- Email: [email protected]
Two-stage label-free aptasensing platform for rapid detection of Cronobacter sakazakii in powdered infant formula
Sensors and Actuators B 239 (2017) 94–99
Contents lists available at ScienceDirect
Sensors and Actuators B: Chemical journal homepage: www.elsevier.com/locate/snb
Two-stage label-free aptasensing platform for rapid detection of Cronobacter sakazakii in powdered infant formula Hong-Seok Kim a , Young-Ji Kim a , Jung-Whan Chon a,1 , Dong-Hyeon Kim a , Jin-Hyeok Yim a , Hyunsook Kim b , Kun-Ho Seo a,∗ a b
Center for One Health, College of Veterinary Medicine, Konkuk University, Seoul, South Korea Department of Food & Nutrition, College of Human Ecology, Hanyang University, Seoul, South Korea
a r t i c l e
i n f o
Article history: Received 23 March 2016 Received in revised form 26 July 2016 Accepted 29 July 2016 Available online 1 August 2016 Keywords: Cronobacter sakazakii Aptamer Gold nanoparticles Powdered infant formula
a b s t r a c t Cronobacter sakazakii constitutes one of the most life-threatening foodborne pathogens in neonates, and is typically acquired via contaminated powdered infant formula. In this study, we developed a sensitive and convenient two-stage label-free aptasensing platform for colorimetric detection of C. sakazakii in powdered infant formula. In this system, C. sakazakii depletes aptamers from the test solution, and the reduction of aptamers induces aggregation of gold nanoparticles in salt, a process accompanied by a color change from red to purple. Under optimal conditions, C. sakazakii present in PIF at a concentration as low as 7.1 × 103 CFU mL−1 could be visually detected within 30 min, with a linear range between 7.1 × 103 and 7.1 × 107 CFU mL−1 . This novel assay provides new opportunities to detect bacteria in real-world samples. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Cronobacter spp. (formerly Enterobacter sakazakii) are opportunistic pathogens that cause necrotizing enterocolitis, sepsis, and meningitis in all age groups [1]. The International Commission for Microbiological Specifications for Foods characterizes Cronobacter spp. as a pathogen that can cause potentially life-threatening chronic sequelae [2]. Among the Cronobacter spp., C. sakazakii has been reported as the predominant cause of serious neonatal and infant infections [3,4]. Indeed, the fatality rate of C. sakazakiiinfected infants can reach up to 80% [3,5] and outbreaks of these bacterial infections have been mainly linked with powdered infant formula [1,4,6]. Despite the high risk of infection of Cronobacter spp., including C. sakazakii, most studies on the development of a Cronobacter-specific immunosensor have been performed using self-developed antibodies, because there is currently no commercial antibody available against this bacterium [6–8].
Abbreviations: AuNP, gold nanoparticle; BB, binding buffer; PIF, powdered infant formula; SELEX, systematic evolution of ligands by exponential enrichment; U.S. FDA, United States Food and Drug Administration. ∗ Corresponding author. E-mail address: [email protected] (K.-H. Seo). 1 Current address: Division of Microbiology, National Center for Toxicological Research, US Food and Drug Administration, Jefferson, AR, USA. http://dx.doi.org/10.1016/j.snb.2016.07.173 0925-4005/© 2016 Elsevier B.V. All rights reserved.
Aptamers are functional DNA/RNA structures with high affinity and specificity for various targets such as small inorganic and organic molecules, proteins, and whole cells; they are generated from random-sequence nucleic acid libraries by systematic evolution of ligands by exponential enrichment (SELEX), an in vitro selection method [9–11]. Aptamers have several advantages for application in various types of biosensors such as their small size, low immunogenicity, convenience of synthesis, chemical stability, and flexibility [11,12]. Label-free colorimetric aptamer-based biosensors (aptasensors) based on the conjugation of unmodified gold nanoparticles (AuNPs) to aptamers have been developed; these have high sensitivity and selectivity without requiring complicated instrumentation, since the results of the colorimetric reaction are visible to the naked eye [12,13]. In these sensors, dissociation of the aptamers from AuNPs in the presence of the target triggers salt-induced aggregation of the nanoparticles, which is accompanied by a color change from red to purple [14]. Most colorimetric aptasensors developed to date were designed against proteins and small molecules [13–17]. Label-free colorimetric aptasensors that detect the foodborne pathogens Escherichia coli O157:H7 and Salmonella Typhimurium have also been reported, but the performance of these sensors in actual food samples has not been evaluated [18]. To the best of our knowledge, there have been no reports of label-free aptasensors to detect bacteria in actual food samples, nor of a Cronobacter-specific aptamer. In this study, we selected aptamers against live intact C. sakazakii
H.-S. Kim et al. / Sensors and Actuators B 239 (2017) 94–99
95
Fig. 1. Schematic illustration of conventional one-stage label-free aptasensor (A) and the proposed two-stage colorimetric aptasensing platform (B) designed to detect C. sakazakii in PIF using unmodified AuNPs and aptamers.
cells using whole-cell SELEX and combined these with AuNPs to establish a two-stage aptasensing platform for specific detection of C. sakazakii in real-world samples (Fig. 1). The analytical performance of the platform was evaluated using artificially inoculated PIF. 2. Materials and methods 2.1. Bacterial strains and culture The bacterial strain used as the target for aptamer selection was Cronobacter sakazakii ATCC 29544, obtained from the American Type Culture Collection (Manassas, VA, USA). C. sakazakii A-9002 and 4923-TN isolated from infected infants were used for the inclusivity test. The non-Cronobacter strains used for the counterSELEX or exclusivity tests included Salmonella Enteritidis and E. coli O157:H7 from the U.S. Food and Drug Administration (FDA), as well as Staphylococcus aureus ATCC 6538, Bacillus cereus ATCC 14579, Shigella flexneri ATCC 12022, and Shigella sonnei ATCC 25931. Other Cronobacter spp., including C. malonaticus LMG 23826, C. turicensis LMG 23827, C. muytjensii ATCC 51329, C. condimenti LMG 26520, C. universalis LMG 26249, and C. dublinensis LMG 23823 strains (kindly provided by Dr. Ben D. Tall, US FDA, Laurel, MD), were also tested to verify the specificity of the selected aptamers. All bacteria strains were cultured in buffered peptone water (Oxoid, Hampshire, UK) at 37 ◦ C for 18–24 h prior to use. 2.2. Selection of aptamers by whole-cell SELEX The whole cell-SELEX procedure for live intact C. sakazakii was adapted from previous work [19]. All oligomers used in this study were synthesized by Cosmo Genetech (Seoul, Korea). The singlestranded DNA (ssDNA) library contained a 40-base central random sequence flanked by two constant primer-hybridization sites (5 GGT ATT GAG GGT CGC ATC N40 GA TGG CTC TAA CTC TCC TCT-3 ).
Before each round of selection, purified random ssDNA libraries were heated at 95 ◦ C for 5 min in binding buffer (BB; 50 mM TrisHCl, 150 mM NaCl, and 5 mM MgCl2 ) and then cooled on ice for 10 min. All bacterial cells were washed and resuspended in BB prior to use. For positive selection, C. sakazakii ATCC 29544 (approximately 108 CFU mL−1 ) was incubated in 1 mL BB containing 1 M of ssDNA library for 30 min at 25 ◦ C, and then centrifuged at 5000 × g for 5 min to remove unbound aptamers, followed by rinsing twice with BB. The precipitant was diluted by adding 95 L of 10 mM TrisHCl buffer containing 10 mM EDTA, pH 7.4 (Sigma, St. Louis, MO, USA), boiled for 10 min, and centrifuged at 14,000 × g for 15 min at 4 ◦ C. The resulting supernatant containing candidate aptamers was used as a template for symmetric and asymmetric PCR [19] to obtain the ssDNA pool for the next round of selection. In 10 iterations of SELEX, counter SELEX-directed steps were carried out starting from round 4 against a negative bacterial mixture containing heat-treated C. sakazakii, live S. Enteritidis, E. coli O157:H7, and S. aureus. In addition, the incubation time for positive selection was reduced to 20 and 10 min starting from rounds 3 and 8 of SELEX, respectively, to select aptamers with high affinity. To remove any nonspecific binding sequences from the pool, salmon sperm DNA (0.1 mg L−1 ; Sigma) was added as masking DNA during the positive selection step starting from round 6. After 10 rounds of selection, the symmetric PCR product was inserted into the TOPO® TA cloning vector (Invitrogen, Carlsbad, CA, USA) and transformed into DH5␣ competent E. coli cells (RBC Bioscience, Taipei, Taiwan). Individual colonies were picked randomly and their inserts were sequenced by Cosmo Genetech. 2.3. Aptasensor preparation and optimization The preparation procedures of label-free aptamer-adsorbed AuNPs and salt-inducing aggregation were based on previous work [14]. Briefly, 10 nm citrate-stabilized AuNP solution (10 nM; Sigma) was adjusted to pH 5.5 with 1 N HCl. Then, 10 L of CS4 aptamer
96
H.-S. Kim et al. / Sensors and Actuators B 239 (2017) 94–99
with an adenine base at the 5 and 3 ends (CS4A: 1.8, 3.6, 5.4, 7.2, 9.0, 10.8, and 12.6 M in BB) was mixed with 90 L of AuNP solution (final concentration: 9 nM) for 3 min at room temperature, and then 10 L of 2 M NaCl was slowly added to the mixture. The change in absorbance at 520 and 630 nm was recorded using an ultraviolet-visible absorption spectrometer (Nanodrop 2000; Thermo Scientific, Wilmington, DE, USA). 2.4. Analytical procedure A mixture consisting of concentrated pellet of each bacterial sample (approximately 108 CFU) and CS4A (9 M) was incubated in 10 L of BB for 10 min, then centrifuged at 5000 × g for 5 min; the supernatant containing unbound aptamer (10 L) was incubated for 3 min with 90 L of acidified AuNP solution. After slowly adding 10 L of 2 M NaCl, the color and spectral change were observed by naked eye or with the Nanodrop 2000 spectrometer. The distribution of AuNPs was visualized from transmission electron micrographs acquired on a JEM-2000FX microscope (JEOL, Tokyo, Japan). To exclude nonspecific binding resulting from the ssDNA, a scrambled CS4A sequence was synthesized with the same number of nucleotides as the original sequence but with the nucleotide order mixed at random sites (CS4B: GGT GTG CGT GTG TGA GCG AGC GTG TGC GAG TGC GTG CGC G, with the same sequence in the primer region). The CS4B sequence was tested with C. sakazakii ATCC 29544 using the same method described above. 2.5. Evaluation of analytical performance Commercial PIF used as a real-world sample was enriched according to the U.S. FDA Bacteriological Analytical Manual [20], with some modifications. Briefly, 10 g of PIF was inoculated with a low number of C. sakazakii cells (about 1.6 CFU) and stored at room temperature overnight to simulate typical use of the product. Subsequently, 90 mL of buffered peptone water was added to the inoculated and negative samples, followed by incubation for 24 h at 37 ◦ C. To determine the detection limit of the sensor, enriched inoculated sample was serially diluted by 10 fold with the negative sample. Aliquots (1 mL) of each dilution were centrifuged at 5000 × g for 5 min to remove fat, filtered using a 1.2 m syringe filter (Sartorius, Goettingen, Germany) following resuspension, concentrated by centrifugation at 5000 × g for 5 min, and analyzed with the aptasensor as described above in Section 2.4. 3. Results and discussion Most label-free aptasensors function in one stage (Fig. 1A). However, a number of factors present in real samples could alter the environment of the aptamer–AuNP solution and lead to detection failure [21]; indeed, in a pilot study, components of PIF severely affected the absorbance of AuNPs and suppressed salt-induced aggregation (Fig. S1). Therefore, a two-stage label-free aptasensing platform was designed to minimize potential interference from confounding factors (Fig. 1B). The platform is based on citrate-capped AuNP, which is normally red due to electrical stabilization [13]. In the absence of target bacteria, target-specific aptamers (in this case, CS4A) diffuse freely in solution and are not removed by centrifugation in the first stage; then in the second stage, they adsorb onto AuNPs and prevent salt-induced aggregation via electrostatic repulsion. However, the aptamers are depleted from the solution in the presence of target bacteria, enabling free AuNPs to aggregate in the second stage, which results in a color change to purple (Fig. 1B). This color change can be observed visually or measured as the ratio of absorbance at 630 and 520 nm (A630 /A520 ) [13].
Fig. 2. Optimization of the molar ratio of CS4A to AuNP. Points and error bars represent means and standard deviations, respectively, of three measurements. The inset photograph shows color changes of AuNPs at each ratio, which are visible to the naked eye.
3.1. Selection of aptamers that efficiently adsorb onto AuNPs Aptamers obtained after round 10 of selection were cloned and sequenced. The majority of sequences could be classified into six groups according to sequence similarity (Table 1). In a preliminary screen by flow cytometry, all sequences showed comparable capture efficiency (14.34%–20.40%) (Fig. S2). However, typical aptamers are relatively long, which can lead to inefficient adsorption to AuNPs due to steric hindrance [22]. To circumvent this issue we selected CS4, which has random regions with high adenine- and cytosine-to-thymine ratios (Table 1), since previous studies have shown that the relative affinities of adenine and cytosine to AuNPs are higher than that of thymine [23–25]. In addition, we appended an adenine at each terminus of the CS4 sequence (CS4A; Fig. S3), since it was reported that although each nucleotide contributes to adsorption, terminal bases play a key role in actual binding [25]. In contrast, in a pilot study, CS12, which had the highest capture efficiency, showed poor adsorption onto AuNPs with or without an adenine at the 5 and 3 end (data not shown). 3.2. Optimization of key parameters Unlike in single-stage aptasensing, it was essential to reduce the time required for aptamer–AuNP binding in the two-stage aptasensing, because the adsorption process should be conducted on site. It was previously found that lowering the pH facilitated DNA adsorption and improved the stability of the conjugate [25,26]. Therefore, before the remaining/unbound CS4A in the supernatant of the first tube was added, AuNPs were acidified to pH 5.5 based on results from a pilot study that showed AuNP self-aggregation below this value (Fig. S4). Considering that a change of pH can undermine the target-binding affinity of an aptamer [27], in previous studies, the pH of the AuNP solution was altered rather than that used for aptamer selection in order to maximize detection efficiency [28–30]. Our platform has the particular advantage in that target binding and colorimetric detection occur in independent spaces. The optimal CS4A-to-AuNP ratio was determined, since an excess of aptamer can lower specificity. Salt induced AuNP aggregation at a molar ratio below 100:1 (Fig. 2). Even with an increase in the amount of CS4A, A630 /A520 values remained close to 0.2, indicating that AuNPs were fully protected from aggregation at CS4A-to-AuNP molar ratios above 100:1. This ratio was therefore deemed suitable for colorimetric aptasensing.
H.-S. Kim et al. / Sensors and Actuators B 239 (2017) 94–99
97
Fig. 3. Ultraviolet-visible absorption spectra (left) and transmission electron micrographs (right) of AuNPs after salt-loading under optimized experimental conditions. Curves represent the following: a, BB without aptamers (positive control); b, supernatant from CS4A aptamers reacted with C. sakazakii; c, supernatant from CS4B scrambled aptamers reacted with C. sakazakii; d, BB with CS4A only (negative control). Inset photograph in the graph on the left shows corresponding color changes, which are visible to the naked eye.
Table 1 Sequences of aptamers selected using Cronobacter sakazakii cells. Aptamer
Central sequence
%AC
%T
CS1 CS3 CS4 CS5 CS8 CS12
GGGGTTGGGGTGGTGGGTAACGGGGTCTTCGGTGTTGGAT GGGTCGGGGGTGGTGGGTGGGGTTTCTCGTCTGGCTTCGG GTGGTCGGGGTGGTGGGTGGGAGGGCGACTTCATCTGCGC GGGTTGGGTGGGTCGGGGTGTATGCGACTAGTGCCGGAGT GGGTTGGGTGGGTCGGGGTGTATGCGACTAGTGCCGGTGT GGGTCGGGGGTGGTGGGTGGGGGTTCTCGTCTGGCTTCGG
15 15 25 22.5 20 15
30 30 22.5 25 27.5 27.5
In a pilot study, we determined an optimal NaCl concentration for AuNP aggregation of 2 M (Fig. S5). The selected time for binding between C. sakazakii and CS4A (10 min; i.e., the time applied in the last SELEX round) allowed sufficient depletion of CS4A in the supernatant (Fig. S6). 3.3. Colorimetric detection of C. sakazakii The analytical performance of the platform was assessed with C. sakazakii ATCC 29544 using optimized detection conditions. BB without aptamers (curve a) and the supernatant from CS4A reacted with C. sakazakii (curve b) did not protect AuNPs from salt-induced aggregation, whereas the supernatant from CS4B reacted with C. sakazakii (curve c) and BB with CS4A only (curve d) stabilized AuNPs and prevented aggregation (Fig. 3). These results indicate that the developed two-stage aptasensing platform using CS4A works effectively for colorimetric detection of C. sakazakii. To assess the selectivity, inclusivity and exclusivity tests were performed against a series of C. sakazakii strains and other nonCronobacter bacteria listed in Section 2.1. A630 /A520 values for all C. sakazakii strains were higher than 0.5, with an obvious change in color from red to purple or blue-gray (Fig. S7A and B). On the contrary, the highest A630 /A520 value for non-Cronobacter strains was 0.32 (S. flexneri), and the sample remained red. Furthermore, the A630 /A520 value of heat-treated C. sakazakii (0.13) was 6–7 times lower than that of cultured C. sakazakii (0.88) (Fig. S7A). These results indicate that the color change occurred specifically as a result of the binding between CS4A and live intact C. sakazakii cells. We also assessed the specificity of the sensor for six other Cronobacter species. Although CS4A was selected using C. sakazakii, the aptamers also reacted with some other Cronobacter species tested (data not shown). This result is similar to that of a previous
study in which an aptamer selected using Listeria monocytogenes showed significant binding affinity to other Listeria species because the other species were not used as counter-targets in the SELEX process [31]. However, there was no color change observed at 107 CFU (1 log CFU reduced) for any of the other Cronobacter species besides C. sakazakii. At this concentration, the A630 /A520 value for C. sakazakii was 0.74, whereas the highest value for the other species was 0.38 (i.e., for C. muytjensii and C. universalis) (Fig. S7B). These findings indicate that the absorbance ratios and color changes were correlated with specificity, as clearly higher absorbance ratios and deeper color change were only observed for the targeted species. The results suggest that although the target moieties of C. sakazakii are also present in other Cronobacter species, the affinity of CS4A to these moieties is still substantially lower in other species than in C. sakazakii. Thus, the aptasensor could detect C. sakazakii with high specificity, and that other bacteria could not effectively induce aggregation of AuNPs. 3.4. Target detection in PIF The aptasensor was tested against enriched 10% PIF containing various amounts of C. sakazakii. The detection limit was defined as three standard deviations above background level [17], so that a reaction was considered positive when the A630 /A520 ratio was equal to or greater than the detection limit. The calibration curve revealed that the A630 /A520 ratio of 7.1 × 103 CFU mL−1 C. sakazakii was still significantly higher than that of blank (Fig. 4). The linear regression equation was y = 19.982x − 5.501, with a linear correlation coefficient of 0.997 (Fig. 4, inset). This detection limit is comparable to those obtained by previous methods based on C. sakazakii-specific antibodies [8,32]. In particular, Kong et al. [8] reported that a sandwich enzyme-linked immunosorbent assay
98
H.-S. Kim et al. / Sensors and Actuators B 239 (2017) 94–99
Center Support Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (716002-7). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.snb.2016.07.173. References
Fig. 4. Absorbance ratio at 630 and 520 nm versus concentration of Cronobacter sakazakii ATCC 29544. Upper inset shows the derived calibration curve; data points and error bars represent means and standard deviations, respectively, of three measurements. Lower inset photograph shows color changes of AuNPs at each concentration, which are visible to the naked eye. Far-left and -right tubes show results in the presence of 0.9 M CS4A (negative control) and in the absence of aptamers (positive control), respectively.
with a monoclonal antibody could detect up to 1 × 104 CFU mL−1 C. sakazakii, and that it was possible to enrich and test PIF samples contaminated with 1 CFU g−1 C. sakazakii in just 4 h. These results suggest that our platform is not only sufficiently sensitive against PIF contaminated with as low as 10−1 CFU g−1 C. sakazakii which was suggested as in real contaminated samples [33], but also offers the possibility of reducing turnaround time. In addition, it does not require fluorescent labeling, advanced instruments, and animal experiments for producing antibodies, in contrast to existing C. sakazakii sensors based on antibodies. 4. Conclusion A two-stage label-free aptasensing platform was established to detect C. sakazakii in PIF based on aptamers selected using live C. sakazakii cells. The assay requires 30 min or less to complete after sample enrichment and minimizes factors that inhibit salt-induced AuNP aggregation as compared to conventional single-stage aptasensing methods. In addition, the low detection limit (7.1 × 103 CFU mL−1 ) and the fact that the results are visible to the naked eye enable simple and rapid detection by shortening the sample enrichment period. This is the first report of an aptamer against C. sakazakii and of a label-free aptasensor for detection of foodborne pathogens in real-world products. In the future, the platform can be customized with target-specific aptamers to detect other bacteria of interest in different types of sample. Acknowledgments The authors are grateful to Dr. Ben D. Tall at the U.S. FDA for providing Cronobacter strains, and thank Jinho Hyon at Hanyang University for his assistance with transmission electron microscopy. This work was supported by the National Research Foundation of Korea grant funded by the Korea government (MSIP) (2015R1A2A2A05001288) and by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries (IPET) through Agriculture, Food and Rural Affairs Research
[1] A. Hoque, T. Ahmed, M. Shahidullah, A. Hossain, A. Mannan, K. Noor, et al., Isolation and molecular identification of Cronobacter spp. from powdered infant formula (PIF) in Bangladesh, Int. J. Food Microbiol. 142 (2010) 375–378. [2] International Commission for Microbiological Specifications for Foods (ICMSF), Microorganisms in Foods 7. Microbiological Testing in Food Safety Management, Kluwer Academic/Plenum Publishers, New York (2002). [3] C. Qiming, T. Tingting, B. Xiaomei, L. Yingjian, L. Fengxia, Z. Ligong, et al., Mining for sensitive and reliable species-specific primers for PCR for detection of Cronobacter sakazakii by a bioinformatics approach, J. Dairy Sci. 98 (2015) 5091–5101. [4] S. Hariri, S. Joseph, S.J. Forsythe, Cronobacter sakazakii ST4 strains and neonatal meningitis, United States, Emerg. Infect. Dis. 19 (2013) 175–177. [5] M. Fakruddin, M.M. Rahaman, M.M. Ahmed, M.M. Hoque, Cronobacter sakazakii (Enterobacter sakazakii): an emerging foodborne pathogen, Int. J. Biomed. Adv. Res. 4 (2013) 349. [6] S. Park, S. Shukla, Y. Kim, S. Oh, S. Hun Kim, M. Kim, Development of sandwich enzyme-linked immunosorbent assay for the detection of Cronobacter muytjensii (formerly called Enterobacter sakazakii), Microbiol. Immunol. 56 (2012) 472–479. [7] X. Xu, Y. Zhang, M. Shi, W. Sheng, X. Du, M. Yuan, et al., Two novel analytical methods based on polyclonal and monoclonal antibodies for the rapid detection of Cronobacter spp.: Development and application in powdered infant formula, LWT—Food Sci. Technol. 56 (2014) 335–340. [8] D. Kong, L. Liu, C. Xing, H. Kuang, C. Xu, Sensitive and highly specific detection of Cronobacter sakazakii based on monoclonal sandwich ELISA, Food Agric. Immunol. 26 (2015) 566–576. [9] C. Tuerk, L. Gold, Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase, Science 249 (1990) 505–510. [10] A.D. Ellington, J.W. Szostak, In vitro selection of RNA molecules that bind specific ligands, Nature 346 (1990) 818–822. [11] J. Zhou, M.R. Battig, Y. Wang, Aptamer-based molecular recognition for biosensor development, Anal. Bioanal. Chem. 398 (2010) 2471–2480. [12] K. Han, Z. Liang, N. Zhou, Design strategies for aptamer-based biosensors, Sensors 10 (2010) 4541–4557. [13] J. Liu, W. Bai, S. Niu, C. Zhu, S. Yang, A. Chen, Highly sensitive colorimetric detection of 17-estradiol using split DNA aptamers immobilized on unmodified gold nanoparticles, Sci. Rep. 4 (2014) 7571. [14] Y.S. Kim, J.H. Kim, I.A. Kim, S.J. Lee, J. Jurng, M.B. Gu, A novel colorimetric aptasensor using gold nanoparticle for a highly sensitive and specific detection of oxytetracycline, Biosens. Bioelectron. 26 (2010) 1644–1649. [15] L. Wang, X. Liu, X. Hu, S. Song, C. Fan, Unmodified gold nanoparticles as a colorimetric probe for potassium DNA aptamers, Chem. Commun. (2006) 3780–3782. [16] H. Wei, B. Li, J. Li, E. Wang, S. Dong, Simple and sensitive aptamer-based colorimetric sensing of protein using unmodified gold nanoparticle probes, Chem. Commun. (2007) 3735–3737. [17] C. Yang, Y. Wang, J.-L. Marty, X. Yang, Aptamer-based colorimetric biosensing of Ochratoxin A using unmodified gold nanoparticles indicator, Biosens. Bioelectron. 26 (2011) 2724–2727. [18] W.-H. Wu, M. Li, Y. Wang, H.-X. Ouyang, L. Wang, C.-X. Li, et al., Aptasensors for rapid detection of Escherichia coli O157:H7 and Salmonella Typhimurium, Nanoscale Res. Lett. 7 (2012) 658. [19] O.S. Kolovskaya, A.G. Savitskaya, T.N. Zamay, I.T. Reshetneva, G.S. Zamay, E.N. Erkaev, et al., Development of bacteriostatic DNA aptamers for Salmonella, J. Med. Chem. 56 (2013) 1564–1572. [20] FDA BAM, 2012. Chapter 29, Cronobacter. http://www.fda.gov/Food/ FoodScienceResearch/LaboratoryMethods/ucm289378.htm (accessed 9.02.16). [21] S. Lee, D.H. Manjunatha, W. Jeon, C. Ban, Cationic surfactant-based colorimetric detection of plasmodium lactate dehydrogenase, a biomarker for malaria using the specific DNA aptamer, PLoS One 9 (2014) 1–6. [22] Z. Xiao, O.C. Farokhzad, Aptamer-functionalized nanoparticles, ACS Nano 6 (2012) 3670–3676. [23] X. Zhang, B. Liu, M.R. Servos, J. Liu, Polarity control for nonthiolated DNA adsorption onto gold nanoparticles, Langmuir 29 (2013) 6091–6098. [24] E.M. Nelson, L.J. Rothberg, Kinetics and mechanism of single-stranded DNA adsorption onto citrate-stabilized gold nanoparticles in colloidal solution, Langmuir 27 (2011) 1770–1777. [25] X. Zhang, B. Liu, N. Dave, M.R. Servos, J. Liu, Instantaneous attachment of an ultrahigh density of nonthiolated DNA to gold nanoparticles and its applications, Langmuir 28 (2012) 17053–17060.
H.-S. Kim et al. / Sensors and Actuators B 239 (2017) 94–99 [26] X. Zhang, M.R. Servos, J. Liu, Surface science of DNA adsorption onto citrate-capped gold nanoparticles, Langmuir 28 (2012) 3896–3902. [27] T. Hianik, V. Ostatná, M. Sonlajtnerova, I. Grman, Influence of ionic strength, pH and aptamer configuration for binding affinity to thrombin, Bioelectrochemistry 70 (2007) 127–133. [28] L. Li, B. Li, Y. Qi, Y. Jin, Label-free aptamer-based colorimetric detection of mercury ions in aqueous media using unmodified gold nanoparticles as colorimetric probe, Anal. Bioanal. Chem. 393 (2009) 2051–2057. [29] H. Zhang, F. Li, H. Chen, Y. Ma, S. Qi, X. Chen, et al., AuNPs colorimetric sensor for detecting platelet-derived growth factor-BB based on isothermal target-triggering strand displacement amplification, Sens. Actuators B Chem. 207 (2015) 748–755. [30] Q. Xu, S. Du, G. Jin, H. Li, X.Y. Hu, Determination of acetamiprid by a colorimetric method based on the aggregation of gold nanoparticles, Microchim. Acta 173 (2011) 323–329. [31] S.H. Suh, L.-A. Jaykus, Nucleic acid aptamers for capture and detection of Listeria spp, J. Biotechnol. 167 (2013) 454–461. [32] S. Shukla, G. Lee, X. Song, S. Park, M. Kim, Immunoliposome-based immunomagnetic concentration and separation assay for rapid detection of Cronobacter sakazakii, Biosens. Bioelectron. 77 (2016) 986–994. [33] H.L. Muytjens, H. Roelofs-Willemse, G.H. Jaspar, Quality of powdered substitutes for breast milk with regard to members of the family Enterobactericeae, J. Clin. Microbiol. 26 (1988) 743–746.
Biographies Hong-Seok Kim received a D.V.M. from Konkuk University in 2012. He is currently a student in the combined M.S./Ph.D. program at Konkuk University. His research is focused on rapid detection/diagnostic methods using aptamers and nanomaterials. Young-Ji Kim received a D.V.M. from Konkuk University in 2014. He is currently a student in the combined M.S./Ph.D. program at Konkuk University. His research is focused on rapid detection/diagnostic methods using aptamers and nanomaterials.
99
Jung-Whan Chon joined the National Center for Toxicological Research at the U.S. Food and Drug Administration as a postdoctoral fellow in 2015, after receiving his D.V.M. and Ph.D. degrees from Konkuk University in 2009 and 2015, respectively. His current research is on rapid detection and metagenomics analytical methods. Dong-Hyeon Kim received a D.V.M. from Konkuk University in 2012. He is currently a student in the combined M.S./Ph.D. program at Konkuk University. His research is on probiotics and analysis of gut microbiota. Jin-Hyeok Yim received a D.V.M. from Konkuk University in 2013. He is currently a student in the combined M.S./Ph.D. program at Konkuk University. His research is on rapid detection of pathogens using nucleic acid-based techniques. Hyunsook Kim joined the Department of Food & Nutrition at Hanyang University as an assistant professor in 2015. She received her B.S. and M.S. degree from Yeungnam University and Kyungpook National University in 1990 and 1993, respectively. Since Ph.D. from University of Georgia in 1999, she has worked in NIH (National Institutes of Health, NIDDK, Diabetic Branch), USDA (U.S. Department of Agriculture, Beltsville Human Nutrition Center), USDA Healthy Processed Food Research Center, and University of California, Davis. Kun-Ho Seo joined the Department of Veterinary Medicine at Konkuk University as an assistant professor in 2006, where he is currently a full professor. He received his B.S. and M.S. degrees from Konkuk University in 1990 and 1993, respectively, and his Ph.D. degree from the University of Georgia in 1997. From 1998 to 2000 and 2001 to 2006 he was postdoctoral associate at U.S. Department of Agriculture and U.S. Food and Drug Administration, respectively. His current research interests include rapid detection methods, antibiotic resistance, probiotics, and genetic analysis of gut microbiota.
Contents lists available at ScienceDirect
Sensors and Actuators B: Chemical journal homepage: www.elsevier.com/locate/snb
Two-stage label-free aptasensing platform for rapid detection of Cronobacter sakazakii in powdered infant formula Hong-Seok Kim a , Young-Ji Kim a , Jung-Whan Chon a,1 , Dong-Hyeon Kim a , Jin-Hyeok Yim a , Hyunsook Kim b , Kun-Ho Seo a,∗ a b
Center for One Health, College of Veterinary Medicine, Konkuk University, Seoul, South Korea Department of Food & Nutrition, College of Human Ecology, Hanyang University, Seoul, South Korea
a r t i c l e
i n f o
Article history: Received 23 March 2016 Received in revised form 26 July 2016 Accepted 29 July 2016 Available online 1 August 2016 Keywords: Cronobacter sakazakii Aptamer Gold nanoparticles Powdered infant formula
a b s t r a c t Cronobacter sakazakii constitutes one of the most life-threatening foodborne pathogens in neonates, and is typically acquired via contaminated powdered infant formula. In this study, we developed a sensitive and convenient two-stage label-free aptasensing platform for colorimetric detection of C. sakazakii in powdered infant formula. In this system, C. sakazakii depletes aptamers from the test solution, and the reduction of aptamers induces aggregation of gold nanoparticles in salt, a process accompanied by a color change from red to purple. Under optimal conditions, C. sakazakii present in PIF at a concentration as low as 7.1 × 103 CFU mL−1 could be visually detected within 30 min, with a linear range between 7.1 × 103 and 7.1 × 107 CFU mL−1 . This novel assay provides new opportunities to detect bacteria in real-world samples. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Cronobacter spp. (formerly Enterobacter sakazakii) are opportunistic pathogens that cause necrotizing enterocolitis, sepsis, and meningitis in all age groups [1]. The International Commission for Microbiological Specifications for Foods characterizes Cronobacter spp. as a pathogen that can cause potentially life-threatening chronic sequelae [2]. Among the Cronobacter spp., C. sakazakii has been reported as the predominant cause of serious neonatal and infant infections [3,4]. Indeed, the fatality rate of C. sakazakiiinfected infants can reach up to 80% [3,5] and outbreaks of these bacterial infections have been mainly linked with powdered infant formula [1,4,6]. Despite the high risk of infection of Cronobacter spp., including C. sakazakii, most studies on the development of a Cronobacter-specific immunosensor have been performed using self-developed antibodies, because there is currently no commercial antibody available against this bacterium [6–8].
Abbreviations: AuNP, gold nanoparticle; BB, binding buffer; PIF, powdered infant formula; SELEX, systematic evolution of ligands by exponential enrichment; U.S. FDA, United States Food and Drug Administration. ∗ Corresponding author. E-mail address: [email protected] (K.-H. Seo). 1 Current address: Division of Microbiology, National Center for Toxicological Research, US Food and Drug Administration, Jefferson, AR, USA. http://dx.doi.org/10.1016/j.snb.2016.07.173 0925-4005/© 2016 Elsevier B.V. All rights reserved.
Aptamers are functional DNA/RNA structures with high affinity and specificity for various targets such as small inorganic and organic molecules, proteins, and whole cells; they are generated from random-sequence nucleic acid libraries by systematic evolution of ligands by exponential enrichment (SELEX), an in vitro selection method [9–11]. Aptamers have several advantages for application in various types of biosensors such as their small size, low immunogenicity, convenience of synthesis, chemical stability, and flexibility [11,12]. Label-free colorimetric aptamer-based biosensors (aptasensors) based on the conjugation of unmodified gold nanoparticles (AuNPs) to aptamers have been developed; these have high sensitivity and selectivity without requiring complicated instrumentation, since the results of the colorimetric reaction are visible to the naked eye [12,13]. In these sensors, dissociation of the aptamers from AuNPs in the presence of the target triggers salt-induced aggregation of the nanoparticles, which is accompanied by a color change from red to purple [14]. Most colorimetric aptasensors developed to date were designed against proteins and small molecules [13–17]. Label-free colorimetric aptasensors that detect the foodborne pathogens Escherichia coli O157:H7 and Salmonella Typhimurium have also been reported, but the performance of these sensors in actual food samples has not been evaluated [18]. To the best of our knowledge, there have been no reports of label-free aptasensors to detect bacteria in actual food samples, nor of a Cronobacter-specific aptamer. In this study, we selected aptamers against live intact C. sakazakii
H.-S. Kim et al. / Sensors and Actuators B 239 (2017) 94–99
95
Fig. 1. Schematic illustration of conventional one-stage label-free aptasensor (A) and the proposed two-stage colorimetric aptasensing platform (B) designed to detect C. sakazakii in PIF using unmodified AuNPs and aptamers.
cells using whole-cell SELEX and combined these with AuNPs to establish a two-stage aptasensing platform for specific detection of C. sakazakii in real-world samples (Fig. 1). The analytical performance of the platform was evaluated using artificially inoculated PIF. 2. Materials and methods 2.1. Bacterial strains and culture The bacterial strain used as the target for aptamer selection was Cronobacter sakazakii ATCC 29544, obtained from the American Type Culture Collection (Manassas, VA, USA). C. sakazakii A-9002 and 4923-TN isolated from infected infants were used for the inclusivity test. The non-Cronobacter strains used for the counterSELEX or exclusivity tests included Salmonella Enteritidis and E. coli O157:H7 from the U.S. Food and Drug Administration (FDA), as well as Staphylococcus aureus ATCC 6538, Bacillus cereus ATCC 14579, Shigella flexneri ATCC 12022, and Shigella sonnei ATCC 25931. Other Cronobacter spp., including C. malonaticus LMG 23826, C. turicensis LMG 23827, C. muytjensii ATCC 51329, C. condimenti LMG 26520, C. universalis LMG 26249, and C. dublinensis LMG 23823 strains (kindly provided by Dr. Ben D. Tall, US FDA, Laurel, MD), were also tested to verify the specificity of the selected aptamers. All bacteria strains were cultured in buffered peptone water (Oxoid, Hampshire, UK) at 37 ◦ C for 18–24 h prior to use. 2.2. Selection of aptamers by whole-cell SELEX The whole cell-SELEX procedure for live intact C. sakazakii was adapted from previous work [19]. All oligomers used in this study were synthesized by Cosmo Genetech (Seoul, Korea). The singlestranded DNA (ssDNA) library contained a 40-base central random sequence flanked by two constant primer-hybridization sites (5 GGT ATT GAG GGT CGC ATC N40 GA TGG CTC TAA CTC TCC TCT-3 ).
Before each round of selection, purified random ssDNA libraries were heated at 95 ◦ C for 5 min in binding buffer (BB; 50 mM TrisHCl, 150 mM NaCl, and 5 mM MgCl2 ) and then cooled on ice for 10 min. All bacterial cells were washed and resuspended in BB prior to use. For positive selection, C. sakazakii ATCC 29544 (approximately 108 CFU mL−1 ) was incubated in 1 mL BB containing 1 M of ssDNA library for 30 min at 25 ◦ C, and then centrifuged at 5000 × g for 5 min to remove unbound aptamers, followed by rinsing twice with BB. The precipitant was diluted by adding 95 L of 10 mM TrisHCl buffer containing 10 mM EDTA, pH 7.4 (Sigma, St. Louis, MO, USA), boiled for 10 min, and centrifuged at 14,000 × g for 15 min at 4 ◦ C. The resulting supernatant containing candidate aptamers was used as a template for symmetric and asymmetric PCR [19] to obtain the ssDNA pool for the next round of selection. In 10 iterations of SELEX, counter SELEX-directed steps were carried out starting from round 4 against a negative bacterial mixture containing heat-treated C. sakazakii, live S. Enteritidis, E. coli O157:H7, and S. aureus. In addition, the incubation time for positive selection was reduced to 20 and 10 min starting from rounds 3 and 8 of SELEX, respectively, to select aptamers with high affinity. To remove any nonspecific binding sequences from the pool, salmon sperm DNA (0.1 mg L−1 ; Sigma) was added as masking DNA during the positive selection step starting from round 6. After 10 rounds of selection, the symmetric PCR product was inserted into the TOPO® TA cloning vector (Invitrogen, Carlsbad, CA, USA) and transformed into DH5␣ competent E. coli cells (RBC Bioscience, Taipei, Taiwan). Individual colonies were picked randomly and their inserts were sequenced by Cosmo Genetech. 2.3. Aptasensor preparation and optimization The preparation procedures of label-free aptamer-adsorbed AuNPs and salt-inducing aggregation were based on previous work [14]. Briefly, 10 nm citrate-stabilized AuNP solution (10 nM; Sigma) was adjusted to pH 5.5 with 1 N HCl. Then, 10 L of CS4 aptamer
96
H.-S. Kim et al. / Sensors and Actuators B 239 (2017) 94–99
with an adenine base at the 5 and 3 ends (CS4A: 1.8, 3.6, 5.4, 7.2, 9.0, 10.8, and 12.6 M in BB) was mixed with 90 L of AuNP solution (final concentration: 9 nM) for 3 min at room temperature, and then 10 L of 2 M NaCl was slowly added to the mixture. The change in absorbance at 520 and 630 nm was recorded using an ultraviolet-visible absorption spectrometer (Nanodrop 2000; Thermo Scientific, Wilmington, DE, USA). 2.4. Analytical procedure A mixture consisting of concentrated pellet of each bacterial sample (approximately 108 CFU) and CS4A (9 M) was incubated in 10 L of BB for 10 min, then centrifuged at 5000 × g for 5 min; the supernatant containing unbound aptamer (10 L) was incubated for 3 min with 90 L of acidified AuNP solution. After slowly adding 10 L of 2 M NaCl, the color and spectral change were observed by naked eye or with the Nanodrop 2000 spectrometer. The distribution of AuNPs was visualized from transmission electron micrographs acquired on a JEM-2000FX microscope (JEOL, Tokyo, Japan). To exclude nonspecific binding resulting from the ssDNA, a scrambled CS4A sequence was synthesized with the same number of nucleotides as the original sequence but with the nucleotide order mixed at random sites (CS4B: GGT GTG CGT GTG TGA GCG AGC GTG TGC GAG TGC GTG CGC G, with the same sequence in the primer region). The CS4B sequence was tested with C. sakazakii ATCC 29544 using the same method described above. 2.5. Evaluation of analytical performance Commercial PIF used as a real-world sample was enriched according to the U.S. FDA Bacteriological Analytical Manual [20], with some modifications. Briefly, 10 g of PIF was inoculated with a low number of C. sakazakii cells (about 1.6 CFU) and stored at room temperature overnight to simulate typical use of the product. Subsequently, 90 mL of buffered peptone water was added to the inoculated and negative samples, followed by incubation for 24 h at 37 ◦ C. To determine the detection limit of the sensor, enriched inoculated sample was serially diluted by 10 fold with the negative sample. Aliquots (1 mL) of each dilution were centrifuged at 5000 × g for 5 min to remove fat, filtered using a 1.2 m syringe filter (Sartorius, Goettingen, Germany) following resuspension, concentrated by centrifugation at 5000 × g for 5 min, and analyzed with the aptasensor as described above in Section 2.4. 3. Results and discussion Most label-free aptasensors function in one stage (Fig. 1A). However, a number of factors present in real samples could alter the environment of the aptamer–AuNP solution and lead to detection failure [21]; indeed, in a pilot study, components of PIF severely affected the absorbance of AuNPs and suppressed salt-induced aggregation (Fig. S1). Therefore, a two-stage label-free aptasensing platform was designed to minimize potential interference from confounding factors (Fig. 1B). The platform is based on citrate-capped AuNP, which is normally red due to electrical stabilization [13]. In the absence of target bacteria, target-specific aptamers (in this case, CS4A) diffuse freely in solution and are not removed by centrifugation in the first stage; then in the second stage, they adsorb onto AuNPs and prevent salt-induced aggregation via electrostatic repulsion. However, the aptamers are depleted from the solution in the presence of target bacteria, enabling free AuNPs to aggregate in the second stage, which results in a color change to purple (Fig. 1B). This color change can be observed visually or measured as the ratio of absorbance at 630 and 520 nm (A630 /A520 ) [13].
Fig. 2. Optimization of the molar ratio of CS4A to AuNP. Points and error bars represent means and standard deviations, respectively, of three measurements. The inset photograph shows color changes of AuNPs at each ratio, which are visible to the naked eye.
3.1. Selection of aptamers that efficiently adsorb onto AuNPs Aptamers obtained after round 10 of selection were cloned and sequenced. The majority of sequences could be classified into six groups according to sequence similarity (Table 1). In a preliminary screen by flow cytometry, all sequences showed comparable capture efficiency (14.34%–20.40%) (Fig. S2). However, typical aptamers are relatively long, which can lead to inefficient adsorption to AuNPs due to steric hindrance [22]. To circumvent this issue we selected CS4, which has random regions with high adenine- and cytosine-to-thymine ratios (Table 1), since previous studies have shown that the relative affinities of adenine and cytosine to AuNPs are higher than that of thymine [23–25]. In addition, we appended an adenine at each terminus of the CS4 sequence (CS4A; Fig. S3), since it was reported that although each nucleotide contributes to adsorption, terminal bases play a key role in actual binding [25]. In contrast, in a pilot study, CS12, which had the highest capture efficiency, showed poor adsorption onto AuNPs with or without an adenine at the 5 and 3 end (data not shown). 3.2. Optimization of key parameters Unlike in single-stage aptasensing, it was essential to reduce the time required for aptamer–AuNP binding in the two-stage aptasensing, because the adsorption process should be conducted on site. It was previously found that lowering the pH facilitated DNA adsorption and improved the stability of the conjugate [25,26]. Therefore, before the remaining/unbound CS4A in the supernatant of the first tube was added, AuNPs were acidified to pH 5.5 based on results from a pilot study that showed AuNP self-aggregation below this value (Fig. S4). Considering that a change of pH can undermine the target-binding affinity of an aptamer [27], in previous studies, the pH of the AuNP solution was altered rather than that used for aptamer selection in order to maximize detection efficiency [28–30]. Our platform has the particular advantage in that target binding and colorimetric detection occur in independent spaces. The optimal CS4A-to-AuNP ratio was determined, since an excess of aptamer can lower specificity. Salt induced AuNP aggregation at a molar ratio below 100:1 (Fig. 2). Even with an increase in the amount of CS4A, A630 /A520 values remained close to 0.2, indicating that AuNPs were fully protected from aggregation at CS4A-to-AuNP molar ratios above 100:1. This ratio was therefore deemed suitable for colorimetric aptasensing.
H.-S. Kim et al. / Sensors and Actuators B 239 (2017) 94–99
97
Fig. 3. Ultraviolet-visible absorption spectra (left) and transmission electron micrographs (right) of AuNPs after salt-loading under optimized experimental conditions. Curves represent the following: a, BB without aptamers (positive control); b, supernatant from CS4A aptamers reacted with C. sakazakii; c, supernatant from CS4B scrambled aptamers reacted with C. sakazakii; d, BB with CS4A only (negative control). Inset photograph in the graph on the left shows corresponding color changes, which are visible to the naked eye.
Table 1 Sequences of aptamers selected using Cronobacter sakazakii cells. Aptamer
Central sequence
%AC
%T
CS1 CS3 CS4 CS5 CS8 CS12
GGGGTTGGGGTGGTGGGTAACGGGGTCTTCGGTGTTGGAT GGGTCGGGGGTGGTGGGTGGGGTTTCTCGTCTGGCTTCGG GTGGTCGGGGTGGTGGGTGGGAGGGCGACTTCATCTGCGC GGGTTGGGTGGGTCGGGGTGTATGCGACTAGTGCCGGAGT GGGTTGGGTGGGTCGGGGTGTATGCGACTAGTGCCGGTGT GGGTCGGGGGTGGTGGGTGGGGGTTCTCGTCTGGCTTCGG
15 15 25 22.5 20 15
30 30 22.5 25 27.5 27.5
In a pilot study, we determined an optimal NaCl concentration for AuNP aggregation of 2 M (Fig. S5). The selected time for binding between C. sakazakii and CS4A (10 min; i.e., the time applied in the last SELEX round) allowed sufficient depletion of CS4A in the supernatant (Fig. S6). 3.3. Colorimetric detection of C. sakazakii The analytical performance of the platform was assessed with C. sakazakii ATCC 29544 using optimized detection conditions. BB without aptamers (curve a) and the supernatant from CS4A reacted with C. sakazakii (curve b) did not protect AuNPs from salt-induced aggregation, whereas the supernatant from CS4B reacted with C. sakazakii (curve c) and BB with CS4A only (curve d) stabilized AuNPs and prevented aggregation (Fig. 3). These results indicate that the developed two-stage aptasensing platform using CS4A works effectively for colorimetric detection of C. sakazakii. To assess the selectivity, inclusivity and exclusivity tests were performed against a series of C. sakazakii strains and other nonCronobacter bacteria listed in Section 2.1. A630 /A520 values for all C. sakazakii strains were higher than 0.5, with an obvious change in color from red to purple or blue-gray (Fig. S7A and B). On the contrary, the highest A630 /A520 value for non-Cronobacter strains was 0.32 (S. flexneri), and the sample remained red. Furthermore, the A630 /A520 value of heat-treated C. sakazakii (0.13) was 6–7 times lower than that of cultured C. sakazakii (0.88) (Fig. S7A). These results indicate that the color change occurred specifically as a result of the binding between CS4A and live intact C. sakazakii cells. We also assessed the specificity of the sensor for six other Cronobacter species. Although CS4A was selected using C. sakazakii, the aptamers also reacted with some other Cronobacter species tested (data not shown). This result is similar to that of a previous
study in which an aptamer selected using Listeria monocytogenes showed significant binding affinity to other Listeria species because the other species were not used as counter-targets in the SELEX process [31]. However, there was no color change observed at 107 CFU (1 log CFU reduced) for any of the other Cronobacter species besides C. sakazakii. At this concentration, the A630 /A520 value for C. sakazakii was 0.74, whereas the highest value for the other species was 0.38 (i.e., for C. muytjensii and C. universalis) (Fig. S7B). These findings indicate that the absorbance ratios and color changes were correlated with specificity, as clearly higher absorbance ratios and deeper color change were only observed for the targeted species. The results suggest that although the target moieties of C. sakazakii are also present in other Cronobacter species, the affinity of CS4A to these moieties is still substantially lower in other species than in C. sakazakii. Thus, the aptasensor could detect C. sakazakii with high specificity, and that other bacteria could not effectively induce aggregation of AuNPs. 3.4. Target detection in PIF The aptasensor was tested against enriched 10% PIF containing various amounts of C. sakazakii. The detection limit was defined as three standard deviations above background level [17], so that a reaction was considered positive when the A630 /A520 ratio was equal to or greater than the detection limit. The calibration curve revealed that the A630 /A520 ratio of 7.1 × 103 CFU mL−1 C. sakazakii was still significantly higher than that of blank (Fig. 4). The linear regression equation was y = 19.982x − 5.501, with a linear correlation coefficient of 0.997 (Fig. 4, inset). This detection limit is comparable to those obtained by previous methods based on C. sakazakii-specific antibodies [8,32]. In particular, Kong et al. [8] reported that a sandwich enzyme-linked immunosorbent assay
98
H.-S. Kim et al. / Sensors and Actuators B 239 (2017) 94–99
Center Support Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (716002-7). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.snb.2016.07.173. References
Fig. 4. Absorbance ratio at 630 and 520 nm versus concentration of Cronobacter sakazakii ATCC 29544. Upper inset shows the derived calibration curve; data points and error bars represent means and standard deviations, respectively, of three measurements. Lower inset photograph shows color changes of AuNPs at each concentration, which are visible to the naked eye. Far-left and -right tubes show results in the presence of 0.9 M CS4A (negative control) and in the absence of aptamers (positive control), respectively.
with a monoclonal antibody could detect up to 1 × 104 CFU mL−1 C. sakazakii, and that it was possible to enrich and test PIF samples contaminated with 1 CFU g−1 C. sakazakii in just 4 h. These results suggest that our platform is not only sufficiently sensitive against PIF contaminated with as low as 10−1 CFU g−1 C. sakazakii which was suggested as in real contaminated samples [33], but also offers the possibility of reducing turnaround time. In addition, it does not require fluorescent labeling, advanced instruments, and animal experiments for producing antibodies, in contrast to existing C. sakazakii sensors based on antibodies. 4. Conclusion A two-stage label-free aptasensing platform was established to detect C. sakazakii in PIF based on aptamers selected using live C. sakazakii cells. The assay requires 30 min or less to complete after sample enrichment and minimizes factors that inhibit salt-induced AuNP aggregation as compared to conventional single-stage aptasensing methods. In addition, the low detection limit (7.1 × 103 CFU mL−1 ) and the fact that the results are visible to the naked eye enable simple and rapid detection by shortening the sample enrichment period. This is the first report of an aptamer against C. sakazakii and of a label-free aptasensor for detection of foodborne pathogens in real-world products. In the future, the platform can be customized with target-specific aptamers to detect other bacteria of interest in different types of sample. Acknowledgments The authors are grateful to Dr. Ben D. Tall at the U.S. FDA for providing Cronobacter strains, and thank Jinho Hyon at Hanyang University for his assistance with transmission electron microscopy. This work was supported by the National Research Foundation of Korea grant funded by the Korea government (MSIP) (2015R1A2A2A05001288) and by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries (IPET) through Agriculture, Food and Rural Affairs Research
[1] A. Hoque, T. Ahmed, M. Shahidullah, A. Hossain, A. Mannan, K. Noor, et al., Isolation and molecular identification of Cronobacter spp. from powdered infant formula (PIF) in Bangladesh, Int. J. Food Microbiol. 142 (2010) 375–378. [2] International Commission for Microbiological Specifications for Foods (ICMSF), Microorganisms in Foods 7. Microbiological Testing in Food Safety Management, Kluwer Academic/Plenum Publishers, New York (2002). [3] C. Qiming, T. Tingting, B. Xiaomei, L. Yingjian, L. Fengxia, Z. Ligong, et al., Mining for sensitive and reliable species-specific primers for PCR for detection of Cronobacter sakazakii by a bioinformatics approach, J. Dairy Sci. 98 (2015) 5091–5101. [4] S. Hariri, S. Joseph, S.J. Forsythe, Cronobacter sakazakii ST4 strains and neonatal meningitis, United States, Emerg. Infect. Dis. 19 (2013) 175–177. [5] M. Fakruddin, M.M. Rahaman, M.M. Ahmed, M.M. Hoque, Cronobacter sakazakii (Enterobacter sakazakii): an emerging foodborne pathogen, Int. J. Biomed. Adv. Res. 4 (2013) 349. [6] S. Park, S. Shukla, Y. Kim, S. Oh, S. Hun Kim, M. Kim, Development of sandwich enzyme-linked immunosorbent assay for the detection of Cronobacter muytjensii (formerly called Enterobacter sakazakii), Microbiol. Immunol. 56 (2012) 472–479. [7] X. Xu, Y. Zhang, M. Shi, W. Sheng, X. Du, M. Yuan, et al., Two novel analytical methods based on polyclonal and monoclonal antibodies for the rapid detection of Cronobacter spp.: Development and application in powdered infant formula, LWT—Food Sci. Technol. 56 (2014) 335–340. [8] D. Kong, L. Liu, C. Xing, H. Kuang, C. Xu, Sensitive and highly specific detection of Cronobacter sakazakii based on monoclonal sandwich ELISA, Food Agric. Immunol. 26 (2015) 566–576. [9] C. Tuerk, L. Gold, Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase, Science 249 (1990) 505–510. [10] A.D. Ellington, J.W. Szostak, In vitro selection of RNA molecules that bind specific ligands, Nature 346 (1990) 818–822. [11] J. Zhou, M.R. Battig, Y. Wang, Aptamer-based molecular recognition for biosensor development, Anal. Bioanal. Chem. 398 (2010) 2471–2480. [12] K. Han, Z. Liang, N. Zhou, Design strategies for aptamer-based biosensors, Sensors 10 (2010) 4541–4557. [13] J. Liu, W. Bai, S. Niu, C. Zhu, S. Yang, A. Chen, Highly sensitive colorimetric detection of 17-estradiol using split DNA aptamers immobilized on unmodified gold nanoparticles, Sci. Rep. 4 (2014) 7571. [14] Y.S. Kim, J.H. Kim, I.A. Kim, S.J. Lee, J. Jurng, M.B. Gu, A novel colorimetric aptasensor using gold nanoparticle for a highly sensitive and specific detection of oxytetracycline, Biosens. Bioelectron. 26 (2010) 1644–1649. [15] L. Wang, X. Liu, X. Hu, S. Song, C. Fan, Unmodified gold nanoparticles as a colorimetric probe for potassium DNA aptamers, Chem. Commun. (2006) 3780–3782. [16] H. Wei, B. Li, J. Li, E. Wang, S. Dong, Simple and sensitive aptamer-based colorimetric sensing of protein using unmodified gold nanoparticle probes, Chem. Commun. (2007) 3735–3737. [17] C. Yang, Y. Wang, J.-L. Marty, X. Yang, Aptamer-based colorimetric biosensing of Ochratoxin A using unmodified gold nanoparticles indicator, Biosens. Bioelectron. 26 (2011) 2724–2727. [18] W.-H. Wu, M. Li, Y. Wang, H.-X. Ouyang, L. Wang, C.-X. Li, et al., Aptasensors for rapid detection of Escherichia coli O157:H7 and Salmonella Typhimurium, Nanoscale Res. Lett. 7 (2012) 658. [19] O.S. Kolovskaya, A.G. Savitskaya, T.N. Zamay, I.T. Reshetneva, G.S. Zamay, E.N. Erkaev, et al., Development of bacteriostatic DNA aptamers for Salmonella, J. Med. Chem. 56 (2013) 1564–1572. [20] FDA BAM, 2012. Chapter 29, Cronobacter. http://www.fda.gov/Food/ FoodScienceResearch/LaboratoryMethods/ucm289378.htm (accessed 9.02.16). [21] S. Lee, D.H. Manjunatha, W. Jeon, C. Ban, Cationic surfactant-based colorimetric detection of plasmodium lactate dehydrogenase, a biomarker for malaria using the specific DNA aptamer, PLoS One 9 (2014) 1–6. [22] Z. Xiao, O.C. Farokhzad, Aptamer-functionalized nanoparticles, ACS Nano 6 (2012) 3670–3676. [23] X. Zhang, B. Liu, M.R. Servos, J. Liu, Polarity control for nonthiolated DNA adsorption onto gold nanoparticles, Langmuir 29 (2013) 6091–6098. [24] E.M. Nelson, L.J. Rothberg, Kinetics and mechanism of single-stranded DNA adsorption onto citrate-stabilized gold nanoparticles in colloidal solution, Langmuir 27 (2011) 1770–1777. [25] X. Zhang, B. Liu, N. Dave, M.R. Servos, J. Liu, Instantaneous attachment of an ultrahigh density of nonthiolated DNA to gold nanoparticles and its applications, Langmuir 28 (2012) 17053–17060.
H.-S. Kim et al. / Sensors and Actuators B 239 (2017) 94–99 [26] X. Zhang, M.R. Servos, J. Liu, Surface science of DNA adsorption onto citrate-capped gold nanoparticles, Langmuir 28 (2012) 3896–3902. [27] T. Hianik, V. Ostatná, M. Sonlajtnerova, I. Grman, Influence of ionic strength, pH and aptamer configuration for binding affinity to thrombin, Bioelectrochemistry 70 (2007) 127–133. [28] L. Li, B. Li, Y. Qi, Y. Jin, Label-free aptamer-based colorimetric detection of mercury ions in aqueous media using unmodified gold nanoparticles as colorimetric probe, Anal. Bioanal. Chem. 393 (2009) 2051–2057. [29] H. Zhang, F. Li, H. Chen, Y. Ma, S. Qi, X. Chen, et al., AuNPs colorimetric sensor for detecting platelet-derived growth factor-BB based on isothermal target-triggering strand displacement amplification, Sens. Actuators B Chem. 207 (2015) 748–755. [30] Q. Xu, S. Du, G. Jin, H. Li, X.Y. Hu, Determination of acetamiprid by a colorimetric method based on the aggregation of gold nanoparticles, Microchim. Acta 173 (2011) 323–329. [31] S.H. Suh, L.-A. Jaykus, Nucleic acid aptamers for capture and detection of Listeria spp, J. Biotechnol. 167 (2013) 454–461. [32] S. Shukla, G. Lee, X. Song, S. Park, M. Kim, Immunoliposome-based immunomagnetic concentration and separation assay for rapid detection of Cronobacter sakazakii, Biosens. Bioelectron. 77 (2016) 986–994. [33] H.L. Muytjens, H. Roelofs-Willemse, G.H. Jaspar, Quality of powdered substitutes for breast milk with regard to members of the family Enterobactericeae, J. Clin. Microbiol. 26 (1988) 743–746.
Biographies Hong-Seok Kim received a D.V.M. from Konkuk University in 2012. He is currently a student in the combined M.S./Ph.D. program at Konkuk University. His research is focused on rapid detection/diagnostic methods using aptamers and nanomaterials. Young-Ji Kim received a D.V.M. from Konkuk University in 2014. He is currently a student in the combined M.S./Ph.D. program at Konkuk University. His research is focused on rapid detection/diagnostic methods using aptamers and nanomaterials.
99
Jung-Whan Chon joined the National Center for Toxicological Research at the U.S. Food and Drug Administration as a postdoctoral fellow in 2015, after receiving his D.V.M. and Ph.D. degrees from Konkuk University in 2009 and 2015, respectively. His current research is on rapid detection and metagenomics analytical methods. Dong-Hyeon Kim received a D.V.M. from Konkuk University in 2012. He is currently a student in the combined M.S./Ph.D. program at Konkuk University. His research is on probiotics and analysis of gut microbiota. Jin-Hyeok Yim received a D.V.M. from Konkuk University in 2013. He is currently a student in the combined M.S./Ph.D. program at Konkuk University. His research is on rapid detection of pathogens using nucleic acid-based techniques. Hyunsook Kim joined the Department of Food & Nutrition at Hanyang University as an assistant professor in 2015. She received her B.S. and M.S. degree from Yeungnam University and Kyungpook National University in 1990 and 1993, respectively. Since Ph.D. from University of Georgia in 1999, she has worked in NIH (National Institutes of Health, NIDDK, Diabetic Branch), USDA (U.S. Department of Agriculture, Beltsville Human Nutrition Center), USDA Healthy Processed Food Research Center, and University of California, Davis. Kun-Ho Seo joined the Department of Veterinary Medicine at Konkuk University as an assistant professor in 2006, where he is currently a full professor. He received his B.S. and M.S. degrees from Konkuk University in 1990 and 1993, respectively, and his Ph.D. degree from the University of Georgia in 1997. From 1998 to 2000 and 2001 to 2006 he was postdoctoral associate at U.S. Department of Agriculture and U.S. Food and Drug Administration, respectively. His current research interests include rapid detection methods, antibiotic resistance, probiotics, and genetic analysis of gut microbiota.