Two new natural begomovirus recombinants associated with the tomato yellow leaf curl disease co-exist with parental viruses in tomato epidemics in Italy

Virus Research 143 (2009) 15–23

Contents lists available at ScienceDirect

Virus Research journal homepage: www.elsevier.com/locate/virusres

Two new natural begomovirus recombinants associated with the tomato yellow leaf curl disease co-exist with parental viruses in tomato epidemics in Italy Salvatore Davino a,1 , Chiara Napoli b,1,2 , Chiara Dellacroce b , Laura Miozzi b , Emanuela Noris b , Mario Davino c , Gian Paolo Accotto b,∗ a b c

Dipartimento di Scienze Entomologiche, Fitopatologiche, Microbiologiche e Zootecniche, Università degli Studi di Palermo, Viale delle Scienze, 90128 Palermo, Italy Istituto di Virologia Vegetale, Consiglio Nazionale delle Ricerche, Strada delle Cacce 73, 10135 Torino, Italy Dipartimento di Scienze e Tecnologie Fitosanitarie, Università degli Studi di Catania, Via S. Sofia 100, 95123 Catania, Italy

a r t i c l e

i n f o

Article history: Received 6 October 2008 Received in revised form 1 March 2009 Accepted 2 March 2009 Available online 14 March 2009 Keywords: Geminiviridae TYLCV TYLCSV Recombination Tomato Sicily

a b s t r a c t Two tomato geminivirus species co-exist in protected crops in Sicily, Tomato yellow leaf curl Sardinia virus (TYLCSV, found in 1989) and Tomato yellow leaf curl virus (TYLCV, found in 2002), and mixed infections have been detected. In a field survey conducted in 2004, the viral intergenic region (IR) was amplified from infected plants, and molecules apparently hybrid between the two species were found, but only in plants where one or both parental species were also present. Two of these hybrids, named 2/2 and 2/5, were isolated and infectious clones were obtained. They were both readily whitefly-transmitted to tomato plants; clone 2/5 produced symptoms typical of TYLCSV and TYLCV, while clone 2/2 produced more severe symptoms, with leaves showing downward curling and rugosity. Sequence analysis showed that both 2/2 and 2/5 are newly generated hybrids, with two recombination sites each. One site, common to both hybrids, is in the stem-loop of the IR. The other is close to the 3 -end of the CP ORF in 2/5 and within the Rep ORF in 2/2. Thus, the 2/2 hybrid virus has a hybrid Rep protein, with the 202 amino-terminal aa from TYLCV and the remaining 155 aa from TYLCSV. Replication assays in leaf disc indicated a lower replicative capacity with respect to parental viruses, a fact that might help to explain why plants infected only by a recombinant have not been found so far. © 2009 Elsevier B.V. All rights reserved.

1. Introduction Tomato yellow leaf curl disease (TYLCD) has been known for more than 40 years, but only since the end of the eighties it has become widespread in all important tomato growing areas around the Mediterranean basin (Moriones and Navas-Castillo, 2000). TYLCD is caused by a complex of virus species that are responsible for severe losses in tomato crops worldwide (Czosnek and Laterrot, 1997). The list of countries suffering severe TYLCD epidemics is continuously increasing (Moriones and Navas-Castillo, 2000). TYLCD symptoms on tomato plants include leaf curling, yellowing and stunting of the plants and flower abortion. The causal agents are species of the genus Begomovirus, family Geminiviridae, transmitted by the whitefly Bemisia tabaci Genn. (Hemiptera: Aleyrodidae) (Stanley et al., 2005). The viruses have small, circular, single-stranded (ss) DNA genomes (Lazarowitz, 1992) that

∗ Corresponding author. Tel.: +39 0113977916; fax: +39 011343809. E-mail address: [email protected] (G.P. Accotto). 1 These authors contributed equally to the work. 2 Present address: Dipartimento di Biologia Vegetale, Università degli Studi di Torino, Viale 24 Mattioli 25, 10125 Torino, Italy. 0168-1702/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2009.03.001

replicates in the nuclei of infected cells via double-stranded (ds) intermediates by a rolling-circle mechanism, analogous to that used by ssDNA phages and plasmids (Saunders et al., 1991; Stenger et al., 1991). In Italy, two begomoviruses cause TYLCD: Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato yellow leaf curl virus (TYLCV). Two isolates of TYLCSV classified in two strains (TYLCSV-Sar-[IT:Sar:88] and TYLCSV-Sic-[IT:Sic]) and one of TYLCV (TYLCV-IL-[IT:Sic:04] have been described (Kheyr-Pour et al., 1991; Crespi et al., 1995; Davino et al., 2006). Their spread in Sicily and Sardinia is well documented and in recent years both species have frequently been found in mixed infections in single tomato plants (Davino et al., 2006). TYLCSV and TYLCV have monopartite ssDNA genomes of about 2.8 kb that contain six partially overlapping open reading frames (ORFs), two in the virion-sense strand (V2 and CP), and four in the complementary-sense (Rep, REn, TrAP, and C4), separated by an intergenic region (IR) of about 300 nucleotides. The IR includes a stem-loop characteristic of all geminiviruses, with a conserved nonanucleotide sequence 5 -TAATATT↑AC-3 in the loop where the breaking and joining site (arrow) for rolling-circle replication occurs (Hanley-Bowdoin et al., 2000). Reps specifically replicate their cognate genomes, recognizing a high-affinity binding site

16

S. Davino et al. / Virus Research 143 (2009) 15–23

present in the IR through their N-terminal domain (Gutierrez, 1999). The Rep possesses a nicking-closing activity and initiates rolling-circle replication by a site-specific cleavage within the nonanucleotide sequence (Laufs et al., 1995). TYLCV and TYLCSV can colonize the same plant and even coinfect the same cell (Morilla et al., 2004), making recombination possible. In Spain, where TYLCSV and TYLCV co-existed first, a recombinant virus was found (Tomato yellow leaf curl Malaga virus, TYLCMalV, Monci et al., 2002), whose genome is composed of portions from each parental species. Later, a further recombinant from Spain was described, Tomato yellow leaf curl Axarquia virus (TYLCAxV; García-Andrés et al., 2006). Preliminary evidence for the appearance of recombinants has also been reported in Italy (Davino et al., 2008), where TYLCV has colonized areas in which TYLCSV was endemic (Davino et al., 2006). In this work we have analyzed the viral populations in tomato field samples collected in 2004 in Sicily. We describe the isolation, cloning and sequencing of two recombinants between TYLCSV and TYLCV for which infectious clones were obtained to reproduce the disease and test their whitefly transmissibility. The presence and spread of recombinants in Sicily is discussed in relation to the results of a field survey done in 2008. 2. Materials and methods 2.1. Sample collection and analysis Leaf samples were collected from tomato plants showing TYLCD symptoms in January and February 2004 in the Ragusa province of Sicily, an important greenhouse-tomato area. For total DNA extraction, approximately 100 mg of leaf tissue were ground in 400 ␮l of extraction buffer, as previously described (Davino et al., 2008). The final pellet was resuspended in 500 ␮l of TE buffer and 1 ␮l was used for 25 ␮l-PCR reactions. Separate PCRs were performed using the primers described in Quinones et al. (2002) and Davino et al. (2008), each amplifying a sequence of about 600 nt. The following classes of viral DNAs could be amplified (primer pairs in parenthesis): TYLCSV-like (TY2353+/TY247−); TYLCV-like (TY2353+/TY255−); recombinant type A, named RecA (TY2463+/TY247−), with sequence from TYLCV on the left and TYLCSV on the right of the recombination site in the intergenic region; and recombinant type B, named RecB (TY2222+/TY255−), with sequence from TYLCSV on the left and TYLCV on the right of the recombination site, as detailed in Davino et al. (2008). Each primer pair can amplify only a single class of molecules, permitting the detection of multiple classes in single samples. The amplified sequences included the intergenic region, which was targeted because it is a well-known recombination site in geminiviruses (Stanley, 1995; Sanz et al., 2000; Zhou et al., 1998; Navas-Castillo et al., 2000; Monci et al., 2002; García-Andrés et al., 2006). Another survey, followed by DNA extraction and amplification, was conducted in the same area in 2008. 2.2. Comparisons of IR regions The sequences of several amplified DNA fragments from plants with single or multiple infections were obtained and compared with sequences present in the GenBank database using CLUSTAL V (DNAStar MegAlign software) and MEGA4 (Tamura et al., 2007). 2.3. Cloning and sequencing of recombinant DNAs Viral DNA was amplified from tomato plant #2 (2004 survey) using the TempliPhi kit (Amersham, Little Chalfont, UK), which exploits the ability of bacteriophage Phi29 DNA polymerase to amplify circular ss- or dsDNAs using random primers (Haible

Fig. 1. Production of full-length linear DNA of RecA type. DNA fragments (lanes 1 and 2) obtained by TempliPhi amplification from a tomato field sample with mixed infection, followed by double digestion with SacII and PflMI were separated in 1% agarose gel. Size of two markers is indicated on the left. M = Invitrogen 1 kb DNA ladder.

et al., 2006). Reactions were run for 14 h at 30 ◦ C and products were digested with SacII (which linearizes TYLCSV and Rec type A molecules) followed by PflMI (which cuts only TYLCSV). As a consequence, TYLCV molecules remain uncut, TYLCSV is cut into two fragments, and Rec type A molecules are linearized (about 2.8 kb), with SacII termini (Fig. 1). The 2.8 kb fragment was excised from agarose gels, purified (High Pure PCR Product Purification Kit, Roche, Basel, Switzerland), and cloned into SacII-linearized pBluescript KS+ plasmid, following standard protocols (Sambrook et al., 1989). Finally, these plasmids were transformed into ultracompetent XL10 E. coli cells. Two classes of clones were identified by restriction analysis and one clone for each class was selected for sequencing (clones 2/2 and 2/5). Cycle sequencing, on both DNA strands, was performed with an ABI-Prism 3730XL machine, using T3 and T7 universal primers, TY2463+, TY247-primers (Davino et al., 2008) and specific primers listed in Table 1. Sequences were assembled using the Vector NTI 9.0.0 suite (Invitrogen, Carlsbad, CA, USA) and multiple alignments were performed with ClustalV algorithm (MegAlign software, DnaStar). 2.4. Infectivity tests To test infectivity of the cloned 2/2 and 2/5 DNAs, two constructs suitable for agroinoculation (Grimsley et al., 1987) were prepared, by a series of subcloning steps. First, a deletion of 282 bp (which includes one of the SacII sites) was produced in full-length 2/2 and 2/5 DNAs by digestion with SpeI and religation. A full-length copy Table 1 Primers used for sequence determination of the recombinants 2/2 and 2/5. Primer

Sequence (5 to 3 )

Specificity

TY151+ TY1295+ TY1946+ TY1948+ TY969− TY1482− TY1530− TY1832− TY2311−

GTG GGA TTC TTT ATT AAA TGA ATT TC GAA TCC CCA GTT CCT TCC TC GTCTTGCCCGTTCTGCTATC GGC TGT CAC CCT CAA TCA CT TCA TAC TTC GCC TGC TCT TG GCA CAG GGG AAC TCA TCA CT GAT CTG GAC TGT GGC TGC T CGT CGA CCC GCA TTA TTT A ACG TGG AGA AAG ACG GAG AA

2/5 and 2/2 2/2 2/5 2/2 2/5 and 2/2 2/5 2/2 2/2 2/5 and 2/2

S. Davino et al. / Virus Research 143 (2009) 15–23

of viral DNA was then inserted in the remaining SacII site, obtaining a plasmid that contains a 1.9-mer insert (about 5.3 kb) of the viral genome. This insert was recovered using BssHII, made blunt-end, and transferred into the binary vector pBin19 linearized with SmaI, obtaining plasmids pBin2/2 and pBin2/5. Finally, pBin2/2 and pBin252 were transformed into the LBA4404 strain of Agrobacterium tumefaciens and agroinoculation experiments were performed on seedlings of Nicotiana benthamiana using standard procedures (Kheyr-Pour et al., 1991). After 2 and 4 weeks, plants were observed for symptoms and analyzed by tissue print hybridization, using a TYLCSV-specific probe designed on the CP region, which is included in both recombinants. 2.5. Agroinfiltrations Agroinfiltration was performed essentially according to Voinnet et al. (2003). LBA4404 A. tumefaciens strains containing plasmids pBin2/2 and pBin2/5 were grown overnight in YEB medium supplemented with 100 ␮g/ml kanamycin, 50 ␮g/ml rifampicin and 40 ␮M acetosyringone (28 ◦ C, 200 rpm). Cultures were centrifuged (6000 × g, 15 min, 4 ◦ C) and re-suspended in infiltration medium [10 mM 2-(N-morpholino) ethansulfonic acid (MES) buffer, pH 5.6, 10 mM MgCl2 , 200 ␮M acetosyringone] to an absorbance of 0.8 (A600 nm ). After 3 h incubation at room temperature, bacteria were infiltrated into fully expanded leaves of 6–8-week-old N. benthamiana. Infiltration buffer alone was used as negative control, and a bacterial strain containing pSar1.8 mer infectious TYLCSV (KheyrPour et al., 1991) was inoculated as positive control. Plants were maintained in a growth chamber under a 16/8 light/dark photoperiod at 24 ◦ C. Samples of infiltrated leaves were collected after 4 days. Total DNA extraction and Southern blot analysis of the viral DNA forms present in each sample were performed according to Noris et al. (1998), loading 1.2 ␮g of total DNA per lane. 2.6. Whitefly transmission and recloning For virus transmission tests, 500 B. tabaci were allowed to feed for 48 h on 2/2- or 2/5-infected N. benthamiana plants. Groups of 30 insects were then moved to single tomato test plants (cv. Marmande) for virus inoculation. Two days later, plants were sprayed with insecticide and maintained in an insect-free greenhouse. Plants were scored individually for symptoms and virus infection by tissue blotting 4 weeks after inoculation (Noris et al., 1998). Total DNA was extracted and analyzed by Southern blotting. One plant infected by 2/2 and one by 2/5 viral DNAs were used for re-cloning the viral DNA, using the TempliPhi as described above. One clone per type was sequenced. 3. Results 3.1. Analysis of field samples When samples collected in 2004 were analyzed, several combinations of viruses were found (Table 2 – data 2004). Single infections were detected for TYLCSV and TYLCV, but not for recombinant viruses. RecA-like molecules were present in 23 out of 51 samples (45%), always in combination with either TYLCV, TYLCSV, or with both. In no case were RecB-like molecules found. In a recent survey (Table 2 – data 2008) again RecB-like were not detected and RecA-like were found only in combination with one or both parental viruses. Several DNA fragments amplified from plants collected in 2004 with single or multiple infections were sequenced. In total, 10 sequences were TYLCSV-like (GenBank accession number EU719085 to EU719094), 11 TYLCV-like (GenBank accession number EU719074 to EU719084) and seven had RecA features (GenBank

17

Table 2 Numbers of plants containing TYLCSV, TYLCV and recombinant viruses identified in field samples collected in Sicily, as detected by PCR using the four primer pairs described in the text. Virus

No. of samples 2004

2008

TYLCSV TYLCSV + TYLCV TYLCSV + RecA TYLCSV + RecB TYLCV TYLCV + RecA TYLCV + RecB RecA RecB TYLCSV + TYLCV + RecA TYLCSV + TYLCV + RecB

9 14 9 0 5 5 0 0 0 9 0

15 44 2 0 7 1 0 0 0 30 0

Total

51

99

accession number EU719095 to EU719101). Their phylogenetic relationships with isolates present in the GenBank database is shown in Fig. 2. All TYLCV-like sequences were very closely related (99.2–99.7%) to the isolate TYLCV-IL- [IT:Sic:04] (accession number DQ144621), originally obtained from a tomato field sample in 2004 (Davino et al., 2006), and less related (96.5–97.0%) to the TYLCV-type strain, TYLCV-IL-[IL:Reo:86] (accession number X15656). In contrast, the TYLCSV-like sequences were more heterogeneous. Two subgroups could be identified, the first one was very similar (98.4–99.7%) to TYLCSV-Sic-[IT:Sic] (accession number Z28390), an isolate collected in 1991. The second subgroup was related (94.4–94.9%) to the TYLCSV-type strain, TYLCSV-Sar-[IT:Sar:88] (accession number X61153), originally obtained from a tomato sample collected in Sardinia. Preliminary analysis showed that all recombinant sequences were TYLCV-like on the left of the conserved stem-loop, and TYLCSV-like on the right. In order to build proper trees, each amplified sequence was split in two parts (left and right portion) at the origin of replication (Stanley, 1995), and separately analyzed. All left portions were very closely related (99.3–100%) to TYLCV-IL-[IT:Sic:04]. When the right portions were considered, three sequences (IT:R-10, -52 and -174) clearly clustered with TYLCSV-Sic-[IT:Sic], while the others were similar to both TYLCSVSic-[IT:Sic] and TYLCSV-Sar-[IT:Sar:88]. 3.2. Cloning and sequencing of full-length recombinants Recombinant DNA molecules were cloned from a single plant collected in a commercial tomato greenhouse in 2004, where TYLCSV, TYLCV and RecA were detected. Preliminary attempts to isolate dsDNA replicative forms using standard protocols yielded only TYLCSV and TYLCV clones, probably because recombinant molecules constituted a very minor fraction of all viral molecules present in the plant. When rolling-circle amplification with TempliPhi was used, followed by restriction digestions as described above, putative fulllength molecules of RecA class could finally be isolated and cloned, avoiding TYLCV- and TYLCSV-like ones (Fig. 1). Several putative fulllength clones were obtained, and preliminary restriction analysis indicated the presence of two different classes of molecules (not shown). One molecule of each class was selected (clones 2/2 and 2/5) and full-length sequences were determined on both strands. The two sequences have been deposited in the GenBank under the accession number EU734831 and EU734832, respectively. Both 2/2 and 2/5 DNAs are 2771 nucleotides in length, with a genome organization similar to that of TYLCV and TYLCSV,

18

S. Davino et al. / Virus Research 143 (2009) 15–23

Fig. 2. Phylogenetic relationships of the portion of the viral genome including the intergenic region, part of the Rep and V2 ORFs, derived from plants affected by TYLCD. (A) Fragments of about 660 nt amplified with primers specific for TYLCV; (B) fragments of about 630 nt amplified with primers specific for TYLCSV; (C and D) represent a fragment of about 540 nt amplified with primers specific for type A recombinants and split into two parts of about 300 nt on the left of the Ori (C) and about 240 nt on the right of the Ori (D). Names of isolates refer to country (IT = Italy), virus type (I = TYLCV; S = TYLCSV; R = type A recombinant) and sample number (e.g., 2 = plant no. 2). Reference sequences are boxed. Relationships were inferred by neighbour-joining analysis. Data were analyzed using MEGA version 4.0 software (Tamura et al., 2007). Support for nodes in a bootstrap analysis with 10,000 replications is shown for values over 70%. GenBank accession numbers for the reference sequences used are: TYLCV-IL-[IT:Sic:04] accession number DQ144621; TYLCV-IL-[IL:Reo:86] accession number X15656; TYLCV-Mld-[IL:93] accession number X76319; TYLCV-Mld-[PT:2:95] accession number AF105975; TYLCSV-Sic[IT:Sic] accession number Z28390; TYLCSV-Sar-[IT:Sar:88] accession number X61153; TYLCSV-ES-[ES:Mur1:92] accession number Z25751. Branch lengths are proportional to sequence distances.

with two ORFs on the virion-sense DNA and four on the complementary-sense. Analysis of the overall sequence similarity with representative isolates of tomato begomoviruses causing TYLCD in the Mediterranean basin (Table 3) showed that 2/2 DNA has 91.4% identity with TYLCAxV-[ES:Alg:00], while 2/5 DNA has 89.2 and 89.9% identity with TYLCAxV-[ES:Alg:00] and TYLCVIL[IT:Sic:04], respectively. In 2/2 two recombination sites were evident from alignments with TYLCV and TYLCSV (Fig. 3): the first was in the region between coordinate 2754 and 22. This site is located in the IR, and includes the nine nucleotides conserved in all Geminiviridae. The second site was located at coordinates 2007–2017. The sequence

between coordinates 2017 and 2754 showed 99.6% similarity with TYLCV-IL-[IT:Sic:04], while that between coordinates 22 and 2007 showed 96.7% similarity with TYLCSV-Sic-[IT:Sic] and TYLCSV-Sar[IT:Sar:88]. This second site is in the C1 ORF: as a consequence the Rep protein encoded by 2/2 is in part from TYLCV (aa 1–202) and in part from TYLCSV (aa 203–357). This is the only viral protein affected by the recombination. Two recombination sites were also present in 2/5 (Fig. 3): the first was in the same position as in 2/2, while the second was in the region between coordinates 1055 and 1059. The sequence between coordinates 1059 and 2754 showed 99.5% similarity with TYLCV-IL-[IT:Sic:04], while that between coordinates 22 and 1055

Table 3 Percentage of similarity between recombinants 2/2 and 2/5 and representative TYLCSV and TYLCV isolates present in the Mediterranean basin, using ClustalV with default parameters. Virus name

2/2

2/5

TYLCV-Mld [ES:72:97]

TYLCMalV [ES:421:99]

TYLCV-IL TYLCAxV [ES:Alm:Pep:99] [ES:Alg:00]

TYLCV-IL [IT:Sic:04]

TYLCSV-Sar [IT:Sar:88]

TYLCSV-ES [ES:Murl:92]

TYLCSV-Sic [IT:Sic]

2/2 2/5 TYLCV-Mld-[ES:72:97] TYLCMalV-[ES:421:99] TYLCV-IL-[ES:Alm:Pep:99] TYLCAxV-[ES:Alg:00] TYLCV-IL[IT:Sic:04] TYLCSV-Sar-[IT:Sar:88] TYLCSV-ES-[ES:Murl:92] TYLCSV-Sic-[IT:Sic]

100

91.6 100

72.6 79.5 100

81.2 85.8 89.1 100

81.4 88.7 91 81.1 100

81.9 89.9 90.2 80.4 97.9 82.4 100

87.1 80.1 73.2 79.8 71.6 81.6 71.7 100

82.7 78.2 73.7 84.9 71.2 87.4 70.9 86.9 100

86.4 79.3 73 80.2 70.5 80.6 70.4 91.9 90.4 100

91.4 89.2 75.4 86.1 83.4 100

S. Davino et al. / Virus Research 143 (2009) 15–23

19

Fig. 3. The recombinant nature of 2/2 and 2/5 genomes. (A) Schematic representation of the linearized genomic DNAs of recombinants (2/2 and 2/5) and putative parental viruses (TYLCV-IL-[IT:Sic:04] in grey and TYLCSV-Sar-[IT:Sar:88] in white) showing the origin of the fragments and the recombination sites (a, b and c). Arrows represent the ORFs on the viral genome. The hairpin loop (containing the conserved TAATATTAC sequence) is indicated on the left. (B) Alignments showing in detail the DNA regions (a, b and c from panel A) containing the likely recombination break-points (boxed sequences). Grey background indicates a conserved nucleotide in that position. (C) Plotsimilarity diagrams (Vector NTI 9.0.0 suite; scanning window = 50 nt) showing pairwise comparisons between 2/2 (above) or 2/5 (below) and the putative parental viruses TYLCSV-Sar-[IT:Sar:88] accession number X61153, TYLCSV-Sic-[IT:Sic] accession number Z28390 and TYLCV-IL-[IT:Sic:04] accession number DQ144621. X-Axis represents coordinates on the viral genome, starting from the TAATATTAC sequence; Y-axis shows the similarity score.

showed 97.4% similarity with TYLCSV-Sar-[IT:Sar:88], and 97.1% with TYLCSV-Sic-[IT:Sic]. Only one ORF was affected by recombination, the CP ORF, which encodes a protein that is mostly from TYLCSV, except for the four C-terminal amino acids that are from TYLCV.

3.3. Infectivity of 2/2 and 2/5 recombinants Following agroinoculation of N. benthamiana with A. tumefaciens harbouring pBin2/2 and pBin2/5, 6 and 5 plants out of 22, respectively, were positive in molecular hybridization experiments and showed disease symptoms. In the same conditions, 13 plants out of 14 were infected by TYLCSV- Sar-[IT:Sar:88] and 8 out of 8 by TYLCSV-Sic-[IT:Sic]. Four weeks post-inoculation, plants were reduced in size, with short internodes. Young leaves infected by 2/5 were pale green, with upward curling (Fig. 4A), similar to plants infected by TYLCV-IL-[IT:Sic:04] and TYLCSV-Sar-[IT:Sar:88] under the same experimental conditions (data not shown). Interestingly, 2/2 infected plants showed different symptoms: dark green and rugose leaves, with downward curling (Fig. 4C). Viral DNAs extracted from agroinfected plants and analyzed in Southern blots showed the same forms observed with TYLCSV, with the same relative abundance of the different forms and a prevalence of the ss- and supercoiled (sc)-DNA (Fig. 5B, lanes B-36, -37, -11,

-01 and T-TYLCSV). The same pattern was observed with TYLCV (not shown). 3.4. Agroinfiltration When the same A. tumefaciens strains used in agroinoculations were tested in agroinfiltration experiments on N. benthamiana leaves, TYLCSV yielded two bands on Southern blots, corresponding to the open circular (oc)- and the sc-DNA forms. The two recombinants 2/2 and 2/5 replicated at approximately 10 times lower levels, and their DNA forms consisted of the oc-DNA, a limited amount of sc-DNA, and a smear between the two. As usual in agroinfiltrations, the ssDNA forms were not detected (Fig. 5A). 3.5. Whitefly transmission and recloning To test the ability of the two hybrid viruses to infect tomato plants through the natural whitefly vector B. tabaci, plants infected by 2/2 and 2/5 were used as sources in transmission experiments. Tomato plants were tested 4 weeks after inoculation: 2/2 and 2/5 were transmitted to 14 out of 17 and 20 out of 27, respectively. Under the same experimental conditions, TYLCSV was transmitted to 18 out of 24 and TYLCV to 24 out of 27 plants. Symptoms caused on leaves by recombinant 2/2 comprised a marked downward curl-

20

S. Davino et al. / Virus Research 143 (2009) 15–23

Fig. 4. Symptoms produced on N. benthamiana (A and C) and tomato (B and D) by the two recombinant viruses 2/5 (A and B) and 2/2 (C and D).

ing and bubbling, accompanied by interveinal yellowing (Fig. 4D). Recombinant 2/5 caused upward curling with marked interveinal yellowing, similarly to TYLCV and TYLCSV infections (Fig. 4B). The viral DNA forms observed in tomato plants following whitefly transmission (lanes T- in Fig. 5B) did not differ from those observed in N. benthamiana plants following agroinoculation (lanes B- in Fig. 5B). To confirm the sequences of the two recombinants, they were recloned from tomato plants following whitefly transmission. The sequence obtained from a 2/2-whitefly-infected tomato was identical to the one characterized from the original plant, while the sequence obtained from the 2/5-whitefly-infected tomato differed in one nucleotide (C to T at coordinate 519). This difference caused a non-conservative proline to leucine change (P71L) in the CP. Both amino acids are hydrophobic and neutral. 4. Discussion Analysis of the 2004 samples, although limited, provided an indication on the population of viruses causing TYLCD and on their relationships with the already described species and strains. After just 2 years of co-existence of TYLCV and TYLCSV in the island, plants with single infections were a minority (14 out of 51). These data are in accordance with an analysis conducted with a different approach in the same region in two different seasons of 2004 on a larger number of samples (1464 samples), where mixed infections were detected in 41–69% of plants (Davino et al., 2006). By that approach however it was not possible to detect viruses resulting from recombination between the two species. The method adopted in the present work overcomes this limitation. Interestingly, more than 40% of the samples analyzed in 2004 contained RecA-like molecules, accompanied in all cases by one or both parental viruses. RecB-like DNAs were never found, confirming observations by García-Andrés et al. (2007b). These authors artificially constructed a RecB-like DNA (between TYLCV and TYLCSV isolated from Spain) that was infectious on plants. It is there-

fore possible that RecB-like recombinants are either not formed in nature because of absence of suitable sequence features to promote recombination, or have a very poor fitness compared to parental viruses and remain therefore undetected. The sequences obtained from a set of amplified fragments gave an indication on the variability among TYLCV and TYLCSV strains present in 2004 in Sicily. All the TYLCV-type DNAs studied were closely related to each other (>99% similarity), as well as to TYLCVIL-[IT:Sic:04], isolated from a tomato sample in 2004 (Davino et al., 2006). Since TYLCV was recorded in Sicily for the first time only in 2002, this low variability among samples in 2004 may be due to the time elapsed, too short for evolution into new populations. Very low sequence variation may also point to a “founder effect” (García-Andrés et al., 2007a), following the introduction of a highly homogeneous TYLCV population in 2002 in Sicily. The sequences of the TYLCSV isolates fell into two groups. The first group consisted of eight sequences, almost identical to TYLCSVSic-[IT:Sic], collected in Sicily in 1991. Thus, TYLCSV-Sic isolates appeared, at least in this portion of the sequence, to be very stable, in spite of the 13 years elapsed since the first isolation. The second group consisted of two sequences with highest similarity to TYLCSV-Sar-[IT:Sar:88]. These can be definitely considered isolates of TYLCSV-Sar, but their 94% similarity may indicate two situations. Either Sicily was colonized by a TYLCSV-Sar isolate slightly different from [IT:Sar:88], or the TYLCSV-Sar genome has higher variability and has undergone evolution since 1988, when it was originally identified in Sardinia. In favour of the first hypothesis is the fact that isolates collected in Sicily 5 years before, in 1999 (García-Andrés et al., 2007a), already showed only 95% similarity to [IT:Sar:88]. All the RecA-like sequences showed a recombination site (as in Fig. 3B, box a) in the stem-loop that is fully conserved between TYLCV and TYLCSV, as was the case in the previously described recombinants. In all cases, the left portion of the sequence was almost identical to TYLCV-IL-[IT:Sic:04], while the right one was in some cases more similar to TYLCSV-Sic-[IT:Sic], and in

S. Davino et al. / Virus Research 143 (2009) 15–23

21

Fig. 5. Replication of 2/2 and 2/5 recombinants in plants analyzed by Southern blotting hybridization with a digoxigenin-labelled probe specific for TYLCSV-CP. Positions of open circular (OC), supercoiled (SC) and single-stranded (SS) DNA forms are indicated by arrows. Each lane was loaded with 1.2 ␮g total DNA, unless otherwise specified. (A) Viral DNA forms in N. benthamiana leaves following infiltration with A. tumefaciens carrying DNAs of 2/2, 2/5 and TYLCSV. To obtain a comparable exposure level, DNA extracted from tissue infiltrated with TYLCSV was diluted 1:10. (B) Viral DNA forms in N. benthamiana plants inoculated with A. tumefaciens carrying DNAs of 2/2 (B-36, -37) and 2/5 (B-11, -01), and in tomato plants whitefly-inoculated from them (T-06, -15, -20, -12). A healthy (T-healthy) and a TYLCSV-infected tomato were also analyzed, together with a TYLCSV full-length linear insert (2771 bp) excised from a plasmid.

others equally similar to either TYLCSV-Sic-[IT:Sic] or TYLCSV-Sar[IT:Sar:88]. The cause of this ambiguity resides in the limited length of this portion (240 nt) combined with an intrinsic high similarity (95%) between the two reference isolates in this region. The recombinant sequences faithfully reflect the parental TYLCV- and TYLCSV-like sequences present in the plant, with differences lower than 1% (not shown), suggesting that recombination was a recent event. In fact, as shown in Spain (García-Andrés et al., 2007b), the two viral species commonly develop recombinants when present together in a single plant. The two recombinants, 2/2 and 2/5, representative of the major classes of TYLCV/TYLCSV hybrid DNAs found in a plant with mixed infection, show some interesting features. Recombinant 2/5 is the first TYLCV/TYLCSV fully characterized hybrid with a recombination site in the CP gene, which encodes a protein with the four terminal aa (SISN) deriving from TYLCV. Since they are conservative changes with respect to TYLCSV (AVTN), significant differences in pathogenicity are not expected. So far only one TYLCV/TYLCSV recombinant in the C1 ORF had been described (TYLCAxV). In that case the hybrid Rep protein is made of the amino-terminal part derived from TYLCV and only about 55 aa at the c-terminus deriving from TYLCSV. In the 2/2 recombinant described here the Rep portion from TYLCSV is much greater (aa 203–357). Even in this case, however, the cognate motifs present in the IR region and Rep protein are maintained and yield a viable recombination unit (Jupin et al., 1995; Gutierrez, 1999). According to García-Andrés et al. (2007b), using the Mfold program with default parameters and temperature of 70 ◦ C, most of

the cross-over sites occur within a portion of genome where stable hairpin secondary structures are predicted for TYLCSV, while a more relaxed structure is predicted for TYLCV. In our case, apart from the well-known hairpin in the IR, no such structures could be detected in the parental viruses, except for TYLCV (but not for TYLCSV) where a stem-loop was predicted at the recombination site found at coordinates 2007–2017 in 2/2 (not shown). A search with the RNA Fold Web Server (Hofacker, 2003), using DNA default parameters and a temperature of 50 ◦ C, predicted in both parentals a secondary structure at the recombination site of 2/2 (coordinates 2007–2017), but not at that of 2/5 (coordinates 1055–1059) (not shown). The importance of secondary structures in recombination events remains therefore unclear. The recombination in geminiviruses has been the object of several studies in recent years. An interesting approach has been used by Lefeuvre et al. (2007), who analyzed all available sequences of begomoviruses with multiple computational tools. This approach confirmed that recombination breakpoint hot- and cold-spots are conserved between monopartite and bipartite begomoviruses and indicated either that DNA breakage and repair do not occur randomly in begomoviruses or that, if breakpoints do occur randomly, selection has preferentially culled recombinants with breakpoints in certain positions while permitting the survival of recombinants with breakpoints in other positions. The position of recombination sites in the two newly described 2/2 and 2/5 genomes fits well with recombination hot-spots indicated in that study. Recombinant 2/2 induced severe downward curling and rugosity of leaves, not observed in plants infected by the parental viruses

22

S. Davino et al. / Virus Research 143 (2009) 15–23

or by 2/5. The two recombinants differ in a stretch between approximately nucleotide 1050 and 2010, deriving from TYLCSV in 2/2 and TYLCV in 2/5. This portion includes the REn and TrAP genes, as well as the 3 -terminal of the Rep gene. Since it is known that REn protein interacts with Rep (Castillo et al., 2003; Settlage et al., 2005), it is tempting to speculate that symptom alteration induced by 2/2 results from the interaction between REn from TYLCSV and a hybrid Rep, in part from TYLCV, while in the case of 2/5, where both gene products derive from TYLCV, symptoms are unchanged. This hypothesis is supported by the observation that TYLCAxV, a recombinant with most of the Rep from TYLCV and REn from TYLCSV, induced symptoms more severe than the parental viruses (GarcíaAndrés et al., 2006). Alternatively, TrAP could be responsible for symptom modifications in recombinant 2/2: in geminiviruses TrAP is known as both a transcriptional activator (Sunter and Bisaro, 1992) and a silencing suppressor (Voinnet et al., 1999). In this case, TrAP, from TYLCSV in 2/2 should interact with elements present in the TYLCV portion, including C4 and Rep, but such interaction has not been reported so far. Rules for begomovirus classification and nomenclature have been proposed by the ICTV Geminiviridae Study Group and are regularly updated (Fauquet et al., 2008). Following these rules, recombinant 2/2, with 91.4% similarity to TYLCAxV, should be considered a new strain of this species, and we propose the name TYLCAxV-Sic1-[IT:Sic2/2:04]. The other recombinant, 2/5, showed 89.9% similarity to TYLCV-IL-[IT:Sic:04] and 89.2% with TYLCAxV (see ClustalV results in Table 3). We believe that considering it a strain of the latter, that is itself a recombinant, reflects its nature better than classifying it as a TYLCV strain; therefore we propose to name it TYLCAxV-Sic2-[IT:Sic2/5:04]. It is interesting to note that the proposed classification of these two new recombinants, however, does not represent their true origin, since parental viruses found in the same plant together with the recombinants were not those of TYLCAxV. Classification of recombinants constitutes a particular challenge, since genetic variation occurs discontinuously along the genome, and will probably need to be re-examined in the future, as long as new cases are reported. Spain is the only other country where TYLCV and TYLCSV coexistence has been reported (although the strains are different from those in Sicily) and population dynamics have been studied. The Spanish surveys reported the presence of TYLCSV in 1992, TYLCV in 1997 and recombinants in 1999 (Monci et al., 2002). It is therefore interesting to compare the evolution of TYLCD in Italy where TYLCSV has been present since 1988, TYLCV arrived in 2002, and recombinant molecules were detected in 2004. In both countries hybrids were detected 2 years after the arrival of TYLCV. Apart from this, several differences can be noted. TYLCV quickly became more common than TYLCSV in Spain, while in Sicily both species were still found, either in single or mixed infections (Table 2). Mixed infections were more abundant in Sicily, but Rec-like molecules were found in single infections in Spain in 13.5% of tomato samples (7.1% in symptomatic and 21.1% in asymptomatic ones) analyzed in 2000 (Monci et al., 2002), while in Sicily plants infected only by Rec-like molecules have been found only in mixed infections, more commonly with both parental viruses (see Table 2). In our case, having analyzed 150 plants in 2004 and 2008, it appears quite unlikely that single infections by a recombinant virus would have gone undetected. There is no obvious explanation for the inability of Rec-like molecules to spread, because the two recombinant molecules 2/2 and 2/5 characterized in the present work are readily transmitted by whiteflies to tomato where they induce severe symptoms (Fig. 4) and accumulate amounts and forms of viral DNA similar to parental viruses (Fig. 5B). Nevertheless, a more detailed analysis of 2/2 and 2/5 may help to identify the basis for the apparent selective advantage of the parental viruses. Although systemically infectious by

agroinoculation, their infectivity was limited if compared to the two parentals: only 25% rather than 90–100% of inoculated plants became infected. Furthermore, when viral replication was analyzed in agroinfiltration experiments (Fig. 5A), 2/2 and 2/5 DNAs replicated approximately ten times less than parentals and the amount of scDNA was particularly scarce. These findings could suggest a lower ecological adaptation of recombinants 2/2 and 2/5 with respect to parental viruses, however the question remains open and needs to be further studied. Another reason for the lack of single infections by Rec-like viruses may reside in an important difference in agronomic practices between the cultivation areas. While in Southern Spain beans (Phaseolus vulgaris) are regularly grown between tomato crops, this is not the case in Sicily. In Spain the recombinant virus has been found alone in the majority of symptomatic beans (Monci et al., 2002), making bean plants a reservoir of pure recombinant virus, ready to be transmitted to young tomato plants. Recently it has been demonstrated that recombinants can be detected 130 days post-inoculation in plants infected by TYLCSV and TYLCV under laboratory conditions (García-Andrés et al., 2007b). Recombinants are probably created continuously and frequently in the field when TYLCSV and TYLCV are present in the same plants, and it is likely that other recombinants, beside 2/2 and 2/5, will be isolated and characterized in the future. Acknowledgements The authors thank R.G. Milne and P. Caciagli for critical reading of the manuscript, D. Marian for whitefly transmissions, M. Vecchiati for technical assistance. This work was supported in part by the Italian Ministry of Agriculture, Food and Forest Policy (MiPAAF) under the research program PROM (C.I.P.E. decision 17/2003). References Castillo, A.G., Collinet, D., Deret, S., Kashoggi, A., Bejarano, E.R., 2003. Dual interaction of plant PCNA with geminivirus replication accessory protein (REn) and viral replication protein (Rep). Virology 312, 381–394. Crespi, S., Noris, E., Vaira, A.M., Accotto, G.P., 1995. Molecular characterization of cloned DNA from tomato yellow leaf curl virus isolate from Sicily. Phytopathologia Mediterr. 34, 93–99. Czosnek, H., Laterrot, H., 1997. A worldwide survey of Tomato yellow leaf curl viruses. Arch. Virol. 142, 1391–1406. Davino, S., Davino, M., Accotto, G.P., 2008. A single-tube PCR assay for detecting viruses and their recombinants that cause tomato yellow leaf curl disease in the Mediterranean basin. J. Virol. Methods 147, 93–98. Davino, S., Napoli, C., Davino, M., Accotto, G.P., 2006. Spread of Tomato yellow leaf curl virus in Sicily: partial displacement of another geminivirus originally present. Eur. J. Plant Pathol. 114, 293–299. Fauquet, C.M., Briddon, R.W., Brown, J.K., Moriones, E., Stanley, J., Zerbini, M., Zhou, X., 2008. Geminivirus strain demarcation and nomenclature. Arch. Virol. 153, 783–821. García-Andrés, S., Monci, F., Navas-Castillo, J., Moriones, E., 2006. Begomovirus genetic diversity in the native plant reservoir Solanum nigrum: evidence for the presence of a new virus species of recombinant nature. Virology 350, 433–442. García-Andrés, S., Accotto, G.P., Navas-Castillo, J., Moriones, E., 2007a. Founder effect, plant host, and recombination shape the emergent population of begomoviruses that cause the tomato yellow leaf curl disease in the Mediterranean basin. Virology 359, 302–312. García-Andrés, S., Tomás, D.M., Sánchez-Campos, S., Navas-Castillo, J., Moriones, E., 2007b. Frequent occurrence of recombinants in mixed infections of tomato yellow leaf curl disease associated begomoviruses. Virology 365, 210–219. Grimsley, N., Hohn, T., Davies, J.W., Hohn, B., 1987. Agrobacterium-mediated delivery of infectious maize streak virus into maize plants. Nature 325, 177–179. Gutierrez, C., 1999. Geminivirus DNA replication. Cell. Mol. Life Sci. 56, 313–329. Haible, D., Kober, S., Jeske, H., 2006. Rolling circle amplification revolutionizes diagnosis and genomics of geminiviruses. J. Virol. Methods 135, 9–16. Hanley-Bowdoin, L., Settlage, S.B., Orozco, B.M., Nagar, S., Robertson, D., 2000. Geminiviruses—models for plant DNA replication, transcription and cell cycle regulation. Crit. Rev. Biochem. Mol. Biol. 35, 105–140. Hofacker, I.L., 2003. Vienna RNA secondary structure server. Nucleic Acids Res. 31, 3429–3431. Jupin, I., Hericourt, F., Benz, B., Gronenborn, B., 1995. DNA replication specificity of TYLCV geminivirus is mediated by the amino-terminal 116 amino acids of the Rep protein. FEBS Lett. 362, 116–120.

S. Davino et al. / Virus Research 143 (2009) 15–23 Kheyr-Pour, A., Bendahmane, M., Matzeit, V., Accotto, G.P., Crespi, S., Gronenborn, B., 1991. Tomato yellow leaf curl virus from Sardinia is a whitefly-transmitted monopartite geminivirus. Nucleic Acids Res. 19, 6763–6769. Laufs, J., Traut, W., Heyraud, F., Matzeit, V., Rogers, S.G., Schell, J., Gronenborn, B., 1995. In-vitro cleavage and joining at the viral origin of replication by the replication initiator protein of Tomato yellow leaf curl virus. Proc. Natl. Acad. Sci. U.S.A. 92, 3879–3883. Lazarowitz, S.G., 1992. Geminiviruses: genome structure and gene-function. Crit. Rev. Plant Sci. 11, 327–349. Lefeuvre, P., Lett, J.M., Reynaud, B., Martin, D.P., 2007 Avoidance of protein fold disruption in natural virus recombinants. PLoS Pathog 3(11) e181. doi:10.1371/journal.ppat.0030181. Monci, F., Sanchez-Campos, S., Navas-Castillo, J., Moriones, E., 2002. A natural recombinant between the geminiviruses Tomato yellow leaf curl Sardinia virus and Tomato yellow leaf curl virus exhibits a novel pathogenic phenotype and is becoming prevalent in Spanish populations. Virology 303, 317–326. Morilla, G., Krenz, B., Jeske, H., Bejarano, E.R., Wege, C., 2004. Tete a tete of Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus in single nuclei. J. Virol. 78, 10715–10723. Moriones, E., Navas-Castillo, J., 2000. Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide. Virus Res. 71, 123–134. Navas-Castillo, J., Sanchez-Campos, S., Noris, E., Louro, D., Accotto, G.P., Moriones, E., 2000. Natural recombination between Tomato yellow leaf curl virus-Is and Tomato leaf curl virus. J. Gen. Virol. 81, 2797–2801. Noris, E., Vaira, A.M., Caciagli, P., Masenga, V., Gronenborn, B., Accotto, G.P., 1998. Amino Acids in the capsid protein of Tomato yellow leaf curl virus that are crucial for systemic infection, particle formation, and insect transmission. J. Virol. 72, 10050–10057. Quinones, D., Fonseca, D., Martinez, Y., Accotto, G.P., 2002. First report of Tomato yellow leaf curl virus infecting pepper plants in Cuba. Plant Dis. 86, 73. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratory. Cold Spring Harbor, New York. Sanz, A.I., Fraile, A., García-Arenal, F., Zhou, X., Robinson, D.J., Khalid, S., Butt, T., Harrison, B.D., 2000. Multiple infection, recombination and genome relationships

23

among Begomovirus isolates found in cotton and other plants in Pakistan. J. Gen. Virol. 81, 1839–1849. Saunders, K., Lucy, A., Stanley, J., 1991. DNA forms of the geminivirus African cassava mosaic-virus consistent with a rolling circle mechanism of replication. Nucleic Acids Res. 19, 2325–2330. Settlage, S.B., See, R.G., Hanley-Bowdoin, L., 2005. Geminivirus C3 protein: replication enhancement and protein interactions. J. Virol. 15, 9885–9895. Stanley, J., 1995. Analysis of African cassava mosaic-virus recombinants suggests strand nicking occurs within the conserved nonanucleotide motif during the initiation of rolling circle DNA-replication. Virology 206, 707–712. Stanley, J., Bisaro, D.M., Briddon, R.W., Brown, J.K., Fauquet, C.M., Harrison, B.D., Rybicki, E.P., Stenger, D.C., 2005. Geminiviridae. In: Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberge, U., Ball, L.A. (Eds.), Virus Taxonomy. VIIIth Report of the ICTV. Elsevier/Academic Press, London, pp. 301–326. Stenger, D.C., Revington, G.N., Stevenson, M.C., Bisaro, D.M., 1991. Replicational release of geminivirus genomes from tandemly repeated copies—evidence for rolling-circle replication of a plant viral-DNA. Proc. Natl. Acad. Sci. U.S.A. 88, 8029–8033. Sunter, G., Bisaro, D.M., 1992. Transactivation of geminivirus AR1 and BR1 gene expression by the viral AL2 gene product occurs at the level of transcription. Plant Cell 4, 1321–1331. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596– 1599. Voinnet, O., Pinto, Y.M., Baulcombe, D.C., 1999. Suppression of gene silencing: a general strategy used by diverse DNA and RNA viruses of plants. Proc. Natl. Acad. Sci. USA 96, 14147–14152. Voinnet, O., Rivas, S., Mestre, P., Baulcombe, D., 2003. An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J. 33, 949–956. Zhou, X., Liu, Y., Robinson, D.J., Harrison, B.D., 1998. Four DNA-A variants among Pakistani isolates of cotton leaf curl virus and their affinities to DNA-A of geminivirus isolates from okra. J. Gen. Virol. 79, 915–923.