- Email: [email protected]
Two nucleoside receptors from Streptomyces coelicolor: Expression of the genes and characterization of the recombinant proteins
Protein Expression and Purification 109 (2015) 40–46
Contents lists available at ScienceDirect
Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep
Two nucleoside receptors from Streptomyces coelicolor: Expression of the genes and characterization of the recombinant proteins Fuhou Li a,b, Jingdan Liang a, Weixia Wang b, Xiufen Zhou a, Zixin Deng a,⇑, Zhijun Wang a,⇑ a
State Key Laboratory of Microbial Metabolism, School of Life Science & Biotechnology, Shanghai Jiaotong University, Shanghai 200030, People’s Republic of China School of Marine Science and Technology, Jiangsu Marine Resources Development Research Institute, Huaihai Institute of Technology, Lianyungang, Jiangsu Province 222005, People’s Republic of China b
a r t i c l e
i n f o
Article history: Received 28 October 2014 and in revised form 6 January 2015 Available online 10 February 2015 Keywords: Streptomyces coelicolor SCO4884 SCO4885 Nucleoside receptor
a b s t r a c t Streptomyces coelicolor is a soil-dwelling bacterium that undergoes an intricate, saprophytic lifecycle. The bacterium takes up exogenous nucleosides for nucleic acid synthesis or use as carbon and energy sources. However, nucleosides must pass through the membrane with the help of transporters. In the present work, the SCO4884 and SCO4885 genes were cloned into pCOLADuet-1 and overexpressed in Escherichia coli BL21. Each protein was monomeric. Using isothermal titration calorimetry, we determined that SCO4884 and SCO4885 are likely nucleoside receptors with affinity for adenosine and pyrimidine nucleosides. On the basis of bioinformatics analysis and the transporter classification system, we speculate that SCO4884–SCO4888 is an ABC-like transporter responsible for the uptake of adenosine and pyrimidine nucleosides. Ó 2015 Published by Elsevier Inc.
Introduction Nucleotide metabolism is one of the most important biochemical pathways [1]. For any growing organism, nucleotides are required for the synthesis of nucleic acids and for multiple cellular processes. Most bacteria exploit two pathways to produce nucleotides. One is de novo synthesis, and the other is the salvage pathway, which uses nucleotide precursors (nucleobases and nucleosides) from the environment [2]. Nucleosides pass through the cytoplasmic membrane with the help of multiple transporters. To date, a number of nucleoside transporters with different and overlapping affinities have been identified. In Escherichia coli, nucleosides are transported across the outer membrane by the Tsx protein [3], an equilibrative nucleoside transporter [4]. Thereafter, nucleosides are transported across the inner membrane by the NupC, NupG, and XapB transporters [5,6]. In Bacillus subtilis, the transporter NupC is responsible for the uptake of pyrimidine nucleosides, and NupG is responsible for the uptake of purine nucleosides [7,8]. These bacterial transporters are members of the concentrative nucleoside transporter (CNT)1 family and are H+ ⇑ Corresponding authors. Tel.: +86 21 62933751 2061; fax: +86 21 62932418. E-mail addresses: [email protected] (Z. Deng), [email protected] (Z. Wang). 1 Abbreviations used: CNT, concentrative nucleoside transporter; ABC, ATP-binding cassette; IEF, isoelectric focusing; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; IPTG, isopropyl b-D-thiogalactopyranoside; hrCNE, high-resolution clear native electrophoresis. http://dx.doi.org/10.1016/j.pep.2015.02.004 1046-5928/Ó 2015 Published by Elsevier Inc.
symporters [9,10]. Several ATP-binding cassette (ABC) transporters responsible for the uptake of nucleosides have been characterized in recent years [11–13]. In general, a classical ABC transporter contains integral membrane domains, ATP-hydrolyzing domains, and substrate-binding receptors [14]. With the help of substrate-binding receptors, nucleosides are transported across the membrane. RnsBACD can transport most nucleosides and plays a role in scavenging nucleosides [11]. BmpA–NupABC transports all common nucleosides [12], and PnrABCDE might be involved in the uptake of purine nucleosides [13]. RnsB, BmpA, and PnrA are nucleoside receptors with a PBP1_BmpA_PnrA_like conserved domain. Streptomyces coelicolor is a filamentous, soil-dwelling bacterium that produces a variety of secondary metabolites used in human and veterinary medicine [15]. Genome annotation indicates that S. coelicolor has a large number of ABC transporters, which are involved in processes such as nutrients transport, antibiotic production, and SAM signaling [16,17]. However, information concerning nucleoside transport in S. coelicolor is scarce. Two substrate-binding proteins, SCO4884 and SCO4885, were first identified in membrane fractions using two-dimensional isoelectric focusing (IEF)/sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) [18]. With two-dimensional native/SDS– PAGE, we have also identified the two proteins in membrane fractions. Interestingly, the two proteins showed the same mobility in the first dimensional gels and appeared in the same location in the second dimensional gels [19]. A Blast search revealed that SCO4884 and SCO4885 have a PBP1_BmpA_PnrA_like conserved
41
F. Li et al. / Protein Expression and Purification 109 (2015) 40–46
domain. The two genes are located in a putative ABC-like operon, SCO4884–SCO4888, which is responsible for nucleoside uptake [20,21]. In this study, the genes SCO4884 and SCO4885 were cloned into pCOLADuet-1 and overexpressed in E. coli BL21. After purification, the binding of nucleosides to rSCO4884 and rSCO4885 was characterized using isothermal titration calorimetry. The results suggest that SCO4884 and SCO4885 are nucleoside receptors, which deliver the nucleosides to membrane channels. SCO4884– SCO4888, the putative ABC transporter, is involved in nucleoside transport.
Materials and methods Construction of His6-tagged SCO4884 and His6-tagged SCO4885 Genomic DNA from S. coelicolor M145 was isolated using a DNA extraction kit (Invitrogen) and used as template for PCR. The primers used are listed in Table 1. The SCO4884 gene was amplified with primers F1 and R1, and the SCO4885 gene was amplified with primers F2 and R2. PCR was performed using KOD -Plus- (Toyobo). The PCR conditions were as follows: 5 min hot start at 94 °C; 30 cycles consisting of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, and extension at 68 °C for 1 min; and a final extension at 68 °C for 7 min. The amplification products were digested with EcoRI and XhoI. The digested products were then cloned into a pCOLADuet-1 vector (Novagen) digested with the same enzymes (Fig. 1). The two ligations were transformed into E. coli DH10B, and the recombinant plasmids were extracted from colonies and sequenced for verification. The recombinant plasmids contained a N-terminal nucleotide sequence coding for six histidines. Table 1 Primers used for PCR.
a
PCR products
Primers
Sequencesa
His6-tagged SCO4884
F1
ATCAGAATTCGATGCGTCGGACATCAAGACTG
R1
ATCACTCGAGTGTTATCCGCCCGTGAGCAAG
His6-tagged SCO4885
F2
ATCAGAATTCGATGCGCCGGATTTCCCGGATCAC
R2
ATCACTCGAGCACATCGACGCGACGGGGTA
Restriction enzyme cutting site was underlined.
Fig. 1. Construction of recombinant plasmids. KanR kanamycin resistant gene, lacI lac repressor, ori origin of replication (ColA ori).
Fig. 2. Expression and purification of rSCO4884 and rSCO4885. (A) Expression and purification of rSCO4884. Lane 1 cell extract (control), Lane 2 cell extract (IPTG induction), Lane 3 purified rSCO4884 with nickel-affinity, Lane 4 purified rSCO4884 with nickel-affinity and Mono Q anion exchange. (B) Expression and purification of rSCO4885. Lane 1 cell extract (control), Lane 2 cell extract (IPTG induction), Lane 3 purified rSCO4885 with nickel-affinity, Lane 4 purified rSCO4885 with nickelaffinity and Mono Q anion exchange. M molecular weight marker.
Table 2 The recombinant proteins identified by mass spectrometry. Accession numbers
Identification
Protein score
Predicted Mr. (Da)
Sequence coverage (%)
SCO4884 SCO4885
Substrate-binding protein Substrate-binding protein
165 244
35743 36106
37 40
Fig. 3. HrCNE profiles of rSCO4884 and rSCO4885. Lane 1 Bovine serum albumin (67 kDa), Lane 2 chymotrypsinogen A (25 kDa), Lane 3 purified rSCO4884, Lane 4 purified rSCO4885.
42
F. Li et al. / Protein Expression and Purification 109 (2015) 40–46
Expression and purification of rSCO4884 and rSCO4885
Fig. 4. Molecular weight determination of rSCO4884 and rSCO4885 by gel filtration chromatography. MW molecular weight (kDa), Ve elution volume, V0 void volume.
E. coli BL21 (DE3) pLysS cells were transformed with recombinant plasmids. Then, the transformed cells were cultivated on Luria–Bertani agar medium containing 25 lg/mL of chloramphenicol and kanamycin. Positive strains were isolated and saved. Each overexpression strain was grown at 37 °C in LB medium containing the same antibiotics for 3–4 h. When the cells reached an A600 of 0.6, 0.2 mM isopropyl b-D-thiogalactopyranoside (IPTG) was added to the medium, and the cells were cultivated for 5 h at 30 °C. The cultures were harvested by centrifuging at 6000g for 10 min. The operations of purification and dialysis were performed at 4 °C. About 3 g of cell pellet was resuspended in 30 mL of buffer A (20 mM Tris, 100 mM NaCl, 1 mM b-mercaptoethanol, 40 mM imidazole, pH 8.0). The suspension was sonicated (5-s pulses of 60 W for 10 min, with 10 s between each pulse). Triton X-100 (from 10% stock solution) was added to a final concentration of 0.5%, and the sample was solubilized for 30 min at 4 °C. The above suspension was centrifuged at 10,000g for 20 min. The suspension was loaded onto a Ni2+ affinity column and washed with 10 column volumes of buffer B (20 mM Tris, 100 mM NaCl, 1 mM b-mercaptoethanol, 80 mM imidazole, pH 8.0). Finally, the
Fig. 5. Multiple sequence alignments of SCO4884 and SCO4885 with other nucleoside receptors of PnrA (Treponema pallidum), RnsB (Streptococcus mutans) and BmpA (Lactococcus lactis). Identical amino acids are shaded black, and similar amino acids are shaded gray. Nucleoside-binding residues are marked with asterisk.
Table 3 The parameters of nucleosides to receptors. Substrates
Adenosine 20 -Deoxyadenosine Guanosine 20 -Deoxyguanosine Cytidine 20 -Deoxycytidine Uridine Thymidine Purine D-Ribose a b
rSCO4884
rSCO4885
Kda (lM)
N
DH (cal/mol)
DS (cal/mol/deg)
Kda (lM)
N
DH (cal/mol)
DS (cal/mol/deg)
122 ± 11 46 ± 7 NMb NM 86 ± 9 30 ± 4 132 ± 12 NM NM NM
1.2 0.7 – – 1.1 0.5 0.5 – – –
4.037E8 1.084E9 – – 7.919E8 3.612E9 1.999E8 – – –
1.35E6 3.63E6 – – 2.66E6 1.21E7 6.71E5 – – –
153 ± 14 75 ± 8 NM NM 113 ± 11 52 ± 6 155 ± 12 NM NM NM
1.1 1.1 – – 1.2 1.2 0.6 – – –
1.637E8 8.125E8 – – 5.115E8 9.213E8 1.528E8 – – –
5.47E5 2.98E6 – – 1.64E6 3.12E6 4.83E5 – – –
All values for Kd are shown ± one S.D. NM not measurable.
F. Li et al. / Protein Expression and Purification 109 (2015) 40–46
recombinant protein was eluted from the column with buffer C (20 mM Tris, 100 mM NaCl, 1 mM b-mercaptoethanol, 300 mM imidazole, pH 8.0). The sample buffer was exchanged to 20 mM HEPES (pH 7.5), 20 mM NaCl by dialyzing for 2 h. To further purify the recombinant protein, the sample was loaded onto a Mono Q™ 5/50 GL column (GE Healthcare) pre-equilibrated with buffer D (20 mM HEPES, pH 7.5) and washed with 10 column volumes of buffer D. Protein was eluted with a linear gradient of 100– 300 mM NaCl in buffer D. Peak fractions were collected and stored at 4 °C. For isothermal titration calorimetry assays, the protein buffer was changed to buffer E (20 mM HEPES, 100 mM NaCl, pH 7.5) by dialyzing for 2 h. The protein was then concentrated to 2 mg/mL using a 10-kDa size exclusion centrifugal filter device (Millipore) and stored at 4 °C until use. All supernatants containing recombinant protein were analyzed with SDS–PAGE.
Protein electrophoresis SDS–PAGE was performed according to standard procedures using 12% separating gels. The SDS gels were stained using Coomassie blue R-250 (Sigma). Using the Glyko BandScan software, band intensity was quantified. The relative level of recombinant protein was calculated as the gray level ratio between target band and total bands. High-resolution clear native electrophoresis (hrCNE) was carried out as described by Wittig et al. [22] using gradient gels of 8–16%. Bovine serum albumin (BSA; 67 kDa) and chymotrypsinogen A (25 kDa) were used as native markers.
43
Mass spectrometry Protein spots from SDS gels were excised. In-gel trypsin digestion was carried out according to Ref. [19]. For mass spectrometry, 1 lL peptide sample was mixed with 0.5 lL a-cyano-4-hydroxycinnamic acid (10 mg/ml) in 50% acetonitrile and 0.1% trifluoroacetic acid, then spotted onto the MALDI target and air dried. Peptides samples were analyzed on a 4800 MALDI TOF/TOF™ Proteomics Analyzer (Applied Biosystems, USA) equipped with 355 nm wavelength Nd:YAG laser and 2 kV acceleration voltage. The mass spectrometry was performed in the positive ion mode and data were acquired in an automatic mode. The mass range was set to 800– 4000 Da. A second run of MS/MS focused on the 8 most intensive peaks of the first MS was performed. The laser was set to fire 2500 times per spot in MS/MS mode, and collision energy was 2 kV. Mass spectra was carried out using the GPS ExplorerÒ software (Applied Biosystems), and peptide masses were searched against the S. coelicolor proteome database in NCBI by Mascot (http://www.matrixscience.com). Search parameters were as follows, a peptide mass tolerance of ±50 ppm, one missed cleavage of trypsin, oxidation of methionine, carbamidomethylation of cysteine, monoisotopic mass values, and unrestricted protein mass. Molecular weight determination with gel filtration chromatography The molecular weight of the protein was determined with gel filtration chromatography using a Superdex™ 75 10/300 GL column (GE Healthcare). The column was run with 20 mM Tris (pH8.0) at a flow rate of 0.5 mL/min, and the eluent was monitored
Fig. 6. Nucleoside binding properties of rSCO4884. (A) The titration of rSCO4884 with deoxyadenosine. The top graph shows the power that the calorimeter applied to the reaction cell to maintain it at constant temperature in terms of lcal/s plotted against the time of experiment. The bottom graph shows normalized integration data in terms of kcal/mol of injectant plotted against molar ratio. (B) The titration of rSCO4884 with deoxycytidine.
44
F. Li et al. / Protein Expression and Purification 109 (2015) 40–46
with an ultraviolet detector at 280 nm. The void volume (V0) of the column bed was determined with Blue Dextran 2000. The column was calibrated with four standard protein markers (conalbumin 75 kDa, ovalbumin 43 kDa, chymotrypsinogen A 25 kDa, ribonuclease A 13.7 kDa; GE Healthcare), and the elution volumes (Ve) of the standards were determined. A standard curve was generating by plotting ‘‘Ve/V0’’ against the log of the molecular weight. Thereafter, 1 mL of protein sample (1 mg/mL) was loaded onto the column, and its elution volume was determined. The molecular weight of the protein sample was estimated from the standard curve.
Results Expression and purification of rSCO4884 and rSCO4885 The conditions for protein expression were optimized, and the two recombinant proteins were expressed at high levels after induction with 0.2 mM IPTG at 30 °C. Using nickel affinity and Mono Q anion exchange columns, rSCO4884 and rSCO4885 were purified to at least 95% homogeneity (Fig. 2). The identity of the purified proteins was verified with mass spectrometry (Table 2). Primary characterization of the proteins
Isothermal titration calorimetry The binding of nucleosides to rSCO4884 or rSCO4885 was analyzed with a MicroCal™ iTC200 titration calorimeter (GE Healthcare). The reaction cell was 200 lL, and the reactive protein concentration was 25 lM. The nucleosides (Sigma) were used at a reactive concentration of 500 lM, except for guanosine (200 lM). Thereafter, the titrations were carried out at 25 °C according to the operation manual. A series of 15–16 injections (2.5 lL each) was applied to the cell, and the heat change was measured. Finally, the calorimetric data was analyzed using OriginÒ scientific plotting software. The heat of nucleosides dilution into buffer was subtracted from the reaction heat by performing the control injection of nucleosides into buffer. The data reported here are the average of three measurements.
Electrophoresis behavior was assessed using hrCNE gels, which are suitable for membrane proteins. As can be seen in Fig. 3, BSA is present as a monomer (67 kDa) and a dimer (134 kDa). While chymotrypsinogen A may form a tetramer, as it migrates at around 100 kDa in hrCNE gels. The mobility of rSCO4884 was greater than that of the BSA monomer, and the mobility of rSCO4885 was similar to that of the BSA monomer. According to their calculated molecular weight (37.5 kDa for rSCO4884 and 37.9 kDa for rSCO4885), we suggest that rSCO4884 and rSCO4885 exist as monomers. Gel filtration chromatography was used to determine the molecular weights. For rSCO4884, a single peak was observed corresponding to 44.5 kDa. For rSCO4885, a single peak was observed corresponding to 46.0 kDa (Fig. 4). So the apparent relative molecular weight of rSCO4884 and rSCO4885 is 44.5 and 46.0 kDa,
Fig. 7. Nucleoside binding properties of rSCO4885. (A) The titration of rSCO4885 with deoxyadenosine. The top graph shows the power that the calorimeter applied to the reaction cell to maintain it at constant temperature in terms of lcal/s plotted against the time of experiment. The bottom graph shows normalized integration data in terms of kcal/mol of injectant plotted against molar ratio. (B) The titration of rSCO4885 with deoxycytidine.
F. Li et al. / Protein Expression and Purification 109 (2015) 40–46
respectively. The results confirmed that rSCO4884 and rSCO4885 exist as monomers in solution.
45
evidence is lacking. Characterization of substrate-binding proteins will provide insight into the unknown functions of other ABC transporters.
Protein sequence alignment with other nucleoside receptors The protein sequences of SCO4884 and SCO4885 were aligned with those of PnrA (Treponema pallidum) [13], RnsB (Streptococcus mutans) [11], and BmpA (Lactococcus lactis) [12]. The results of the alignment are depicted in Fig. 5. For SCO4884 and its homologues, the amino acid identity is between 28% and 34%. For SCO4885 and its homologues, the amino acid identity is between 29% and 35%. In the National Center for Biotechnology Information database, these proteins have been placed into cluster cd06354, which contains 122 proteins with a PBP1_BmpA_PnrA_like conserved domain (updated January 17, 2013). The members of this cluster might have similar nucleoside-binding functions given that the nucleoside-binding residues are well conserved among the proteins. Nucleoside binding properties of rSCO4884 and rSCO4885 The binding of various nucleosides to rSCO4884 and rSCO4885 was analyzed using isothermal titration calorimetry. The results are shown in Table 3, Figs. 6 and 7, and the dissociation constant was calculated based on the isotherms. Among the purine nucleosides tested, rSCO4884 had affinity for adenosine and deoxyadenosine, with Kd values of 122 ± 11 and 46 ± 7 lM, respectively. No binding to guanosine and its derivative was detected. Among the pyrimidine nucleosides tested, rSCO4884 had affinity for cytidine, deoxycytidine, and uridine, with Kd values of 86 ± 9, 30 ± 4, and 132 ± 12 lM, respectively. No binding to thymidine was detected. Like rSCO4884, rSCO4885 had affinity for adenosine and pyrimidine nucleosides, but its affinities were much lower than those of rSCO4884. The data suggest that the two proteins are nucleoside receptors with a broad specificity for most nucleosides, especially deoxycytidine and deoxyadenosine. Discussion To obtain a general understanding of nucleoside transport in S. coelicolor, genes encoding potential nucleoside transporters were identified using bioinformatics analysis. The E. coli transporters NupG, NupC, and XapB were used as queries and searched against Streptomyces genomes [5,6]. No candidate sequences were found. To date, no secondary active transporter has been described in S. coelicolor. The SCO4884 and SCO4885 genes are located in locus SCO4884– SCO4888. The amino acid sequences of SCO4884 (a substrate-binding protein), SCO4886 (a putative ATP-binding protein), SCO4887 (a putative integral membrane protein), and SCO4888 (a putative integral membrane protein) show high homology to RnsB, RnsA, RnsD, and RnsC, respectively [11]. The identities are between 29% and 45%. Moreover, the SCO4884–SCO4888 locus is adjacent to SCO4889 (cdd, encoding a putative cytidine deaminase) and SCO4890 (pdp, encoding a putative thymidine phosphorylase), which are involved in nucleoside metabolism. Indeed, SCO4884– SCO4888 is characterized as an ABC transporter according to the transporter classification scheme (Transport DB 2.0, http://www. membranetransport.org/). In this study, we demonstrated that proteins SCO4884 and SCO4885 showed a broad specificity for adenosine and pyrimidine nucleosides. It is likely that the two proteins serve as peripheral nucleoside receptors and deliver the nucleosides to membrane channels. There, the nucleosides are transported across the membrane via SCO4884 (SCO4885) and its ABC parters. However, direct
Conflict of interest The authors declare that they have no conflict of interest. Acknowledgments The authors wish to thank the Ministry of Science and Technology (973 (2012CB721004 and 2009CB118901) and 863 programs), the National Science Foundation of China (31121064), the Ministry of Education of China, the Shanghai Municipal Council of Science and Technology and Shanghai Leading Academic Discipline Project B203, the State Key Laboratory of Bio-organic and Natural Products Chemistry (CAS), the National Program of Development of Transgenic New Species of China and Jiangsu Marine Resources Development Research Institute (JSIMR201335) for research support. References [1] M. Kilstrup, K. Hammer, P. Ruhdal Jensen, J. Martinussen, Nucleotide metabolism and its control in lactic acid bacteria, FEMS Microbiol. Rev. 29 (2005) 555–590. [2] T. Möhlmann, C. Bernard, S. Hach, H. Ekkehard Neuhaus, Nucleoside transport and associated metabolism, Plant Biol. 12 (2010) 26–34. [3] J. Ye, B. van den Berg, Crystal structure of the bacterial nucleoside transporter Tsx, EMBO J. 23 (2004) 3187–3195. [4] Y. Acimovic, I.R. Coe, Molecular evolution of the equilibrative nucleoside transporter family: identification of novel family members in prokaryotes and eukaryotes, Mol. Biol. Evol. 19 (2002) 2199–2210. [5] S.G. Patching, S.A. Baldwin, A.D. Baldwin, J.D. Young, M.P. Gallagher, P.J.F. Henderson, R.B. Herbert, The nucleoside transport proteins, NupC and NupG, from Escherichia coli: specific structural motifs necessary for the binding of ligands, Org. Biomol. Chem. 3 (2005) 462–470. [6] C. Seeger, C. Poulsen, G. Dandanell, Identification and characterization of genes (xapA, xapB, and xapR) involved in xanthosine catabolism in Escherichia coli, J. Bacteriol. 177 (1995) 5506–5516. [7] H.H. Saxild, L.N. Andersen, K. Hammer, Dra-nupC-pdp operon of Bacillus subtilis: nucleotide sequence, induction by deoxyribonucleosides, and transcriptional regulation by the deoR-encoded DeoR repressor protein, J. Bacteriol. 178 (1996) 424–434. [8] L.E. Johansen, P. Nygaard, C. Lassen, Y. Agersø, H.H. Saxild, Definition of a second Bacillus subtilis pur regulon comprising the pur and xpt-pbuX operons plus pbuG, nupG (yxjA), and pbuE (ydhL), J. Bacteriol. 185 (2003) 5200–5209. [9] M.H. Saier, V.S. Reddy, D.G. Tamang, Å. Västermark, The transporter classification database, Nucleic Acids Res. 42 (2014) D251–D258. [10] M.A. Cabrita, S.A. Baldwin, J.D. Young, C.E. Cass, Molecular biology and regulation of nucleoside and nucleobase transporter proteins in eukaryotes and prokaryotes, Biochem. Cell Biol. 80 (2002) 623–638. [11] A.J. Webb, A.H.F. Hosie, A member of the second carbohydrate uptake subfamily of atp-binding cassette transporters is responsible for ribonucleoside uptake in Streptococcus mutans, J. Bacteriol. 188 (2006) 8005– 8012. [12] J. Martinussen, C. Sørensen, C.B. Jendresen, M. Kilstrup, Two nucleoside transporters in Lactococcus lactis with different substrate specificities, Microbiology 156 (2010) 3148–3157. [13] R.K. Deka, C.A. Brautigam, X.F. Yang, J.S. Blevins, M. Machius, D.R. Tomchick, M.V. Norgard, The PnrA (Tp0319; TmpC) lipoprotein represents a new family of bacterial purine nucleoside receptor encoded within an ATP-binding cassette (ABC)-like operon in Treponema pallidum, J. Biol. Chem. 281 (2006) 8072–8081. [14] W. Zheng, Å. Västermark, M. Shlykov, V. Reddy, E. Sun, M. Saier, Evolutionary relationships of ATP-binding cassette (ABC) uptake porters, BMC Microbiol. 13 (2013) 1–20. [15] S.D. Bentley, K.F. Chater, A.M. Cerdeño-Tárraga, G.L. Challis, N.R. Thomson, K.D. James, D.E. Harris, M.A. Quail, H. Kieser, D. Harper, A. Bateman, S. Brown, G. Chandra, C.W. Chen, M. Collins, A. Cronin, A. Fraser, A. Goble, J. Hidalgo, T. Hornsby, S. Howarth, C.H. Huang, T. Kieser, L. Larke, L. Murphy, K. Oliver, S. O’Neil, E. Rabbinowitsch, M.A. Rajandream, K. Rutherford, S. Rutter, K. Seeger, D. Saunders, S. Sharp, R. Squares, S. Squares, K. Taylor, T. Warren, A. Wietzorrek, J. Woodward, B.G. Barrell, J. Parkhill, D.A. Hopwood, Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2), Nature 417 (2002) 141–147. [16] R. Bertram, M. Schlicht, K. Mahr, H. Nothaft, M.H. Saier, F. Titgemeyer, In Silico and transcriptional analysis of carbohydrate uptake systems of Streptomyces coelicolor A3(2), J. Bacteriol. 186 (2004) 1362–1373.
46
F. Li et al. / Protein Expression and Purification 109 (2015) 40–46
[17] S.-K. Lee, S. Mo, J.-W. Suh, An ABC transporter complex containing Sadenosylmethionine (SAM)-induced ATP-binding protein is involved in antibiotics production and SAM signaling in Streptomyces coelicolor M145, Biotechnol. Lett. 34 (2012) 1907–1914. [18] D.-W. Kim, K.F. Chater, K.-J. Lee, A. Hesketh, Effects of growth phase and the developmentally significant bldA-specified tRNA on the membrane-associated proteome of Streptomyces coelicolor, Microbiology 151 (2005) 2707–2720. [19] F. Li, J. Liang, W. Wang, X. Zhou, Z. Deng, Z. Wang, Analysis of Streptomyces coelicolor membrane proteome using two-dimensional native/native and native/ sodium dodecyl sulfate gel electrophoresis, Anal. Biochem. 465 (2014) 148–155.
[20] B.J. Thompson, D.A. Widdick, M.G. Hicks, G. Chandra, I.C. Sutcliffe, T. Palmer, M.I. Hutchings, Investigating lipoprotein biogenesis and function in the model Gram-positive bacterium Streptomyces coelicolor, Mol. Microbiol. 77 (2010) 943–957. [21] Q. Ren, K. Chen, I.T. Paulsen, TransportDB: a comprehensive database resource for cytoplasmic membrane transport systems and outer membrane channels, Nucleic Acids Res. 35 (2007) D274–D279. [22] I. Wittig, M. Karas, H. Schägger, High resolution clear native electrophoresis for in-gel functional assays and fluorescence studies of membrane protein complexes, Mol. Cell. Proteomics 6 (2007) 1215–1225.
Contents lists available at ScienceDirect
Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep
Two nucleoside receptors from Streptomyces coelicolor: Expression of the genes and characterization of the recombinant proteins Fuhou Li a,b, Jingdan Liang a, Weixia Wang b, Xiufen Zhou a, Zixin Deng a,⇑, Zhijun Wang a,⇑ a
State Key Laboratory of Microbial Metabolism, School of Life Science & Biotechnology, Shanghai Jiaotong University, Shanghai 200030, People’s Republic of China School of Marine Science and Technology, Jiangsu Marine Resources Development Research Institute, Huaihai Institute of Technology, Lianyungang, Jiangsu Province 222005, People’s Republic of China b
a r t i c l e
i n f o
Article history: Received 28 October 2014 and in revised form 6 January 2015 Available online 10 February 2015 Keywords: Streptomyces coelicolor SCO4884 SCO4885 Nucleoside receptor
a b s t r a c t Streptomyces coelicolor is a soil-dwelling bacterium that undergoes an intricate, saprophytic lifecycle. The bacterium takes up exogenous nucleosides for nucleic acid synthesis or use as carbon and energy sources. However, nucleosides must pass through the membrane with the help of transporters. In the present work, the SCO4884 and SCO4885 genes were cloned into pCOLADuet-1 and overexpressed in Escherichia coli BL21. Each protein was monomeric. Using isothermal titration calorimetry, we determined that SCO4884 and SCO4885 are likely nucleoside receptors with affinity for adenosine and pyrimidine nucleosides. On the basis of bioinformatics analysis and the transporter classification system, we speculate that SCO4884–SCO4888 is an ABC-like transporter responsible for the uptake of adenosine and pyrimidine nucleosides. Ó 2015 Published by Elsevier Inc.
Introduction Nucleotide metabolism is one of the most important biochemical pathways [1]. For any growing organism, nucleotides are required for the synthesis of nucleic acids and for multiple cellular processes. Most bacteria exploit two pathways to produce nucleotides. One is de novo synthesis, and the other is the salvage pathway, which uses nucleotide precursors (nucleobases and nucleosides) from the environment [2]. Nucleosides pass through the cytoplasmic membrane with the help of multiple transporters. To date, a number of nucleoside transporters with different and overlapping affinities have been identified. In Escherichia coli, nucleosides are transported across the outer membrane by the Tsx protein [3], an equilibrative nucleoside transporter [4]. Thereafter, nucleosides are transported across the inner membrane by the NupC, NupG, and XapB transporters [5,6]. In Bacillus subtilis, the transporter NupC is responsible for the uptake of pyrimidine nucleosides, and NupG is responsible for the uptake of purine nucleosides [7,8]. These bacterial transporters are members of the concentrative nucleoside transporter (CNT)1 family and are H+ ⇑ Corresponding authors. Tel.: +86 21 62933751 2061; fax: +86 21 62932418. E-mail addresses: [email protected] (Z. Deng), [email protected] (Z. Wang). 1 Abbreviations used: CNT, concentrative nucleoside transporter; ABC, ATP-binding cassette; IEF, isoelectric focusing; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; IPTG, isopropyl b-D-thiogalactopyranoside; hrCNE, high-resolution clear native electrophoresis. http://dx.doi.org/10.1016/j.pep.2015.02.004 1046-5928/Ó 2015 Published by Elsevier Inc.
symporters [9,10]. Several ATP-binding cassette (ABC) transporters responsible for the uptake of nucleosides have been characterized in recent years [11–13]. In general, a classical ABC transporter contains integral membrane domains, ATP-hydrolyzing domains, and substrate-binding receptors [14]. With the help of substrate-binding receptors, nucleosides are transported across the membrane. RnsBACD can transport most nucleosides and plays a role in scavenging nucleosides [11]. BmpA–NupABC transports all common nucleosides [12], and PnrABCDE might be involved in the uptake of purine nucleosides [13]. RnsB, BmpA, and PnrA are nucleoside receptors with a PBP1_BmpA_PnrA_like conserved domain. Streptomyces coelicolor is a filamentous, soil-dwelling bacterium that produces a variety of secondary metabolites used in human and veterinary medicine [15]. Genome annotation indicates that S. coelicolor has a large number of ABC transporters, which are involved in processes such as nutrients transport, antibiotic production, and SAM signaling [16,17]. However, information concerning nucleoside transport in S. coelicolor is scarce. Two substrate-binding proteins, SCO4884 and SCO4885, were first identified in membrane fractions using two-dimensional isoelectric focusing (IEF)/sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) [18]. With two-dimensional native/SDS– PAGE, we have also identified the two proteins in membrane fractions. Interestingly, the two proteins showed the same mobility in the first dimensional gels and appeared in the same location in the second dimensional gels [19]. A Blast search revealed that SCO4884 and SCO4885 have a PBP1_BmpA_PnrA_like conserved
41
F. Li et al. / Protein Expression and Purification 109 (2015) 40–46
domain. The two genes are located in a putative ABC-like operon, SCO4884–SCO4888, which is responsible for nucleoside uptake [20,21]. In this study, the genes SCO4884 and SCO4885 were cloned into pCOLADuet-1 and overexpressed in E. coli BL21. After purification, the binding of nucleosides to rSCO4884 and rSCO4885 was characterized using isothermal titration calorimetry. The results suggest that SCO4884 and SCO4885 are nucleoside receptors, which deliver the nucleosides to membrane channels. SCO4884– SCO4888, the putative ABC transporter, is involved in nucleoside transport.
Materials and methods Construction of His6-tagged SCO4884 and His6-tagged SCO4885 Genomic DNA from S. coelicolor M145 was isolated using a DNA extraction kit (Invitrogen) and used as template for PCR. The primers used are listed in Table 1. The SCO4884 gene was amplified with primers F1 and R1, and the SCO4885 gene was amplified with primers F2 and R2. PCR was performed using KOD -Plus- (Toyobo). The PCR conditions were as follows: 5 min hot start at 94 °C; 30 cycles consisting of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, and extension at 68 °C for 1 min; and a final extension at 68 °C for 7 min. The amplification products were digested with EcoRI and XhoI. The digested products were then cloned into a pCOLADuet-1 vector (Novagen) digested with the same enzymes (Fig. 1). The two ligations were transformed into E. coli DH10B, and the recombinant plasmids were extracted from colonies and sequenced for verification. The recombinant plasmids contained a N-terminal nucleotide sequence coding for six histidines. Table 1 Primers used for PCR.
a
PCR products
Primers
Sequencesa
His6-tagged SCO4884
F1
ATCAGAATTCGATGCGTCGGACATCAAGACTG
R1
ATCACTCGAGTGTTATCCGCCCGTGAGCAAG
His6-tagged SCO4885
F2
ATCAGAATTCGATGCGCCGGATTTCCCGGATCAC
R2
ATCACTCGAGCACATCGACGCGACGGGGTA
Restriction enzyme cutting site was underlined.
Fig. 1. Construction of recombinant plasmids. KanR kanamycin resistant gene, lacI lac repressor, ori origin of replication (ColA ori).
Fig. 2. Expression and purification of rSCO4884 and rSCO4885. (A) Expression and purification of rSCO4884. Lane 1 cell extract (control), Lane 2 cell extract (IPTG induction), Lane 3 purified rSCO4884 with nickel-affinity, Lane 4 purified rSCO4884 with nickel-affinity and Mono Q anion exchange. (B) Expression and purification of rSCO4885. Lane 1 cell extract (control), Lane 2 cell extract (IPTG induction), Lane 3 purified rSCO4885 with nickel-affinity, Lane 4 purified rSCO4885 with nickelaffinity and Mono Q anion exchange. M molecular weight marker.
Table 2 The recombinant proteins identified by mass spectrometry. Accession numbers
Identification
Protein score
Predicted Mr. (Da)
Sequence coverage (%)
SCO4884 SCO4885
Substrate-binding protein Substrate-binding protein
165 244
35743 36106
37 40
Fig. 3. HrCNE profiles of rSCO4884 and rSCO4885. Lane 1 Bovine serum albumin (67 kDa), Lane 2 chymotrypsinogen A (25 kDa), Lane 3 purified rSCO4884, Lane 4 purified rSCO4885.
42
F. Li et al. / Protein Expression and Purification 109 (2015) 40–46
Expression and purification of rSCO4884 and rSCO4885
Fig. 4. Molecular weight determination of rSCO4884 and rSCO4885 by gel filtration chromatography. MW molecular weight (kDa), Ve elution volume, V0 void volume.
E. coli BL21 (DE3) pLysS cells were transformed with recombinant plasmids. Then, the transformed cells were cultivated on Luria–Bertani agar medium containing 25 lg/mL of chloramphenicol and kanamycin. Positive strains were isolated and saved. Each overexpression strain was grown at 37 °C in LB medium containing the same antibiotics for 3–4 h. When the cells reached an A600 of 0.6, 0.2 mM isopropyl b-D-thiogalactopyranoside (IPTG) was added to the medium, and the cells were cultivated for 5 h at 30 °C. The cultures were harvested by centrifuging at 6000g for 10 min. The operations of purification and dialysis were performed at 4 °C. About 3 g of cell pellet was resuspended in 30 mL of buffer A (20 mM Tris, 100 mM NaCl, 1 mM b-mercaptoethanol, 40 mM imidazole, pH 8.0). The suspension was sonicated (5-s pulses of 60 W for 10 min, with 10 s between each pulse). Triton X-100 (from 10% stock solution) was added to a final concentration of 0.5%, and the sample was solubilized for 30 min at 4 °C. The above suspension was centrifuged at 10,000g for 20 min. The suspension was loaded onto a Ni2+ affinity column and washed with 10 column volumes of buffer B (20 mM Tris, 100 mM NaCl, 1 mM b-mercaptoethanol, 80 mM imidazole, pH 8.0). Finally, the
Fig. 5. Multiple sequence alignments of SCO4884 and SCO4885 with other nucleoside receptors of PnrA (Treponema pallidum), RnsB (Streptococcus mutans) and BmpA (Lactococcus lactis). Identical amino acids are shaded black, and similar amino acids are shaded gray. Nucleoside-binding residues are marked with asterisk.
Table 3 The parameters of nucleosides to receptors. Substrates
Adenosine 20 -Deoxyadenosine Guanosine 20 -Deoxyguanosine Cytidine 20 -Deoxycytidine Uridine Thymidine Purine D-Ribose a b
rSCO4884
rSCO4885
Kda (lM)
N
DH (cal/mol)
DS (cal/mol/deg)
Kda (lM)
N
DH (cal/mol)
DS (cal/mol/deg)
122 ± 11 46 ± 7 NMb NM 86 ± 9 30 ± 4 132 ± 12 NM NM NM
1.2 0.7 – – 1.1 0.5 0.5 – – –
4.037E8 1.084E9 – – 7.919E8 3.612E9 1.999E8 – – –
1.35E6 3.63E6 – – 2.66E6 1.21E7 6.71E5 – – –
153 ± 14 75 ± 8 NM NM 113 ± 11 52 ± 6 155 ± 12 NM NM NM
1.1 1.1 – – 1.2 1.2 0.6 – – –
1.637E8 8.125E8 – – 5.115E8 9.213E8 1.528E8 – – –
5.47E5 2.98E6 – – 1.64E6 3.12E6 4.83E5 – – –
All values for Kd are shown ± one S.D. NM not measurable.
F. Li et al. / Protein Expression and Purification 109 (2015) 40–46
recombinant protein was eluted from the column with buffer C (20 mM Tris, 100 mM NaCl, 1 mM b-mercaptoethanol, 300 mM imidazole, pH 8.0). The sample buffer was exchanged to 20 mM HEPES (pH 7.5), 20 mM NaCl by dialyzing for 2 h. To further purify the recombinant protein, the sample was loaded onto a Mono Q™ 5/50 GL column (GE Healthcare) pre-equilibrated with buffer D (20 mM HEPES, pH 7.5) and washed with 10 column volumes of buffer D. Protein was eluted with a linear gradient of 100– 300 mM NaCl in buffer D. Peak fractions were collected and stored at 4 °C. For isothermal titration calorimetry assays, the protein buffer was changed to buffer E (20 mM HEPES, 100 mM NaCl, pH 7.5) by dialyzing for 2 h. The protein was then concentrated to 2 mg/mL using a 10-kDa size exclusion centrifugal filter device (Millipore) and stored at 4 °C until use. All supernatants containing recombinant protein were analyzed with SDS–PAGE.
Protein electrophoresis SDS–PAGE was performed according to standard procedures using 12% separating gels. The SDS gels were stained using Coomassie blue R-250 (Sigma). Using the Glyko BandScan software, band intensity was quantified. The relative level of recombinant protein was calculated as the gray level ratio between target band and total bands. High-resolution clear native electrophoresis (hrCNE) was carried out as described by Wittig et al. [22] using gradient gels of 8–16%. Bovine serum albumin (BSA; 67 kDa) and chymotrypsinogen A (25 kDa) were used as native markers.
43
Mass spectrometry Protein spots from SDS gels were excised. In-gel trypsin digestion was carried out according to Ref. [19]. For mass spectrometry, 1 lL peptide sample was mixed with 0.5 lL a-cyano-4-hydroxycinnamic acid (10 mg/ml) in 50% acetonitrile and 0.1% trifluoroacetic acid, then spotted onto the MALDI target and air dried. Peptides samples were analyzed on a 4800 MALDI TOF/TOF™ Proteomics Analyzer (Applied Biosystems, USA) equipped with 355 nm wavelength Nd:YAG laser and 2 kV acceleration voltage. The mass spectrometry was performed in the positive ion mode and data were acquired in an automatic mode. The mass range was set to 800– 4000 Da. A second run of MS/MS focused on the 8 most intensive peaks of the first MS was performed. The laser was set to fire 2500 times per spot in MS/MS mode, and collision energy was 2 kV. Mass spectra was carried out using the GPS ExplorerÒ software (Applied Biosystems), and peptide masses were searched against the S. coelicolor proteome database in NCBI by Mascot (http://www.matrixscience.com). Search parameters were as follows, a peptide mass tolerance of ±50 ppm, one missed cleavage of trypsin, oxidation of methionine, carbamidomethylation of cysteine, monoisotopic mass values, and unrestricted protein mass. Molecular weight determination with gel filtration chromatography The molecular weight of the protein was determined with gel filtration chromatography using a Superdex™ 75 10/300 GL column (GE Healthcare). The column was run with 20 mM Tris (pH8.0) at a flow rate of 0.5 mL/min, and the eluent was monitored
Fig. 6. Nucleoside binding properties of rSCO4884. (A) The titration of rSCO4884 with deoxyadenosine. The top graph shows the power that the calorimeter applied to the reaction cell to maintain it at constant temperature in terms of lcal/s plotted against the time of experiment. The bottom graph shows normalized integration data in terms of kcal/mol of injectant plotted against molar ratio. (B) The titration of rSCO4884 with deoxycytidine.
44
F. Li et al. / Protein Expression and Purification 109 (2015) 40–46
with an ultraviolet detector at 280 nm. The void volume (V0) of the column bed was determined with Blue Dextran 2000. The column was calibrated with four standard protein markers (conalbumin 75 kDa, ovalbumin 43 kDa, chymotrypsinogen A 25 kDa, ribonuclease A 13.7 kDa; GE Healthcare), and the elution volumes (Ve) of the standards were determined. A standard curve was generating by plotting ‘‘Ve/V0’’ against the log of the molecular weight. Thereafter, 1 mL of protein sample (1 mg/mL) was loaded onto the column, and its elution volume was determined. The molecular weight of the protein sample was estimated from the standard curve.
Results Expression and purification of rSCO4884 and rSCO4885 The conditions for protein expression were optimized, and the two recombinant proteins were expressed at high levels after induction with 0.2 mM IPTG at 30 °C. Using nickel affinity and Mono Q anion exchange columns, rSCO4884 and rSCO4885 were purified to at least 95% homogeneity (Fig. 2). The identity of the purified proteins was verified with mass spectrometry (Table 2). Primary characterization of the proteins
Isothermal titration calorimetry The binding of nucleosides to rSCO4884 or rSCO4885 was analyzed with a MicroCal™ iTC200 titration calorimeter (GE Healthcare). The reaction cell was 200 lL, and the reactive protein concentration was 25 lM. The nucleosides (Sigma) were used at a reactive concentration of 500 lM, except for guanosine (200 lM). Thereafter, the titrations were carried out at 25 °C according to the operation manual. A series of 15–16 injections (2.5 lL each) was applied to the cell, and the heat change was measured. Finally, the calorimetric data was analyzed using OriginÒ scientific plotting software. The heat of nucleosides dilution into buffer was subtracted from the reaction heat by performing the control injection of nucleosides into buffer. The data reported here are the average of three measurements.
Electrophoresis behavior was assessed using hrCNE gels, which are suitable for membrane proteins. As can be seen in Fig. 3, BSA is present as a monomer (67 kDa) and a dimer (134 kDa). While chymotrypsinogen A may form a tetramer, as it migrates at around 100 kDa in hrCNE gels. The mobility of rSCO4884 was greater than that of the BSA monomer, and the mobility of rSCO4885 was similar to that of the BSA monomer. According to their calculated molecular weight (37.5 kDa for rSCO4884 and 37.9 kDa for rSCO4885), we suggest that rSCO4884 and rSCO4885 exist as monomers. Gel filtration chromatography was used to determine the molecular weights. For rSCO4884, a single peak was observed corresponding to 44.5 kDa. For rSCO4885, a single peak was observed corresponding to 46.0 kDa (Fig. 4). So the apparent relative molecular weight of rSCO4884 and rSCO4885 is 44.5 and 46.0 kDa,
Fig. 7. Nucleoside binding properties of rSCO4885. (A) The titration of rSCO4885 with deoxyadenosine. The top graph shows the power that the calorimeter applied to the reaction cell to maintain it at constant temperature in terms of lcal/s plotted against the time of experiment. The bottom graph shows normalized integration data in terms of kcal/mol of injectant plotted against molar ratio. (B) The titration of rSCO4885 with deoxycytidine.
F. Li et al. / Protein Expression and Purification 109 (2015) 40–46
respectively. The results confirmed that rSCO4884 and rSCO4885 exist as monomers in solution.
45
evidence is lacking. Characterization of substrate-binding proteins will provide insight into the unknown functions of other ABC transporters.
Protein sequence alignment with other nucleoside receptors The protein sequences of SCO4884 and SCO4885 were aligned with those of PnrA (Treponema pallidum) [13], RnsB (Streptococcus mutans) [11], and BmpA (Lactococcus lactis) [12]. The results of the alignment are depicted in Fig. 5. For SCO4884 and its homologues, the amino acid identity is between 28% and 34%. For SCO4885 and its homologues, the amino acid identity is between 29% and 35%. In the National Center for Biotechnology Information database, these proteins have been placed into cluster cd06354, which contains 122 proteins with a PBP1_BmpA_PnrA_like conserved domain (updated January 17, 2013). The members of this cluster might have similar nucleoside-binding functions given that the nucleoside-binding residues are well conserved among the proteins. Nucleoside binding properties of rSCO4884 and rSCO4885 The binding of various nucleosides to rSCO4884 and rSCO4885 was analyzed using isothermal titration calorimetry. The results are shown in Table 3, Figs. 6 and 7, and the dissociation constant was calculated based on the isotherms. Among the purine nucleosides tested, rSCO4884 had affinity for adenosine and deoxyadenosine, with Kd values of 122 ± 11 and 46 ± 7 lM, respectively. No binding to guanosine and its derivative was detected. Among the pyrimidine nucleosides tested, rSCO4884 had affinity for cytidine, deoxycytidine, and uridine, with Kd values of 86 ± 9, 30 ± 4, and 132 ± 12 lM, respectively. No binding to thymidine was detected. Like rSCO4884, rSCO4885 had affinity for adenosine and pyrimidine nucleosides, but its affinities were much lower than those of rSCO4884. The data suggest that the two proteins are nucleoside receptors with a broad specificity for most nucleosides, especially deoxycytidine and deoxyadenosine. Discussion To obtain a general understanding of nucleoside transport in S. coelicolor, genes encoding potential nucleoside transporters were identified using bioinformatics analysis. The E. coli transporters NupG, NupC, and XapB were used as queries and searched against Streptomyces genomes [5,6]. No candidate sequences were found. To date, no secondary active transporter has been described in S. coelicolor. The SCO4884 and SCO4885 genes are located in locus SCO4884– SCO4888. The amino acid sequences of SCO4884 (a substrate-binding protein), SCO4886 (a putative ATP-binding protein), SCO4887 (a putative integral membrane protein), and SCO4888 (a putative integral membrane protein) show high homology to RnsB, RnsA, RnsD, and RnsC, respectively [11]. The identities are between 29% and 45%. Moreover, the SCO4884–SCO4888 locus is adjacent to SCO4889 (cdd, encoding a putative cytidine deaminase) and SCO4890 (pdp, encoding a putative thymidine phosphorylase), which are involved in nucleoside metabolism. Indeed, SCO4884– SCO4888 is characterized as an ABC transporter according to the transporter classification scheme (Transport DB 2.0, http://www. membranetransport.org/). In this study, we demonstrated that proteins SCO4884 and SCO4885 showed a broad specificity for adenosine and pyrimidine nucleosides. It is likely that the two proteins serve as peripheral nucleoside receptors and deliver the nucleosides to membrane channels. There, the nucleosides are transported across the membrane via SCO4884 (SCO4885) and its ABC parters. However, direct
Conflict of interest The authors declare that they have no conflict of interest. Acknowledgments The authors wish to thank the Ministry of Science and Technology (973 (2012CB721004 and 2009CB118901) and 863 programs), the National Science Foundation of China (31121064), the Ministry of Education of China, the Shanghai Municipal Council of Science and Technology and Shanghai Leading Academic Discipline Project B203, the State Key Laboratory of Bio-organic and Natural Products Chemistry (CAS), the National Program of Development of Transgenic New Species of China and Jiangsu Marine Resources Development Research Institute (JSIMR201335) for research support. References [1] M. Kilstrup, K. Hammer, P. Ruhdal Jensen, J. Martinussen, Nucleotide metabolism and its control in lactic acid bacteria, FEMS Microbiol. Rev. 29 (2005) 555–590. [2] T. Möhlmann, C. Bernard, S. Hach, H. Ekkehard Neuhaus, Nucleoside transport and associated metabolism, Plant Biol. 12 (2010) 26–34. [3] J. Ye, B. van den Berg, Crystal structure of the bacterial nucleoside transporter Tsx, EMBO J. 23 (2004) 3187–3195. [4] Y. Acimovic, I.R. Coe, Molecular evolution of the equilibrative nucleoside transporter family: identification of novel family members in prokaryotes and eukaryotes, Mol. Biol. Evol. 19 (2002) 2199–2210. [5] S.G. Patching, S.A. Baldwin, A.D. Baldwin, J.D. Young, M.P. Gallagher, P.J.F. Henderson, R.B. Herbert, The nucleoside transport proteins, NupC and NupG, from Escherichia coli: specific structural motifs necessary for the binding of ligands, Org. Biomol. Chem. 3 (2005) 462–470. [6] C. Seeger, C. Poulsen, G. Dandanell, Identification and characterization of genes (xapA, xapB, and xapR) involved in xanthosine catabolism in Escherichia coli, J. Bacteriol. 177 (1995) 5506–5516. [7] H.H. Saxild, L.N. Andersen, K. Hammer, Dra-nupC-pdp operon of Bacillus subtilis: nucleotide sequence, induction by deoxyribonucleosides, and transcriptional regulation by the deoR-encoded DeoR repressor protein, J. Bacteriol. 178 (1996) 424–434. [8] L.E. Johansen, P. Nygaard, C. Lassen, Y. Agersø, H.H. Saxild, Definition of a second Bacillus subtilis pur regulon comprising the pur and xpt-pbuX operons plus pbuG, nupG (yxjA), and pbuE (ydhL), J. Bacteriol. 185 (2003) 5200–5209. [9] M.H. Saier, V.S. Reddy, D.G. Tamang, Å. Västermark, The transporter classification database, Nucleic Acids Res. 42 (2014) D251–D258. [10] M.A. Cabrita, S.A. Baldwin, J.D. Young, C.E. Cass, Molecular biology and regulation of nucleoside and nucleobase transporter proteins in eukaryotes and prokaryotes, Biochem. Cell Biol. 80 (2002) 623–638. [11] A.J. Webb, A.H.F. Hosie, A member of the second carbohydrate uptake subfamily of atp-binding cassette transporters is responsible for ribonucleoside uptake in Streptococcus mutans, J. Bacteriol. 188 (2006) 8005– 8012. [12] J. Martinussen, C. Sørensen, C.B. Jendresen, M. Kilstrup, Two nucleoside transporters in Lactococcus lactis with different substrate specificities, Microbiology 156 (2010) 3148–3157. [13] R.K. Deka, C.A. Brautigam, X.F. Yang, J.S. Blevins, M. Machius, D.R. Tomchick, M.V. Norgard, The PnrA (Tp0319; TmpC) lipoprotein represents a new family of bacterial purine nucleoside receptor encoded within an ATP-binding cassette (ABC)-like operon in Treponema pallidum, J. Biol. Chem. 281 (2006) 8072–8081. [14] W. Zheng, Å. Västermark, M. Shlykov, V. Reddy, E. Sun, M. Saier, Evolutionary relationships of ATP-binding cassette (ABC) uptake porters, BMC Microbiol. 13 (2013) 1–20. [15] S.D. Bentley, K.F. Chater, A.M. Cerdeño-Tárraga, G.L. Challis, N.R. Thomson, K.D. James, D.E. Harris, M.A. Quail, H. Kieser, D. Harper, A. Bateman, S. Brown, G. Chandra, C.W. Chen, M. Collins, A. Cronin, A. Fraser, A. Goble, J. Hidalgo, T. Hornsby, S. Howarth, C.H. Huang, T. Kieser, L. Larke, L. Murphy, K. Oliver, S. O’Neil, E. Rabbinowitsch, M.A. Rajandream, K. Rutherford, S. Rutter, K. Seeger, D. Saunders, S. Sharp, R. Squares, S. Squares, K. Taylor, T. Warren, A. Wietzorrek, J. Woodward, B.G. Barrell, J. Parkhill, D.A. Hopwood, Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2), Nature 417 (2002) 141–147. [16] R. Bertram, M. Schlicht, K. Mahr, H. Nothaft, M.H. Saier, F. Titgemeyer, In Silico and transcriptional analysis of carbohydrate uptake systems of Streptomyces coelicolor A3(2), J. Bacteriol. 186 (2004) 1362–1373.
46
F. Li et al. / Protein Expression and Purification 109 (2015) 40–46
[17] S.-K. Lee, S. Mo, J.-W. Suh, An ABC transporter complex containing Sadenosylmethionine (SAM)-induced ATP-binding protein is involved in antibiotics production and SAM signaling in Streptomyces coelicolor M145, Biotechnol. Lett. 34 (2012) 1907–1914. [18] D.-W. Kim, K.F. Chater, K.-J. Lee, A. Hesketh, Effects of growth phase and the developmentally significant bldA-specified tRNA on the membrane-associated proteome of Streptomyces coelicolor, Microbiology 151 (2005) 2707–2720. [19] F. Li, J. Liang, W. Wang, X. Zhou, Z. Deng, Z. Wang, Analysis of Streptomyces coelicolor membrane proteome using two-dimensional native/native and native/ sodium dodecyl sulfate gel electrophoresis, Anal. Biochem. 465 (2014) 148–155.
[20] B.J. Thompson, D.A. Widdick, M.G. Hicks, G. Chandra, I.C. Sutcliffe, T. Palmer, M.I. Hutchings, Investigating lipoprotein biogenesis and function in the model Gram-positive bacterium Streptomyces coelicolor, Mol. Microbiol. 77 (2010) 943–957. [21] Q. Ren, K. Chen, I.T. Paulsen, TransportDB: a comprehensive database resource for cytoplasmic membrane transport systems and outer membrane channels, Nucleic Acids Res. 35 (2007) D274–D279. [22] I. Wittig, M. Karas, H. Schägger, High resolution clear native electrophoresis for in-gel functional assays and fluorescence studies of membrane protein complexes, Mol. Cell. Proteomics 6 (2007) 1215–1225.