrase DDE domain (Fig. 4A). PyRE1G1 was grouped in the clade of typical copia retrotransposons while PyRE10G, like the GalEa group, was in the clade of gypsy elements. Fig. 4B shows the deduced amino acid sequences of C-terminal region of copia retrotransposons and PyRE1G1. Copia retrotransposons usually contain a GKGY motif downstream of the integrase DDE domain (Peterson-Burch and Voytas, 2002). By contrast, gypsy integrases usually contain a GPF(Y) motif downstream of the DDE domain, and some of them contain a chromodomain in the C-terminal region (Malik and Eickbush, 1999). As shown in Fig. 4B, PyRE1G1 contained the GKGF motif in this region. We previously reported that PyRE10G integrase did not contain a GPF (Y) motif but partially contained the chromodomain (Peddigari et al., 2008). In the present study, we found neither chromodomain nor GPF

157

(Y) motif in GalEa group retrotransposons. Instead, a DNA-binding domain conserved in retrovirus integrases (Puras Lutzke and Plasterk, 1998) was identified downstream from the DDE domain (Fig. 3C). Fig. 4C also shows a partially conserved DNA-binding domain in PyRE10G integrase. In addition to the integrase core sequences, the C-terminal region of integrase also indicates that PyRE1G1 and PyRE10G integrases are related to those of typical copia retrotransposons and GalEa group elements, respectively. 4. Discussion PyRE1G1 is the first example of a full-length LTR retrotransposon from macro algae. PyRE1G1 possessed an intact gene structure (Fig. 1) and was expressed under normal growth conditions, while the expression of another family gene was repressed (Fig. 2C). Therefore, the possibility arises that PyRE1G1 may be an active element. In seed plants, active retrotransposons were demonstrated to provide valuable tools for genome analysis (Hirochika, 1997). Further, the copia retrotransposon Tnt1 of tobacco was reported to successfully induce mutations in Medicago (Tadege et al., 2005) and lettuce (Mazier et al., 2007), suggesting that the active retrotransposon can transpose in heterologous plant species. Porphyra is known to be important for seaweed cultivation and as a model plant for functional and genomic studies in marine algae (Nikaido et al., 2000). Further characterization of family genes of PyRE1G1 and the identification of active elements in P. yezoensis will provide valuable information for the application of retroelements to gene analysis in macro algae. A phylogenetic tree constructed using RT aa sequences suggests that Porphyra contains at least two different clades of copia elements (Fig. 3B). The phylogenetic tree also suggests that PyRE1G1 is more related to the copia elements of green algae and diatoms than seed plants. This result is consistent with the phylogenetic stance of red algae as a primitive plant lineage. Fig. 3 also provides insight into the evolutionary history of diatom retrotransposons because diatoms are

Fig. 4. Phylogenetic tree of retrotransposon integrases and alignment of integrase C-terminal region. (A) Phylogenetic tree of integrase DDE domain of PyRE1G1 and other sources. Accession numbers of the genes are as follows: Ty1 (X03840) and CsRn1 (AY013569). Transposase-like sequences of bacterial insertional element IS630 (X05955) was defined as the outgroup. (B) Multiple alignment of the integrase C-terminal region of PyRE1G1 and other copia retrotransposons. Conserved GKGY motif is indicated above the alignment. (C) Multiple alignment of integrase C-terminal region of PyRE10G and GalEa group retrotransposons. The bold bar indicates the region of the DNA-binding domain.

158

S. Peddigari et al. / Gene 424 (2008) 153–158

believed to have acquired their plastids by secondary endosymbiogenesis, where a red algal endosymbiont was engulfed and domesticated by a nonphotosynthetic eukaryotic host. Secondary endosymbiosis has given rise to diverse groups of algae including brown algae and diatoms. Now, whole genome sequences of the diatom, Thalassiosira pseudonana are available (Armbrust et al. 2004). Although copia-like or gypsy-like retrotransposons have been identified in Thalassiosira (Armbrust et al. 2004) and cryptomonad algae (Khan et al. 2007), their structures could not be compared to those of red algae because the complete genome of the unicellular red alga Cyanidioschyzon merolae lacks LTR retrotransposons (Nozaki et al. 2007) and the EST database of P. yezoensis contains fragments of the retroelement (Asamizu et al. 2003; Nikaido et al. 2000). Here we tested the similarity of red algal PyRE1G1 and PyRE10G to Thalassiosira copia elements. As shown in Figs. 3 and 4, the Thalassiosira copia element Copia1-TP stands within the copia clade but in a different branch from Porphyra elements. Other Thalassiosira copia elements deposited on Repbase (Kohany et al., 2006) also stand in different branches from Porphyra elements (data not shown). Therefore, the origin of Thalassiosira copia elements remains unclear. A difference between PyRE1G1 and Thalassiosira elements was also found in their PBS sequences. As shown in Fig. 1A, the PBS sequences of PyRE1G1 were closely related to those of some copia elements. In contrast to the general phenomenon observed in many LTR retroelements where PBS is complementary to the acceptor stem of cellular tRNAiMet, in the case of Drosophila copia it was demonstrated that an internal portion of the tRNAiMet is used as primer for minus strand DNA synthesis (Kikuchi et al., 1986). We found similar PBS sequences in Volvox Osser (Fig. 1A) and that all Chlamydomonas copia retrotransposons deposited in Repbase (Kohany et al., 2006). By comparison, Talassiosira copia retrotransposons possess no tRNA-like PBS; rather they seem to use self-priming by 12-bp palindrome sequences such as 5′CGTTTATAAACG-3′ in the Copia1-TP at 3′ flanking region of the 5′ LTR (Armbrust et al. 2004). These findings also suggest that Thalassiosira copia elements are unrelated to Porphyra elements reported here. Isolation of other LTR retrotransposons from P. yezoensis will provide information about the evolution of retrotransposons through secondary symbiosis. In contrast to PyRE1G1, PyRE10G is closely related to GalEa group elements. This was strongly supported by phylogenetic trees constructed using RT regions (Fig. 3B) and integrase (Fig. 4A). At present, however, LTR sequences have not been identified in PyRE10G, whereas most GalEa group elements possess LTR sequences at both ends. Considering the distribution of GalEa elements among phylogenetically distant aquatic animals, Terrat et al. (2008) speculated horizontal gene transfer as one reason for the unusual distribution. The present data raise the possibility that GalEa group elements exist in plants. Identification of a PyRE10G-related element in other red algae will provide valuable information about the evolution of GalEa elements. Acknowledgments We would like to thank Dr. Naotsune Saga of Hokkaido University, Japan, for providing the gametophyte of P. yezoensis. This work was supported by Grants-in-Aid for Scientific Research on Priority Areas (to H.T.) from the Ministry of Education, Culture, Sports, Science, and Technology of Japan, and from the Program for Promotion of Basic Research Activities for Innovative Biosciences (PROBRAIN, to H.T.).

References Apt, K.E., Grossman, A.R., 1993. Characterization and transcript analysis of the major phycobiliprotein subunit genes from Aglaothamnion neglectum (Rhodophyta). Plant Mol. Biol. 21, 27–38. Armbrust, E.V., et al., 2004. The genome of the diatom Thalassiosira pseudonana: ecology, evolution, and metabolism. Science 306, 79–86. Asamizu, E., Nakajima, M., Kitade, Y., Saga, N., Nakamura, Y., Tabata, S., 2003. Comparison of RNA expression profiles between the two generations of Porphyra yezoensis (Rhodophyta), based on expressed sequence TAG frequency analysis. J. Phycol. 39, 923–930. Hirochika, H., 1997. Retrotransposons of rice: their regulation and use for genome analysis. Plant Mol. Biol. 35, 231–240. Kapraun, D.F., Hinson, T.K., Lemus, A.J., 1991. Karyology and cytophotometric estimation of inter- and intraspecific nuclear DNA variation in four species of Porphyra (Rhodophyta). Phycologia 30, 458–466. Khan, H., et al., 2007. Retrotransposons and tandem repeat sequences in the nuclear genomes of cryptomonad algae. J. Mol. Evol. 64, 223–236. Kikuchi, Y., Ando, Y., Shiba, T., 1986. Unusual priming mechanism of RNA-directed DNA synthesis in copia retrovirus-like particles of Drosophila. Nature 323, 824–826. Kumar, A., Bennetzen, J.L., 1999. Plant retrotransposons. Annu. Rev. Genet. 33, 479–532. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5, 150–163. Kohany, O., Gentles, A.J., Hankus, L., Jurka, J., 2006. Annotation, submission and screening of repetitive elements in Repbase: RepbaseSubmitter and Censor. BMC Bioinformatics 7, 474. Kuwano, K., Aruga, Y., Saga, N., 1996. Cryopreservation of clonal gametophytic thalli of Porphyra (Rhodohyta). Plant Sci. 116, 117–124. Le Gall, Y., Brown, S., Marie, D., Mejjad, M., Kloareg, B., 1993. Quantification of nuclear DNA and G–C content in marine macroalgae by flow cytometry of isolated nuclei. Protoplasma 173, 123–132. Lindauer, A., Fraser, D., Bruderlein, M., Schmitt, R., 1993. Reverse transcriptase families and a copia-like retrotransposon, Osser, in the green alga Volvox carteri. FEBS. Lett. 319, 261–266. Malik, H.S., Eickbush, T.H., 1999. Modular evolution of the integrase domain in the Ty3/ Gypsy class of LTR retrotransposons. J. Virol. 73, 5186–5190. Malik, H.S., Eickbush, T.H., 2001. Phylogenetic analysis of ribonuclease H domains suggests a late, chimeric origin of LTR retrotransposable elements and retroviruses. Genome Res. 11, 1187–1197. Mazier, M., et al., 2007. Successful gene tagging in lettuce using the Tnt1 retrotransposon from tobacco. Plant Physiol. 144, 18–31. McClure, M.A., 1991. Evolution of retroposons by acquisition or deletion of retroviruslike genes. Mol. Biol. Evol. 8, 835–856. Mount, S.M., Rubin, G.M., 1985. Complete nucleotide sequence of the Drosophila transposable element copia: Homology between copia and retroviral proteins. Mol. Cell Biol. 5, 1630–1638. Nikaido, I., Asamizu, E., Nakajima, M., Nakamura, Y., Saga, N., Tabata, S., 2000. Generation of 10,154 expressed sequence tags from a leafy gametophyte of a marine red alga, Porphyra yezoensis. DNA Res. 7, 223–227. Nozaki, H., et al., 2007. A 100%-complete sequence reveals unusually simple genomic features in the hot-spring red alga Cyanidioschyzon merolae. BMC Biol. 5, 28. Peddigari, S., Zhang, W., Sakai, M., Takechi, K., Takano, H., Takio, S., 2008. A copia-like retrotransposon gene encoding gypsy-like integrase in a red alga, Porphyra yezoensis. J. Mol. Evol. 66, 72–79. Perez-Alegre, M., Dubus, A., Fernandez, E., 2005. REM1, a new type of long terminal repeat retrotransposon in Chlamydomonas reinhardtii. Mol. Cell Biol. 25, 10628–10638. Peterson-Burch, B.D., Voytas, D.F., 2002. Genes of the pseudoviridae (Ty1/copia retrotransposons). Mol. Biol. Evol. 19, 1832–1845. Puras Lutzke, R.A., Plasterk, R.H.A., 1998. Structure-based mutational analysis of the Cterminal DNA binding domain of human immunodeficiency virus type 1 integrase: critical residues for protein oligomerization and DNA binding. J. Virol. 72, 4841–4848. Suzuki, T., Takio, S., Satoh, T., 1998. Light-dependent expression in liverwort cells of chlL/ N and chlB identified as chloroplast genes involved in chlorophyll synthesis in the dark. J. Plant Physiol. 152, 31–37. Tadege, M., Ratet, P., Mysore, S., 2005. Insertional mutagenesis: a Swiss army knife for functional genomics of Medicago truncatula. Trends Plant Sci. 10, 229–235. Terrat, Y., Bonnivard, E., Higuet, D., 2008. GalEa retrotransposons from galatheid squat lobsters (Decapoda, Anomura) define a new clade of Ty1/copia-like elements restricted to aquatic species. Mol. Genet. Genomics 279, 63–73. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acids Res. 22, 4673–4680. Xiong, Y., Eickbush, T.H., 1990. Origin and evolution of retroelements based upon their reverse transcriptase sequences. EMBO J. 9, 3353–3362. Zhang, W., Sakai, M., Lin, X.F., Takechi, K., Takano, H., Takio, S., 2006. Reverse transcriptase-like sequences related to retrotransposon in a red alga, Porphyra yezoensis. Biosci. Biotechnol. Biochem. 70, 1999–2003.