- Email: [email protected]
Two translation initiation codons direct the expression of annexin VI 64 kDa and 68 kDa isoforms
YMGME-06106; No. of pages: 6; 4C: Molecular Genetics and Metabolism xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Molecular Genetics and Metabolism journal homepage: www.elsevier.com/locate/ymgme
Two translation initiation codons direct the expression of annexin VI 64 kDa and 68 kDa isoforms Alfonso González-Noriega a,⁎, Colette Michalak a, Rafael Cervantes-Roldán b,c, Vania Gómez-Romero b,c, Alfonso León-Del-Río b,c,⁎⁎ a b c
Departamento de Biología Celular, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, México D.F. 04510, México Programa de Investigación de Cáncer de Mama, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, México D.F. 04510, México Departamento de Biología Molecular y Biotecnología, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, México D.F. 04510, México
a r t i c l e
i n f o
Article history: Received 19 August 2016 Received in revised form 7 October 2016 Accepted 8 October 2016 Available online xxxx Keywords: Annexin VI Annexin VI isoforms Cellular localization Cellular expression
a b s t r a c t Annexin A6 is a multicompetent, multifunctional protein involved in several biological processes within and outside of the cell. Whereas HeLa cells express annexin A6 only as a 68/67-kDa doublet, indicating alternative splicing (Smith PD et al. (1994) Proc Natl Acad Sci USA 91, 2713–2717), the GMO2784 human fibroblast cell line expresses two additional isoforms at 64 and 58 kDa. In both cell lines, annexin A6 is located intracellularly and on the plasma membrane. In vitro eukaryotic protein synthesis of pIRESneoAnxA6 cDNA and pIRESneoAnxA6/ Met1− or Met33− using a reticulocyte lysate coupled transcription/translation system revealed that this gene contains two translation start codons, Met1 and Met33. Immunoprecipitation of the products obtained from the transcription/translation system using various anti-annexin A6 antibodies confirmed the presence of several isoforms and suggested that this protein might be present in different configurations. © 2016 Published by Elsevier Inc.
1. Introduction The annexin A6 (AnxA6) protein is present in all mammalian tissues and is specifically enriched in the liver, muscle, heart and spleen [1–3]. AnxA6 belongs to a family of highly conserved proteins that bind to phospholipid membranes in a Ca2+-dependent manner. This binding is reversible, as the removal of Ca2+ by EGTA leads to the liberation of annexins from the phospholipid matrix [3]. AnxA6 has been shown to associate with the cytosolic face of plasma membrane microdomains rich in sphingolipids and cholesterol near caveolin regions [4,5], as well as with endosomes, as an integral plasma membrane protein or as a membrane associated protein on the outer face of the cell surface and in circulation [6–12]. Cytoplasmic AnxA6 may function as an organizer of membrane domains for the formation of multifactorial signaling complexes that regulate membrane-actin interactions during endocytic transport and modulate intracellular cholesterol homeostasis [5]. AnxA6 found on
Abbreviations: AnxA6, annexin VI; IGF-II/Man6PR, cation-independent Man6P receptors; MEM, minimum essential media. ⁎ Correspondence to: A. González-Noriega, Department of Cell Biology and Physiology, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, Ciudad Universitaria, México D.F. 04510, México. ⁎⁎ Correspondence to: A. León-Del-Río, Department of Molecular Biology, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, Lab B038, Circuito Exterior, Ciudad Universitaria, P.O. Box 70228, México D.F. 04510, México. E-mail addresses: [email protected] (A. González-Noriega), [email protected] (A. León-Del-Río).
the extracellular surface interacts with several extracellular ligands, including LRP-1, fetuin-A, heparin, and chondroitin sulfate [6–10]. In addition, extracellular AnxA6 may regulate critical physiological processes linked to cell spreading, adhesion, proliferation, differentiation, inflammation and cell migration [9–11]. AnxA6, as an integral protein, behaves as an endocytic receptor for IGF-II/Man6PR-independent bovine β-glucuronidase [12]. Although AnxA6 has been described as a 68-kDa protein, purified AnxA6 consistently migrates as a closely spaced doublet when analyzed by SDS-PAGE. The Crumpton group [13,14] reported that the 21st exon of AnxA6-1 is alternatively spliced, giving rise to an isoform (AnxA6-2) that is missing the VAAEI sequence. In a search for calcium-binding proteins (CBPs), JosiC et al. [15] found two membrane-associated proteins with apparent molecular masses of 65/67 kDa. Peptide mapping of the separated CBP 65 and 67 showed that they consist of two very similar polypeptides. Furthermore, the occurrence of a polypeptide with an apparent molecular weight of 60 kDa, which was first detected in serum and later in liver plasma membranes, may be due to the partial proteolytic cleavage of CBP 65/67. Afterwards, cDNA encoding the rat membrane-associated 65/67-kDa calcium-binding protein was isolated and found to correspond to AnxA6 [16]. Previously, we reported that AnxA6 purified from bovine liver was resolved as three bands of 68, 64 and 58 kDa when analyzed by SDS-PAGE. Although the variation in protein size and differences in bovine β-glucuronidase binding ability suggested the existence of 2 additional AnxA6 isoforms, the possibility that these species might represent changes in the conformation of the protein triggered by detergent extraction or proteolytic products
http://dx.doi.org/10.1016/j.ymgme.2016.10.002 1096-7192/© 2016 Published by Elsevier Inc.
Please cite this article as: A. González-Noriega, et al., Two translation initiation codons direct the expression of annexin VI 64 kDa and 68 kDa isoforms, Mol. Genet. Metab. (2016), http://dx.doi.org/10.1016/j.ymgme.2016.10.002
2
A. González-Noriega et al. / Molecular Genetics and Metabolism xxx (2016) xxx–xxx
generated during protein purification could not be excluded [12]. In this current study, we present evidence implying the existence of alternative translation initiation codons at Met1 and Met33 that could explain the presence of these different AnxA6 isoforms. 2. Material and methods 2.1. Reagents and antibodies The majority of reagents were obtained from Sigma Chemical Co. (St Louis, MO, USA). Fetal calf serum was purchased from GIBCO (Grand Island Biological Co., Grand Island, NY, USA). The anti-human AnxA6 mouse monoclonal antibody (Clone 73) was purchased from BD Transduction Laboratories (San Diego, CA, USA). The rabbit antisera N19 and K14 directed against epitopes at the N- and C-terminus of Annexin VI, respectively, as well as mouse monoclonal Anti LIMPII, were obtained from Santa Cruz Biotech, Inc. (Santa Cruz, CA, USA). Rabbit antisera Rb646 against the IGF-II/Man6PR-independent receptor (AnxA6) was generated in our laboratory [13–15]. 2.2. Cell culture The human β-glucuronidase-deficient fibroblast cell line (GMO2784) and HeLa cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). Cells were maintained as monolayers in α-MEM (GIBCO) supplemented with 10% heatinactivated fetal calf serum, 1 mM sodium pyruvate, 5 mM glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin sulfate. 2.3. Western blot analysis Samples were incubated with SDS-PAGE loading buffer for 2 h at 25 °C. Equal amounts of protein (70 μg/well) were loaded in each lane. Proteins were resolved by 8% SDS-PAGE and transferred to nitrocellulose (Bio-Rad, Hercules, CA, USA) as previously described [12]. For receptor identification, the membranes were blocked, incubated with N19, K14, Clone 73 or Rb646, incubated with secondary antibodies coupled to horseradish peroxidase (Zymed Laboratories, Inc., South San Francisco, CA, USA) and finally developed with 4-chloro-1-naphthol. Proteins were stained with Coomassie PhastGel™ Blue (Pharmacia LKB Biotechnology AB, Upsala, Sweden). 2.4. Construction and preparation of AnxA6 cDNA Full-length human AnxA6 was prepared as previously described by Takagi et al. [7]. The cDNA was obtained by RT-PCR using sequence data [16]. Total cellular RNA was isolated from HepG2 cells using TRIzol (Invitrogen, Löhne, Germany). First-strand cDNA was prepared using the SuperScript II Reverse Transcriptase Kit (Invitrogen, Carlsbad CA, USA). A human AnxA6 PCR fragment was amplified using Platinum Taq DNA polymerase (Invitrogen), and the following primers were utilized: forward A6F 5′GGCGCTAGCTGCGTCCGTCTGCGACCCGAG 3′ (containing a Nhe1 restriction site to facilitate subcloning, underlined); reverse A6R 5′ CATGCGGCCGCGCGTTTCCTAAGCTCCACTGAAG 3′ (containing a Not1 site, underlined). The full-length cDNA was directionally inserted into the Nhe1 and Not1 sites of pIRESneo3 (Clontech Lab Inc., CA, USA). This plasmid permits the AnxA6 gene and the selection marker to be translated from a single mRNA.
Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA). The primer sequences for Methionine 1 were Fw 5′-TGC GAA CCG GAG ACC GCG GCC AAA CCA GCA CAG-3′ and Rev 5′-CTG TGC TGG TTT GGC CGC GGT CTC CGG TTC GCA-3′. The primer sequences for Methionine 33 were Fw 5′-CTG TAC ACT GCC GCG AAG GGC TTT GGC-3′ and Rev 5′-GAC ATG TGA CGG CGC TTC CCG AAA CCG-3′. To confirm the change of Met to Ala in both sequences, DNA sequencing was performed at Laragen, Inc. (LA, USA). 2.6. Cell-free protein synthesis pIRESneo3Anx6 constructs (1 μg) were incubated with 25 μl of TNT® Rabbit reticulocyte lysate (Promega Corporation, Madison, WI, USA), TNT RNA polymerase T3, amino acid mixture and 20 μC of S35-methionine, as indicated in the Promega technical bulletin. After incubation at 30 °C for 90 min, aliquots were boiled in SDS gel loading buffer, and proteins were resolved by 8% SDS-PAGE. For immunoprecipitation, 25μl aliquots from the transcription/translation system were diluted with 0.5 ml of PBS and adsorbed to 20 μl of protein G Sepharose [13] saturated with 5 μg of N19, K14, Clone 73, Rb646 antibody or rabbit IgG. The beads were washed with PBS buffer and heated in 50 μl of SDSPAGE loading buffer. Immunoadsorbed material was separated by 8% SDS-PAGE and analyzed by fluorography after treatment of gels with 1% salicylate [14]. 2.7. Biotinylation of cell surface AnxA6 Human β-glucuronidase-deficient fibroblast cells (GMO2784) were grown to confluency in 60-mm Petri dishes. All biotinylation procedures were performed at 4 °C. After 3 washes with cold SBM buffer (97.5 mM NaCl, 2.5 mM KCl, 25 mM Na maleate, pH 6.8, 10 mM MnCl2, 10 mM CaCl2, and 10 mM MgCl2), cells were biotinylated with 1 ml of 1 mg/ml membrane-impermeant Sulfo-NHS-SS-Biotin (Thermo Scientific, Rockford, IL, USA) in SBM buffer for 30 min. Unreacted biotin was quenched by washing the cells with cold glycine. In control dishes, surface biotin labeling was removed by incubating the cells for 15 min with GSH buffer (50 mM glutathione in 75 mM NaCl, 10 mM EDTA, 0.1% BSA, and 0.075 N NaOH). After the cells were washed and harvested with SMB buffer, cellular protein was extracted with 0.5 ml of RIPA buffer (10 mM Tris, pH 7.5, 50 mM NaCl, 1% NP40, 0.5% Na Deoxycholate, 0.1% SDS, 5 mM EDTA, 1 mg/ml BSA, and 1 mM PMSF) and centrifuged at 14,000 rpm for 15 min; the supernatants were incubated overnight with 100 μl of streptavidin agarose (Molecular Probes, Eugen, Oregon). Beads were washed with RIPA buffer without SDS, and bound proteins were eluted by boiling for 5 min in SDS loading buffer. Eluted material was identified by immunodetection with N19, K14, Clone 73 or Rb646 antibody [17]. 2.8. Indirect immunofluorescence microscopy Cells grown on cover slips were fixed for 15 min with 2% paraformaldehyde. Antibody incubation was conducted in the presence or absence of 0.1% saponin. First, cells were incubated with Rb646 and anti-LIMPII. Next, the cells were rinsed and incubated with Texas red-labeled antimouse horse IgG (Vector Labs, Burlingame, CA, USA) and FITC-labeled anti-rabbit donkey IgG (Jackson ImmunoResearch Labs, Inc., West Grove, PA, USA). The cover slips were mounted in Mowiol (Calbiochem, San Diego, CA, USA), and the slides were examined using an Olympus BX51 microscope (Tokyo, Japan) equipped for epifluorescence with an UPlanAPO 100× objective [12,15].
2.5. Site-directed mutagenesis by PCR 3. Results To identify the sequence responsible for the different AnxA6 isoforms, we changed the first ATG (Met1) and the ATG at position 33 of the AnxA6 cDNA (Met33) after the transcription start site to GCC (Alanine) using site-directed mutagenesis. We performed the mutagenesis by PCR following the instructions of the Quick-change II Site-Directed
3.1. Presence of AnxA6 isoforms in cell lines Previously, we reported a protocol for AnxA6 purification that includes Triton × 100 extraction from membranes and adsorption to
Please cite this article as: A. González-Noriega, et al., Two translation initiation codons direct the expression of annexin VI 64 kDa and 68 kDa isoforms, Mol. Genet. Metab. (2016), http://dx.doi.org/10.1016/j.ymgme.2016.10.002
A. González-Noriega et al. / Molecular Genetics and Metabolism xxx (2016) xxx–xxx
affinity columns. AnxA6 purified from bovine liver was resolved as three bands of 68, 64 and 58 kDa when analyzed by SDS-PAGE. We initially proposed that the presence of these isoforms might represent changes in protein size triggered by Triton ×100 associated with AnxA6 or proteolytic products generated during protein purification [12]. However, transfection of A431 cells, which do not natively express AnxA6, with the bicistronic vector pIRESneoAnxA6 also resulted in the expression of 68/64/58-kDa AnxA6 isoforms [12]. Together, these results indicate that this annexin might undergo post-translational modification, e.g., limited proteolysis. To confirm these observations, we performed western blotting to investigate whether all of these AnxA6 isoforms are expressed in a human fibroblast cell line and in HeLa cells. Three commercial antibodies were used: N19, K14 and Clone 73, which are directed against epitopes at the N-terminus, near the C-terminus and in the middle region of AnxA6, respectively. In addition, we used polyclonal Rb646, which was raised in the laboratory against full-length AnxA6 purified from bovine liver membranes. The human fibroblast cell line expresses the doublet that indicates alternative splicing along with the 68-, 64- and 58-kDa isoforms (Fig. 1A). In contrast, HeLa cells only express the longer AnxA61 (68 kDa) and the splicing isomer AnxA6-2 (Fig. 1B). The absence of the 64/58-kDa AnxA6 isoforms in HeLa cells allowed us to investigate whether the 68-kDa form is present in the plasma membrane. Cells were paraformaldehyde-fixed and incubated with anti-LIMPII (a lysosomal marker) and an anti-AnxA6 rabbit serum (Rb646) that is able to block the IGF-II/Man6PR-independent endocytosis of bovine β-glucuronidase [12]. Primary and secondary antibodies were incubated in the absence or presence of saponin to visualize AnxA6 only at the plasma membrane or both at the membrane and inside the cell. In the absence of saponin, AnxA6, but not LIMPII, was observed along the surface of HeLa cells and human fibroblasts (Fig. 2). These results indicate that AnxA6 spans the plasma membrane and that, consequently, some of its epitopes were accessible to the antibodies added to the media. When both cultures were incubated in the presence of saponin, LIMPII and AnxA6 were both visualized to associate with different intracellular vesicles (Fig. 2). Similar results were obtained when both cell lines were incubated with commercial anti-AnxA6 antibodies (not shown). The presence of the AnxA6 isoforms in the plasma membrane of human fibroblasts was also confirmed by labeling the proteins present at the cell surface with Sulfo-NHS-SS-Biotin at 4 °C. To identify which of the AnxA6 isoforms spans the plasma membrane, biotinylated proteins were extracted with RIPA and adsorbed onto streptavidin-agarose
Fig. 1. Expression of AnxA6 isoforms in human fibroblasts and HeLa cells. Membrane protein preparations (70 μg) from a human fibroblast cell line (A) and HeLa cells (B) were resolved by 8% SDS-PAGE and transferred to nitrocellulose membranes. AnxA6 was identified using commercial anti-AnxA6 antibodies (N19, K14 and Clone 73) or with antisera obtained in the laboratory against AnxA6 (Rb646).
3
Fig. 2. Immunofluorescence analysis of AnxA6 in human fibroblasts (GMO2784) and HeLa cells. Cells grown on cover slips were fixed for 15 min with 2% paraformaldehyde. Incubation with antibodies was performed in the presence or absence of 0.1% saponin. Cells were first incubated with antibodies against AnxA6 (Rb646) and a mouse monoclonal IgG against a lysosomal marker (LIMP II). The cells were then rinsed and incubated with Texas red-labeled anti-mouse horse IgG and FITC-labeled anti-rabbit donkey IgG. Merged images are shown, wherein green corresponds to AnxA6 and red corresponds to LIMP II. Nuclei were stained with DAPI. Scale bar, 40 μm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
columns, after which the adsorbed material was resolved by SDS-PAGE and the AnxA6 isoforms were identified by immunoblotting. As shown in Fig. 3, the 68- and 64-kDa isoforms were present in the plasma membrane. When biotinylated cells were kept at 4 °C, the biotin was released from AnxA6 after glutathione treatment (Fig. 3). The above results indicate that AnxA6 is located inside the cells and at the plasma membrane as an integral membrane protein [12]. Differences in the bands visualized by western blotting imply that each antibody identifies different epitopes in AnxA6, indicating that either a battery of antibodies or a polyclonal pan-AnxA6 antibody is necessary to detect the different isoforms. Finally, the fact that the 64- and 58kDa isoforms are absent in HeLa cells suggests the existence of alternative translation initiation codons in AnxA6. 3.2. Alternative translation initiation codons for the AnxA6 To determine if the presence of the 64/58-kDa AnxA6 isoforms is indeed due to alternative initiation codons during translation, the pIRESneoAnxA6 plasmid was incubated in the presence of a TNT cellfree transcription/translation mixture and S35-methionine. As shown in Fig. 4A, two labeled proteins of 68 and 64 kDa in size were detected. However, when the translation products were immunoprecipitated with the aforementioned AnxA6 antibodies, a different banding pattern
Fig. 3. Presence of AnxA6 isoforms in the plasma membrane. Human fibroblasts (GMO2784) were biotinylated with Sulfo-NHS-S-S-Biotin. After 1 h at 4 °C, surface biotin labeling was removed with glutathione (b). Cells were harvested with RIPA buffer. Biotinylated proteins were adsorbed to 100 μl of streptavidin agarose, and after washing, adsorbed proteins were eluted by boiling the beads in SDS loading buffer. Biotinylated proteins were analyzed by immunoblotting with N19 (top) or Rb646 (bottom).
Please cite this article as: A. González-Noriega, et al., Two translation initiation codons direct the expression of annexin VI 64 kDa and 68 kDa isoforms, Mol. Genet. Metab. (2016), http://dx.doi.org/10.1016/j.ymgme.2016.10.002
4
A. González-Noriega et al. / Molecular Genetics and Metabolism xxx (2016) xxx–xxx
was visualized. The AnxA6 68/64 isoforms may be present in greater amounts, with the remaining isoforms only becoming apparent when enriched by immunoprecipitation. Different precipitation patterns of AnxA6 products were revealed when the translation mixture was immunoprecipitated with each of the different AnxA6 antibodies mentioned above. In addition, a differential enrichment pattern was visualized depending on which anti-AnxA6 antibody was used for immunoprecipitation (Fig. 4B). To confirm the existence of alternative translation initiation codons that could explain the presence of these different isoforms, the Met1 or Met33 codons in the AnxA6 cDNA sequence were each substituted with an Ala codon. pIRESneoAnxA6/Met1− or Met33− was then incubated in the presence of the TNT cell-free translation mixture. As shown in Fig. 5, the 68-kDa isoform was synthesized when Met33 was missing, and the 64/58 kDa was present when Met1 was absent. These results, combined with the fact that the amino and carboxyl termini of the 64/ 58-kDa isoforms are the same [12], suggest that the difference between these two isoforms is due to conformational changes. 4. Discussion AnxA6-1 is widely accepted to be a 68-kDa protein that may undergo alternative splicing to give rise to an isoform (AnxA6-2) that lacks the VAAEI sequence [18,19]. The JosiC DJ group has reported that all rat tissues express two AnxA6 isoforms of 65/67 kDa [20,21]. In this present study, we corroborate the existence of two additional isoforms of 64/
Fig. 5. Existence of alternative translation initiation codons in the AnxA6 cDNA. Met1 or Met33 of the AnxA6 cDNA were substituted with Ala. A) Sequence and alignment of the two different pIRESneoAnxA6 constructs generated by site-directed mutagenesis showing the sequence related to the mutation of Met1 or Met33. B) pIRESneoAnxA6/ Met1− or Met33− was incubated with the TNT cell-free translation mixture in the presence of S35-methionine. After protein synthesis, aliquots were analyzed by SDSPAGE followed by fluorography of the dried gel slab.
Fig. 4. In vitro protein synthesis of human AnxA6. A) pIRESneo3 (a) or pIRESneoAnxA6 (b) were incubated in the presence of a TNT reticulocyte lysate-coupled transcription/ translation system mixture and S35-methionine. After protein synthesis, aliquots were analyzed by SDS-PAGE. (B) In vitro-synthesized polypeptides from pIRESneoAnxA6 were immunoprecipitated with commercial anti-AnxA6 antibodies (N19, K14 and Clone 73) or with antisera obtained in the laboratory against AnxA6 (Rb646). The immunoprecipitates were analyzed by SDS-PAGE followed by fluorography of the dried gel slab.
58 kDa in addition to the presence of AnxA6-1/AnxA6-2 [12]. The expression of AnxA6 cDNA in a reticulocyte lysate-coupled transcription/ translation system allowed us to determine that this gene contains two translation start codons (Met1 and Met33), which would explain the presence of the 68/64-kDa isoforms. Initially, the presence of molecular isoforms that were smaller than 68 kDa was thought to be due to a partial proteolytic cleavage for the following reasons: a) peptide mapping of the isoforms showed that they consist of very similar polypeptides [12,20,21]; b) the amino terminal residues of the 68/64/58-kDa peptides were blocked, with N-termini of the internal sequences initiating at residue 16 for the 68-kDa band and at residue 41 for the 64/58-kDa bands of AnxA6 [12]; and c) antibodies against the AnxA6 amino terminus (N19) only recognize the 68-kDa isoform. These observations, as well as the fact that the molecular weights of the in vitro translation products and the molecular weights of the native proteins from cultured cells were the same by SDS-PAGE, imply that the modifications to AnxA6 occur before translation. Consistent with these results, the presence of the 68- or 64/58-kDa AnxA6 expression products in a reticulocyte lysate-coupled transcription/translation system of pIRESneoAnxA6 when Met33 or Met1, respectively, were missing confirmed the presence of two translation start codons (Met1 and Met33). On the other hand, considering that in these studies, the 64/58-kDa AnxA6 isoforms were synthesized only when Met1 was missing and given that both isoforms have the same aminoand carboxyl-terminal amino acids [12]. We propose that the apparent differences in the molecular size might be due to folding differences resulting from the binding of phospholipids monolayers forming micelle-like clusters around the hydrophobic domains of a fraction of AnxA6. If so, the 58 kDa peptide may present a structurally more-compact form that partially resists SDS-induced unfolding, with a consequent reduction in apparent size by SDS-PAGE [13,22].
Please cite this article as: A. González-Noriega, et al., Two translation initiation codons direct the expression of annexin VI 64 kDa and 68 kDa isoforms, Mol. Genet. Metab. (2016), http://dx.doi.org/10.1016/j.ymgme.2016.10.002
A. González-Noriega et al. / Molecular Genetics and Metabolism xxx (2016) xxx–xxx
Conformational changes in AnxB12 the protein has been reported by the Langen group [23], who found that after protonation, the destabilization of the native α-helical structure and the refolding and formation of AnxB12 multimers creates a transmembrane-spanning configuration. Similarly, pH changes may trigger the conversion of α-helices to β-sheet structures and the insertion of AnxA6 into lipid bilayers. [24–26]. Discrete structural differences between the different AnxA6 isoforms, combined with the diverse conformational configurations that they may acquire within cells, may explain the presence of different epitopes in each of the different isoforms. As such, visualizing the presence of these different isoforms and their differential enrichment patterns requires a battery of antibodies that recognize different the epitopes that might be present in AnxA6. The visualization of differential enrichment patterns depending on the antibody used to immunoprecipitate AnxA6 reveals the different conformational isoforms present at any given time. The hypothesis of one gene–one protein–one function has been replaced by the fact that many proteins have multiple functions. Several such proteins, known as moonlighting proteins, have been reported, whose function can vary as a consequence of changes in cellular localization, cell type, oligomeric state, or the cellular concentration of a ligand, substrate, cofactor or product [27]. This group of proteins excludes other proteins whose multifunctionality and multilocation is the result of multiple initiation sites, of splicing, or the result of posttranslational modifications, changes in their secondary structure or oligomerization. This alternative group of proteins, some of which are annexins, can operate in different locations or utilize different substrates [28–34]. Some attempts have been reported to associate specific AnxA6 isoforms with specific functions. The Creutz group [22] reported that AnxA6 has at least two conformations when bound to a phospholipid monolayer and has hypothesized that AnxA6 may also adopt several conformations in vivo, underlying different functional roles. Similarly, the Bandorowicz-Pikula group [31] proposed “that the discrete structural and functional differences between AnxA6-1 and AnxA6-2 isoforms promoting distinct localization of these isoforms to specific cellular compartments is probably a molecular mechanism of participation of AnxA6 isoforms in Ca2+- and pH-dependent membrane dynamics during vesicular transport”. The absence of the 64/58 kDa isoforms together with the inability of the Hela cells to take up the bovine β-glucuronidase suggested to us that these AnxA6 isoforms could be the responsible for the endocytosis of the lysosomal enzyme mediated by the IGF-II/Man6PR-independent receptors (to be published elsewhere). The presence of multiple initiation sites, splice variants, and post-translational modifications in AnxA6 leads to changes in secondary structure and oligomerization. In addition, the different cellular locations of AnxA6, its interaction with numerous ligands, and its role in multiple cellular functions poses a challenge in connecting each of the possible AnxA6 isoforms (structures) with the specific functions in which this protein is involved. 5. Conclusions An alternative splicing of the AnxA6 gene give rises to two different isoforms, the AnxA6-1 and the AnxA6-2 where is missing the VAAEI sequence [13,14]. In this current study, we present evidence implying the existence of two additional isoforms of 64/58 kDa, the presence of alternative translation initiation codons at Met1 and Met33 that could explain the presence of the 68 and 64 kDa AnxA6 isoforms. Author contributions AGN and ALDR conceived and designed the study. CM, RCR, VGR collected the data and performed the experiments. AGN, ALDR, CM and VGR analyzed the data. AGN and ALDR wrote the manuscript. AGN,
5
CM, RCR, VGR, and ALDR revised the paper. All authors read and accepted the final version of the manuscript submitted for publication. Acknowledgments We thank Alberto Ramírez Mata for providing technical support. This work was supported in part by the funds from the Universidad Nacional Autónoma de México (PAPIIT project IN206211). Vania Gómez-Romero is a recipient of doctoral scholarships from the Consejo Nacional de Ciencia y Tecnología.
References [1] M.A. Kaetzel, G. Pula, B. Campos, P. Uhrin, N. Horseman, J.R. Dedman, Annexin VI isoforms are differentially expressed in mammalian tissues, Biochim. Biophys. Acta 1223 (1994) 368–374. [2] H.C. Edwards, S.E. Moss, Functional and genetic analysis of annexin VI, Mol. Cell. Biochem. 149–150 (1995) 293–299. [3] V. Gerke, S.E. Moss, Annexins: from structure to function, Physiol. Rev. 82 (2002) 331–337. [4] E.B. Babiychuck, A. Drager, Biochemical characterization of detergent-resistant membranes: a systematic approach, Biochem. J. 397 (2006) 407–416. [5] T. Grewal, M. Koese, C. Rentero, C. Enrich, Molecules in focus: annexin A6 - regulator of the GFR/Ras signaling pathway and cholesterol homeostasis, Int. J. Biochem. Cell Biol. 42 (2010) 580–584. [6] R. Ishitsuka, K. Kojima, H. Utsumi, H. Ogawa, I. Matsumoto, Glycosaminoglycan binding properties of annexin IV, V, and VI, J. Biol. Chem. 273 (1998) 9935–9941. [7] H. Takagi, Y. Asano, N. Yamakawa, I. Matsumoto, K. Kimata, Annexin 6 is a putative cell surface receptor for chondroitin sulfate chains, J. Cell Sci. 115 (2002) 3309–3318. [8] M.N. Kundranda, S. Ray, M. Saria, D. Friedman, L.M. Matrisian, P. Lukyanov, J. Ochieng, Annexins expressed on the cell surface serve as receptors for adhesion to immobilized fetuin-A, Biochim. Biophys. Acta 1693 (2004) 111–123. [9] R.J. Tressler, T. Yetman, G.L. Nicolson, Extracellular annexin VI expression is associated with divalent cation-dependent endothelial cell adhesion of metastatic RAW117 large-cell lymphoma cells, Exp. Cell Res. 215 (1994) 395–40027. [10] H.O. van Genderen, H. Kenis, L. Hofstra, J. Narula, C.P. Reutelingsperger, Extracellular annexin A5: functions of phosphatidylserine-binding and two-dimensional crystallization, Biochim. Biophys. Acta 1783 (2008) 953–963. [11] A.M. Sakwe, R. Koumangoye, B. Guillory, J. Ochieng, Annexin A6 contributes to the invasiveness of breast carcinoma cells by influencing the organization and localization of functional focal adhesions, Exp. Cell Res. 317 (2011) 823–837. [12] A. Ramírez-Mata, C. Michalak, G. Mendoza-Hernández, A. León-Del-Río, A. González-Noriega, Annexin VI is a mannose-6-phosphate-independent endocytic receptor for bovine β-glucuronidase, Exp. Cell Res. 317 (2011) 2364–2373. [13] A. González-Noriega, D.D. Ortega Cuellar, C. Michalak, 78 kDa receptor for Man6Pindependent lysosomal enzyme targeting: biosynthetic transport from endoplasmic reticulum to “high-density vesicles”, Exp. Cell Res. 312 (2006) 1065–1078. [14] A. González-Noriega, C. Michalak, Mannose 6-phosphate-independient endocytosis of β-glucuronidase by human fibroblasts: II. Purification of a cation-dependent receptor from bovine liver, Biochim. Biophys. Acta 1538 (2001) 152–161. [15] A. González-Noriega, C. Michalak, J.A. Sosa-Melgarejo, Cation-independent mannose 6-phosphate and 78 kDa receptors for lysosomal enzyme targeting are located in different cell compartments, Biochim. Biophys. Acta 1745 (2005) 7–19. [16] M.R. Crompton, R.J. Owens, N.F. Totty, S.E. Moss, M.D. Waterfield, M.J. Crumpton, Primary structure of the human, membrane-associated Ca2+-binding protein p68 a novel member of a protein family, EMBO J. 7 (1988) 21–27. [17] G.M. Daniels, S.G. Amara, Selective labeling of neurotransmitter transporters at the cell surface, Methods Enzymol. 296 (1998) 307–318. [18] P.D. Smith, A.D. Michael, M.J. Crumpton, S.E. Moss, Structure of the human annexin VI gene, Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 2713–2717. [19] M.M. Domon, M.N. Nasir, S. Pikula, F. Besson, Influence of the 524-VAAEIL-529 sequence of annexins A6 in their interfacial behavior and interaction with lipid monolayers, J. Colloid Interface Sci. 403 (2013) 99–104. [20] D.J. JosiC, R. Gossrau, R. Habermann, Y.P. Lim, W. Reutter, Calcium-binding proteins 33 kDa, 35 kDa, and 65·67 kDa in normal rat and Morris hepatoma tissues a biochemical and immunohistochemical study, Histochemistry 93 (1990) 389–395. [21] H. Fan, D.J. JosiC, Y.P. Lim, W. Reutter, cDNA cloning and tissue-specific regulation of expression of rat calcium-binding protein 65/67 identification as a homologue of annexin VI, Eur. J. Biochem. 230 (1995) 741–751. [22] A.J. Avila-Sakar, R.H. Kretsinger, C.E. Creutz, Membrane-bound 3D structures reveal the intrinsic flexibility of annexin VI, J. Struct. Biol. 130 (2000) 54–62. [23] R. Langen, J.M. Isas, W.L. Hubbel, H.T. Haigler, A transmembrane form of annexin XII detected by site-directed spin labeling, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 14060–14065. [24] R. Bianchi, I. Giambanco, P. Ceccarelli, G. Pula, R. Donato, Membrane-bound annexin V isoforms (CaBP33 and CaBP37) and annexin VI in bovine tissues behave like integral membrane proteins, FEBS Lett. 296 (1992) 158–162. [25] M. Golczak, A. Kirilenko, J. Bandorowicz-Pikula, S. Pikula, Conformational states of annexin VI in solution induced by acidic pH, FEBS Lett. 496 (2001) 49–54.
Please cite this article as: A. González-Noriega, et al., Two translation initiation codons direct the expression of annexin VI 64 kDa and 68 kDa isoforms, Mol. Genet. Metab. (2016), http://dx.doi.org/10.1016/j.ymgme.2016.10.002
6
A. González-Noriega et al. / Molecular Genetics and Metabolism xxx (2016) xxx–xxx
[26] M. Golczak, A. Kicinska, J. Bandorowicz-Pikula, R. Buchet, A. Szewczyk, S. Pikula, Acidic pH-induced folding of annexin VI is a prerequisite for its insertion into lipid bilayers and formation of ion channels by the protein molecules, FASEB J. 15 (2001) 1083–1085. [27] C.J. Jeffery, Moonlighting proteins, Trends Biochem. Sci. 24 (1999) 8–11. [28] A. León-Del-Rio, D. Leclerc, B. Akerman, N. Wakamatsu, R.A. Gravel, Isolation of a cDNA encoding human holocarboxylase synthetase by functional complementation of a biotin auxotroph of Escherichia coli, Proc. Natl. Acad. Sci. U. S. A. 92 (1995) 4626–4630. [29] S. Lecat, P. Verkade, C. Thiele, K. Fiedler, K. Simons, F. Lafont, Different properties of two isoforms of annexin XIII in MDCK cells, J. Cell Sci. 113 (2000) 2607–2618. [30] C. Freye-Minks, H. Robert, R.H. Kretsinger, C.E. Creutz, Structural and dynamic changes in human annexin VI induced by a phosphorylation-mimicking mutation, Biochemistry 42 (2003) 620–630.
[31] A. Strzelecka-Kiliszek, M.E. Buszewska, P. Podszywalow-Bartnicka, S. Pikula, K. Otulak, R. Buchet, J. Bandorowicz-Pikula, Calcium- and pH-dependent localization of annexin A6 isoforms in Balb/3T3 fibroblasts reflecting their potential participation in vesicular transport, J. Cell. Biochem. 104 (2008) 418–434. [32] G. Kim, N.B. Cole, J.C. Lim, H. Zhao, R.L. H, Dual sites of protein initiation control the localization and myristoylation of methionine sulfoxide reductase A, J. Biol. Chem. 285 (2010) 18085–18094. [33] L.M. Bailey, J.C. Wallace, S.W. Polyak, Holocarboxylase synthetase: correlation of protein localization with biological function, Arch. Biochem. Biophys. 496 (2010) 45. [34] M. Luo, K.A. Hajjar, Annexin A2 system in human biology: cell surface and beyond, Semin. Thromb. Hemost. 39 (2013) 338–346.
Please cite this article as: A. González-Noriega, et al., Two translation initiation codons direct the expression of annexin VI 64 kDa and 68 kDa isoforms, Mol. Genet. Metab. (2016), http://dx.doi.org/10.1016/j.ymgme.2016.10.002
Contents lists available at ScienceDirect
Molecular Genetics and Metabolism journal homepage: www.elsevier.com/locate/ymgme
Two translation initiation codons direct the expression of annexin VI 64 kDa and 68 kDa isoforms Alfonso González-Noriega a,⁎, Colette Michalak a, Rafael Cervantes-Roldán b,c, Vania Gómez-Romero b,c, Alfonso León-Del-Río b,c,⁎⁎ a b c
Departamento de Biología Celular, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, México D.F. 04510, México Programa de Investigación de Cáncer de Mama, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, México D.F. 04510, México Departamento de Biología Molecular y Biotecnología, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, México D.F. 04510, México
a r t i c l e
i n f o
Article history: Received 19 August 2016 Received in revised form 7 October 2016 Accepted 8 October 2016 Available online xxxx Keywords: Annexin VI Annexin VI isoforms Cellular localization Cellular expression
a b s t r a c t Annexin A6 is a multicompetent, multifunctional protein involved in several biological processes within and outside of the cell. Whereas HeLa cells express annexin A6 only as a 68/67-kDa doublet, indicating alternative splicing (Smith PD et al. (1994) Proc Natl Acad Sci USA 91, 2713–2717), the GMO2784 human fibroblast cell line expresses two additional isoforms at 64 and 58 kDa. In both cell lines, annexin A6 is located intracellularly and on the plasma membrane. In vitro eukaryotic protein synthesis of pIRESneoAnxA6 cDNA and pIRESneoAnxA6/ Met1− or Met33− using a reticulocyte lysate coupled transcription/translation system revealed that this gene contains two translation start codons, Met1 and Met33. Immunoprecipitation of the products obtained from the transcription/translation system using various anti-annexin A6 antibodies confirmed the presence of several isoforms and suggested that this protein might be present in different configurations. © 2016 Published by Elsevier Inc.
1. Introduction The annexin A6 (AnxA6) protein is present in all mammalian tissues and is specifically enriched in the liver, muscle, heart and spleen [1–3]. AnxA6 belongs to a family of highly conserved proteins that bind to phospholipid membranes in a Ca2+-dependent manner. This binding is reversible, as the removal of Ca2+ by EGTA leads to the liberation of annexins from the phospholipid matrix [3]. AnxA6 has been shown to associate with the cytosolic face of plasma membrane microdomains rich in sphingolipids and cholesterol near caveolin regions [4,5], as well as with endosomes, as an integral plasma membrane protein or as a membrane associated protein on the outer face of the cell surface and in circulation [6–12]. Cytoplasmic AnxA6 may function as an organizer of membrane domains for the formation of multifactorial signaling complexes that regulate membrane-actin interactions during endocytic transport and modulate intracellular cholesterol homeostasis [5]. AnxA6 found on
Abbreviations: AnxA6, annexin VI; IGF-II/Man6PR, cation-independent Man6P receptors; MEM, minimum essential media. ⁎ Correspondence to: A. González-Noriega, Department of Cell Biology and Physiology, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, Ciudad Universitaria, México D.F. 04510, México. ⁎⁎ Correspondence to: A. León-Del-Río, Department of Molecular Biology, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, Lab B038, Circuito Exterior, Ciudad Universitaria, P.O. Box 70228, México D.F. 04510, México. E-mail addresses: [email protected] (A. González-Noriega), [email protected] (A. León-Del-Río).
the extracellular surface interacts with several extracellular ligands, including LRP-1, fetuin-A, heparin, and chondroitin sulfate [6–10]. In addition, extracellular AnxA6 may regulate critical physiological processes linked to cell spreading, adhesion, proliferation, differentiation, inflammation and cell migration [9–11]. AnxA6, as an integral protein, behaves as an endocytic receptor for IGF-II/Man6PR-independent bovine β-glucuronidase [12]. Although AnxA6 has been described as a 68-kDa protein, purified AnxA6 consistently migrates as a closely spaced doublet when analyzed by SDS-PAGE. The Crumpton group [13,14] reported that the 21st exon of AnxA6-1 is alternatively spliced, giving rise to an isoform (AnxA6-2) that is missing the VAAEI sequence. In a search for calcium-binding proteins (CBPs), JosiC et al. [15] found two membrane-associated proteins with apparent molecular masses of 65/67 kDa. Peptide mapping of the separated CBP 65 and 67 showed that they consist of two very similar polypeptides. Furthermore, the occurrence of a polypeptide with an apparent molecular weight of 60 kDa, which was first detected in serum and later in liver plasma membranes, may be due to the partial proteolytic cleavage of CBP 65/67. Afterwards, cDNA encoding the rat membrane-associated 65/67-kDa calcium-binding protein was isolated and found to correspond to AnxA6 [16]. Previously, we reported that AnxA6 purified from bovine liver was resolved as three bands of 68, 64 and 58 kDa when analyzed by SDS-PAGE. Although the variation in protein size and differences in bovine β-glucuronidase binding ability suggested the existence of 2 additional AnxA6 isoforms, the possibility that these species might represent changes in the conformation of the protein triggered by detergent extraction or proteolytic products
http://dx.doi.org/10.1016/j.ymgme.2016.10.002 1096-7192/© 2016 Published by Elsevier Inc.
Please cite this article as: A. González-Noriega, et al., Two translation initiation codons direct the expression of annexin VI 64 kDa and 68 kDa isoforms, Mol. Genet. Metab. (2016), http://dx.doi.org/10.1016/j.ymgme.2016.10.002
2
A. González-Noriega et al. / Molecular Genetics and Metabolism xxx (2016) xxx–xxx
generated during protein purification could not be excluded [12]. In this current study, we present evidence implying the existence of alternative translation initiation codons at Met1 and Met33 that could explain the presence of these different AnxA6 isoforms. 2. Material and methods 2.1. Reagents and antibodies The majority of reagents were obtained from Sigma Chemical Co. (St Louis, MO, USA). Fetal calf serum was purchased from GIBCO (Grand Island Biological Co., Grand Island, NY, USA). The anti-human AnxA6 mouse monoclonal antibody (Clone 73) was purchased from BD Transduction Laboratories (San Diego, CA, USA). The rabbit antisera N19 and K14 directed against epitopes at the N- and C-terminus of Annexin VI, respectively, as well as mouse monoclonal Anti LIMPII, were obtained from Santa Cruz Biotech, Inc. (Santa Cruz, CA, USA). Rabbit antisera Rb646 against the IGF-II/Man6PR-independent receptor (AnxA6) was generated in our laboratory [13–15]. 2.2. Cell culture The human β-glucuronidase-deficient fibroblast cell line (GMO2784) and HeLa cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). Cells were maintained as monolayers in α-MEM (GIBCO) supplemented with 10% heatinactivated fetal calf serum, 1 mM sodium pyruvate, 5 mM glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin sulfate. 2.3. Western blot analysis Samples were incubated with SDS-PAGE loading buffer for 2 h at 25 °C. Equal amounts of protein (70 μg/well) were loaded in each lane. Proteins were resolved by 8% SDS-PAGE and transferred to nitrocellulose (Bio-Rad, Hercules, CA, USA) as previously described [12]. For receptor identification, the membranes were blocked, incubated with N19, K14, Clone 73 or Rb646, incubated with secondary antibodies coupled to horseradish peroxidase (Zymed Laboratories, Inc., South San Francisco, CA, USA) and finally developed with 4-chloro-1-naphthol. Proteins were stained with Coomassie PhastGel™ Blue (Pharmacia LKB Biotechnology AB, Upsala, Sweden). 2.4. Construction and preparation of AnxA6 cDNA Full-length human AnxA6 was prepared as previously described by Takagi et al. [7]. The cDNA was obtained by RT-PCR using sequence data [16]. Total cellular RNA was isolated from HepG2 cells using TRIzol (Invitrogen, Löhne, Germany). First-strand cDNA was prepared using the SuperScript II Reverse Transcriptase Kit (Invitrogen, Carlsbad CA, USA). A human AnxA6 PCR fragment was amplified using Platinum Taq DNA polymerase (Invitrogen), and the following primers were utilized: forward A6F 5′GGCGCTAGCTGCGTCCGTCTGCGACCCGAG 3′ (containing a Nhe1 restriction site to facilitate subcloning, underlined); reverse A6R 5′ CATGCGGCCGCGCGTTTCCTAAGCTCCACTGAAG 3′ (containing a Not1 site, underlined). The full-length cDNA was directionally inserted into the Nhe1 and Not1 sites of pIRESneo3 (Clontech Lab Inc., CA, USA). This plasmid permits the AnxA6 gene and the selection marker to be translated from a single mRNA.
Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA). The primer sequences for Methionine 1 were Fw 5′-TGC GAA CCG GAG ACC GCG GCC AAA CCA GCA CAG-3′ and Rev 5′-CTG TGC TGG TTT GGC CGC GGT CTC CGG TTC GCA-3′. The primer sequences for Methionine 33 were Fw 5′-CTG TAC ACT GCC GCG AAG GGC TTT GGC-3′ and Rev 5′-GAC ATG TGA CGG CGC TTC CCG AAA CCG-3′. To confirm the change of Met to Ala in both sequences, DNA sequencing was performed at Laragen, Inc. (LA, USA). 2.6. Cell-free protein synthesis pIRESneo3Anx6 constructs (1 μg) were incubated with 25 μl of TNT® Rabbit reticulocyte lysate (Promega Corporation, Madison, WI, USA), TNT RNA polymerase T3, amino acid mixture and 20 μC of S35-methionine, as indicated in the Promega technical bulletin. After incubation at 30 °C for 90 min, aliquots were boiled in SDS gel loading buffer, and proteins were resolved by 8% SDS-PAGE. For immunoprecipitation, 25μl aliquots from the transcription/translation system were diluted with 0.5 ml of PBS and adsorbed to 20 μl of protein G Sepharose [13] saturated with 5 μg of N19, K14, Clone 73, Rb646 antibody or rabbit IgG. The beads were washed with PBS buffer and heated in 50 μl of SDSPAGE loading buffer. Immunoadsorbed material was separated by 8% SDS-PAGE and analyzed by fluorography after treatment of gels with 1% salicylate [14]. 2.7. Biotinylation of cell surface AnxA6 Human β-glucuronidase-deficient fibroblast cells (GMO2784) were grown to confluency in 60-mm Petri dishes. All biotinylation procedures were performed at 4 °C. After 3 washes with cold SBM buffer (97.5 mM NaCl, 2.5 mM KCl, 25 mM Na maleate, pH 6.8, 10 mM MnCl2, 10 mM CaCl2, and 10 mM MgCl2), cells were biotinylated with 1 ml of 1 mg/ml membrane-impermeant Sulfo-NHS-SS-Biotin (Thermo Scientific, Rockford, IL, USA) in SBM buffer for 30 min. Unreacted biotin was quenched by washing the cells with cold glycine. In control dishes, surface biotin labeling was removed by incubating the cells for 15 min with GSH buffer (50 mM glutathione in 75 mM NaCl, 10 mM EDTA, 0.1% BSA, and 0.075 N NaOH). After the cells were washed and harvested with SMB buffer, cellular protein was extracted with 0.5 ml of RIPA buffer (10 mM Tris, pH 7.5, 50 mM NaCl, 1% NP40, 0.5% Na Deoxycholate, 0.1% SDS, 5 mM EDTA, 1 mg/ml BSA, and 1 mM PMSF) and centrifuged at 14,000 rpm for 15 min; the supernatants were incubated overnight with 100 μl of streptavidin agarose (Molecular Probes, Eugen, Oregon). Beads were washed with RIPA buffer without SDS, and bound proteins were eluted by boiling for 5 min in SDS loading buffer. Eluted material was identified by immunodetection with N19, K14, Clone 73 or Rb646 antibody [17]. 2.8. Indirect immunofluorescence microscopy Cells grown on cover slips were fixed for 15 min with 2% paraformaldehyde. Antibody incubation was conducted in the presence or absence of 0.1% saponin. First, cells were incubated with Rb646 and anti-LIMPII. Next, the cells were rinsed and incubated with Texas red-labeled antimouse horse IgG (Vector Labs, Burlingame, CA, USA) and FITC-labeled anti-rabbit donkey IgG (Jackson ImmunoResearch Labs, Inc., West Grove, PA, USA). The cover slips were mounted in Mowiol (Calbiochem, San Diego, CA, USA), and the slides were examined using an Olympus BX51 microscope (Tokyo, Japan) equipped for epifluorescence with an UPlanAPO 100× objective [12,15].
2.5. Site-directed mutagenesis by PCR 3. Results To identify the sequence responsible for the different AnxA6 isoforms, we changed the first ATG (Met1) and the ATG at position 33 of the AnxA6 cDNA (Met33) after the transcription start site to GCC (Alanine) using site-directed mutagenesis. We performed the mutagenesis by PCR following the instructions of the Quick-change II Site-Directed
3.1. Presence of AnxA6 isoforms in cell lines Previously, we reported a protocol for AnxA6 purification that includes Triton × 100 extraction from membranes and adsorption to
Please cite this article as: A. González-Noriega, et al., Two translation initiation codons direct the expression of annexin VI 64 kDa and 68 kDa isoforms, Mol. Genet. Metab. (2016), http://dx.doi.org/10.1016/j.ymgme.2016.10.002
A. González-Noriega et al. / Molecular Genetics and Metabolism xxx (2016) xxx–xxx
affinity columns. AnxA6 purified from bovine liver was resolved as three bands of 68, 64 and 58 kDa when analyzed by SDS-PAGE. We initially proposed that the presence of these isoforms might represent changes in protein size triggered by Triton ×100 associated with AnxA6 or proteolytic products generated during protein purification [12]. However, transfection of A431 cells, which do not natively express AnxA6, with the bicistronic vector pIRESneoAnxA6 also resulted in the expression of 68/64/58-kDa AnxA6 isoforms [12]. Together, these results indicate that this annexin might undergo post-translational modification, e.g., limited proteolysis. To confirm these observations, we performed western blotting to investigate whether all of these AnxA6 isoforms are expressed in a human fibroblast cell line and in HeLa cells. Three commercial antibodies were used: N19, K14 and Clone 73, which are directed against epitopes at the N-terminus, near the C-terminus and in the middle region of AnxA6, respectively. In addition, we used polyclonal Rb646, which was raised in the laboratory against full-length AnxA6 purified from bovine liver membranes. The human fibroblast cell line expresses the doublet that indicates alternative splicing along with the 68-, 64- and 58-kDa isoforms (Fig. 1A). In contrast, HeLa cells only express the longer AnxA61 (68 kDa) and the splicing isomer AnxA6-2 (Fig. 1B). The absence of the 64/58-kDa AnxA6 isoforms in HeLa cells allowed us to investigate whether the 68-kDa form is present in the plasma membrane. Cells were paraformaldehyde-fixed and incubated with anti-LIMPII (a lysosomal marker) and an anti-AnxA6 rabbit serum (Rb646) that is able to block the IGF-II/Man6PR-independent endocytosis of bovine β-glucuronidase [12]. Primary and secondary antibodies were incubated in the absence or presence of saponin to visualize AnxA6 only at the plasma membrane or both at the membrane and inside the cell. In the absence of saponin, AnxA6, but not LIMPII, was observed along the surface of HeLa cells and human fibroblasts (Fig. 2). These results indicate that AnxA6 spans the plasma membrane and that, consequently, some of its epitopes were accessible to the antibodies added to the media. When both cultures were incubated in the presence of saponin, LIMPII and AnxA6 were both visualized to associate with different intracellular vesicles (Fig. 2). Similar results were obtained when both cell lines were incubated with commercial anti-AnxA6 antibodies (not shown). The presence of the AnxA6 isoforms in the plasma membrane of human fibroblasts was also confirmed by labeling the proteins present at the cell surface with Sulfo-NHS-SS-Biotin at 4 °C. To identify which of the AnxA6 isoforms spans the plasma membrane, biotinylated proteins were extracted with RIPA and adsorbed onto streptavidin-agarose
Fig. 1. Expression of AnxA6 isoforms in human fibroblasts and HeLa cells. Membrane protein preparations (70 μg) from a human fibroblast cell line (A) and HeLa cells (B) were resolved by 8% SDS-PAGE and transferred to nitrocellulose membranes. AnxA6 was identified using commercial anti-AnxA6 antibodies (N19, K14 and Clone 73) or with antisera obtained in the laboratory against AnxA6 (Rb646).
3
Fig. 2. Immunofluorescence analysis of AnxA6 in human fibroblasts (GMO2784) and HeLa cells. Cells grown on cover slips were fixed for 15 min with 2% paraformaldehyde. Incubation with antibodies was performed in the presence or absence of 0.1% saponin. Cells were first incubated with antibodies against AnxA6 (Rb646) and a mouse monoclonal IgG against a lysosomal marker (LIMP II). The cells were then rinsed and incubated with Texas red-labeled anti-mouse horse IgG and FITC-labeled anti-rabbit donkey IgG. Merged images are shown, wherein green corresponds to AnxA6 and red corresponds to LIMP II. Nuclei were stained with DAPI. Scale bar, 40 μm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
columns, after which the adsorbed material was resolved by SDS-PAGE and the AnxA6 isoforms were identified by immunoblotting. As shown in Fig. 3, the 68- and 64-kDa isoforms were present in the plasma membrane. When biotinylated cells were kept at 4 °C, the biotin was released from AnxA6 after glutathione treatment (Fig. 3). The above results indicate that AnxA6 is located inside the cells and at the plasma membrane as an integral membrane protein [12]. Differences in the bands visualized by western blotting imply that each antibody identifies different epitopes in AnxA6, indicating that either a battery of antibodies or a polyclonal pan-AnxA6 antibody is necessary to detect the different isoforms. Finally, the fact that the 64- and 58kDa isoforms are absent in HeLa cells suggests the existence of alternative translation initiation codons in AnxA6. 3.2. Alternative translation initiation codons for the AnxA6 To determine if the presence of the 64/58-kDa AnxA6 isoforms is indeed due to alternative initiation codons during translation, the pIRESneoAnxA6 plasmid was incubated in the presence of a TNT cellfree transcription/translation mixture and S35-methionine. As shown in Fig. 4A, two labeled proteins of 68 and 64 kDa in size were detected. However, when the translation products were immunoprecipitated with the aforementioned AnxA6 antibodies, a different banding pattern
Fig. 3. Presence of AnxA6 isoforms in the plasma membrane. Human fibroblasts (GMO2784) were biotinylated with Sulfo-NHS-S-S-Biotin. After 1 h at 4 °C, surface biotin labeling was removed with glutathione (b). Cells were harvested with RIPA buffer. Biotinylated proteins were adsorbed to 100 μl of streptavidin agarose, and after washing, adsorbed proteins were eluted by boiling the beads in SDS loading buffer. Biotinylated proteins were analyzed by immunoblotting with N19 (top) or Rb646 (bottom).
Please cite this article as: A. González-Noriega, et al., Two translation initiation codons direct the expression of annexin VI 64 kDa and 68 kDa isoforms, Mol. Genet. Metab. (2016), http://dx.doi.org/10.1016/j.ymgme.2016.10.002
4
A. González-Noriega et al. / Molecular Genetics and Metabolism xxx (2016) xxx–xxx
was visualized. The AnxA6 68/64 isoforms may be present in greater amounts, with the remaining isoforms only becoming apparent when enriched by immunoprecipitation. Different precipitation patterns of AnxA6 products were revealed when the translation mixture was immunoprecipitated with each of the different AnxA6 antibodies mentioned above. In addition, a differential enrichment pattern was visualized depending on which anti-AnxA6 antibody was used for immunoprecipitation (Fig. 4B). To confirm the existence of alternative translation initiation codons that could explain the presence of these different isoforms, the Met1 or Met33 codons in the AnxA6 cDNA sequence were each substituted with an Ala codon. pIRESneoAnxA6/Met1− or Met33− was then incubated in the presence of the TNT cell-free translation mixture. As shown in Fig. 5, the 68-kDa isoform was synthesized when Met33 was missing, and the 64/58 kDa was present when Met1 was absent. These results, combined with the fact that the amino and carboxyl termini of the 64/ 58-kDa isoforms are the same [12], suggest that the difference between these two isoforms is due to conformational changes. 4. Discussion AnxA6-1 is widely accepted to be a 68-kDa protein that may undergo alternative splicing to give rise to an isoform (AnxA6-2) that lacks the VAAEI sequence [18,19]. The JosiC DJ group has reported that all rat tissues express two AnxA6 isoforms of 65/67 kDa [20,21]. In this present study, we corroborate the existence of two additional isoforms of 64/
Fig. 5. Existence of alternative translation initiation codons in the AnxA6 cDNA. Met1 or Met33 of the AnxA6 cDNA were substituted with Ala. A) Sequence and alignment of the two different pIRESneoAnxA6 constructs generated by site-directed mutagenesis showing the sequence related to the mutation of Met1 or Met33. B) pIRESneoAnxA6/ Met1− or Met33− was incubated with the TNT cell-free translation mixture in the presence of S35-methionine. After protein synthesis, aliquots were analyzed by SDSPAGE followed by fluorography of the dried gel slab.
Fig. 4. In vitro protein synthesis of human AnxA6. A) pIRESneo3 (a) or pIRESneoAnxA6 (b) were incubated in the presence of a TNT reticulocyte lysate-coupled transcription/ translation system mixture and S35-methionine. After protein synthesis, aliquots were analyzed by SDS-PAGE. (B) In vitro-synthesized polypeptides from pIRESneoAnxA6 were immunoprecipitated with commercial anti-AnxA6 antibodies (N19, K14 and Clone 73) or with antisera obtained in the laboratory against AnxA6 (Rb646). The immunoprecipitates were analyzed by SDS-PAGE followed by fluorography of the dried gel slab.
58 kDa in addition to the presence of AnxA6-1/AnxA6-2 [12]. The expression of AnxA6 cDNA in a reticulocyte lysate-coupled transcription/ translation system allowed us to determine that this gene contains two translation start codons (Met1 and Met33), which would explain the presence of the 68/64-kDa isoforms. Initially, the presence of molecular isoforms that were smaller than 68 kDa was thought to be due to a partial proteolytic cleavage for the following reasons: a) peptide mapping of the isoforms showed that they consist of very similar polypeptides [12,20,21]; b) the amino terminal residues of the 68/64/58-kDa peptides were blocked, with N-termini of the internal sequences initiating at residue 16 for the 68-kDa band and at residue 41 for the 64/58-kDa bands of AnxA6 [12]; and c) antibodies against the AnxA6 amino terminus (N19) only recognize the 68-kDa isoform. These observations, as well as the fact that the molecular weights of the in vitro translation products and the molecular weights of the native proteins from cultured cells were the same by SDS-PAGE, imply that the modifications to AnxA6 occur before translation. Consistent with these results, the presence of the 68- or 64/58-kDa AnxA6 expression products in a reticulocyte lysate-coupled transcription/translation system of pIRESneoAnxA6 when Met33 or Met1, respectively, were missing confirmed the presence of two translation start codons (Met1 and Met33). On the other hand, considering that in these studies, the 64/58-kDa AnxA6 isoforms were synthesized only when Met1 was missing and given that both isoforms have the same aminoand carboxyl-terminal amino acids [12]. We propose that the apparent differences in the molecular size might be due to folding differences resulting from the binding of phospholipids monolayers forming micelle-like clusters around the hydrophobic domains of a fraction of AnxA6. If so, the 58 kDa peptide may present a structurally more-compact form that partially resists SDS-induced unfolding, with a consequent reduction in apparent size by SDS-PAGE [13,22].
Please cite this article as: A. González-Noriega, et al., Two translation initiation codons direct the expression of annexin VI 64 kDa and 68 kDa isoforms, Mol. Genet. Metab. (2016), http://dx.doi.org/10.1016/j.ymgme.2016.10.002
A. González-Noriega et al. / Molecular Genetics and Metabolism xxx (2016) xxx–xxx
Conformational changes in AnxB12 the protein has been reported by the Langen group [23], who found that after protonation, the destabilization of the native α-helical structure and the refolding and formation of AnxB12 multimers creates a transmembrane-spanning configuration. Similarly, pH changes may trigger the conversion of α-helices to β-sheet structures and the insertion of AnxA6 into lipid bilayers. [24–26]. Discrete structural differences between the different AnxA6 isoforms, combined with the diverse conformational configurations that they may acquire within cells, may explain the presence of different epitopes in each of the different isoforms. As such, visualizing the presence of these different isoforms and their differential enrichment patterns requires a battery of antibodies that recognize different the epitopes that might be present in AnxA6. The visualization of differential enrichment patterns depending on the antibody used to immunoprecipitate AnxA6 reveals the different conformational isoforms present at any given time. The hypothesis of one gene–one protein–one function has been replaced by the fact that many proteins have multiple functions. Several such proteins, known as moonlighting proteins, have been reported, whose function can vary as a consequence of changes in cellular localization, cell type, oligomeric state, or the cellular concentration of a ligand, substrate, cofactor or product [27]. This group of proteins excludes other proteins whose multifunctionality and multilocation is the result of multiple initiation sites, of splicing, or the result of posttranslational modifications, changes in their secondary structure or oligomerization. This alternative group of proteins, some of which are annexins, can operate in different locations or utilize different substrates [28–34]. Some attempts have been reported to associate specific AnxA6 isoforms with specific functions. The Creutz group [22] reported that AnxA6 has at least two conformations when bound to a phospholipid monolayer and has hypothesized that AnxA6 may also adopt several conformations in vivo, underlying different functional roles. Similarly, the Bandorowicz-Pikula group [31] proposed “that the discrete structural and functional differences between AnxA6-1 and AnxA6-2 isoforms promoting distinct localization of these isoforms to specific cellular compartments is probably a molecular mechanism of participation of AnxA6 isoforms in Ca2+- and pH-dependent membrane dynamics during vesicular transport”. The absence of the 64/58 kDa isoforms together with the inability of the Hela cells to take up the bovine β-glucuronidase suggested to us that these AnxA6 isoforms could be the responsible for the endocytosis of the lysosomal enzyme mediated by the IGF-II/Man6PR-independent receptors (to be published elsewhere). The presence of multiple initiation sites, splice variants, and post-translational modifications in AnxA6 leads to changes in secondary structure and oligomerization. In addition, the different cellular locations of AnxA6, its interaction with numerous ligands, and its role in multiple cellular functions poses a challenge in connecting each of the possible AnxA6 isoforms (structures) with the specific functions in which this protein is involved. 5. Conclusions An alternative splicing of the AnxA6 gene give rises to two different isoforms, the AnxA6-1 and the AnxA6-2 where is missing the VAAEI sequence [13,14]. In this current study, we present evidence implying the existence of two additional isoforms of 64/58 kDa, the presence of alternative translation initiation codons at Met1 and Met33 that could explain the presence of the 68 and 64 kDa AnxA6 isoforms. Author contributions AGN and ALDR conceived and designed the study. CM, RCR, VGR collected the data and performed the experiments. AGN, ALDR, CM and VGR analyzed the data. AGN and ALDR wrote the manuscript. AGN,
5
CM, RCR, VGR, and ALDR revised the paper. All authors read and accepted the final version of the manuscript submitted for publication. Acknowledgments We thank Alberto Ramírez Mata for providing technical support. This work was supported in part by the funds from the Universidad Nacional Autónoma de México (PAPIIT project IN206211). Vania Gómez-Romero is a recipient of doctoral scholarships from the Consejo Nacional de Ciencia y Tecnología.
References [1] M.A. Kaetzel, G. Pula, B. Campos, P. Uhrin, N. Horseman, J.R. Dedman, Annexin VI isoforms are differentially expressed in mammalian tissues, Biochim. Biophys. Acta 1223 (1994) 368–374. [2] H.C. Edwards, S.E. Moss, Functional and genetic analysis of annexin VI, Mol. Cell. Biochem. 149–150 (1995) 293–299. [3] V. Gerke, S.E. Moss, Annexins: from structure to function, Physiol. Rev. 82 (2002) 331–337. [4] E.B. Babiychuck, A. Drager, Biochemical characterization of detergent-resistant membranes: a systematic approach, Biochem. J. 397 (2006) 407–416. [5] T. Grewal, M. Koese, C. Rentero, C. Enrich, Molecules in focus: annexin A6 - regulator of the GFR/Ras signaling pathway and cholesterol homeostasis, Int. J. Biochem. Cell Biol. 42 (2010) 580–584. [6] R. Ishitsuka, K. Kojima, H. Utsumi, H. Ogawa, I. Matsumoto, Glycosaminoglycan binding properties of annexin IV, V, and VI, J. Biol. Chem. 273 (1998) 9935–9941. [7] H. Takagi, Y. Asano, N. Yamakawa, I. Matsumoto, K. Kimata, Annexin 6 is a putative cell surface receptor for chondroitin sulfate chains, J. Cell Sci. 115 (2002) 3309–3318. [8] M.N. Kundranda, S. Ray, M. Saria, D. Friedman, L.M. Matrisian, P. Lukyanov, J. Ochieng, Annexins expressed on the cell surface serve as receptors for adhesion to immobilized fetuin-A, Biochim. Biophys. Acta 1693 (2004) 111–123. [9] R.J. Tressler, T. Yetman, G.L. Nicolson, Extracellular annexin VI expression is associated with divalent cation-dependent endothelial cell adhesion of metastatic RAW117 large-cell lymphoma cells, Exp. Cell Res. 215 (1994) 395–40027. [10] H.O. van Genderen, H. Kenis, L. Hofstra, J. Narula, C.P. Reutelingsperger, Extracellular annexin A5: functions of phosphatidylserine-binding and two-dimensional crystallization, Biochim. Biophys. Acta 1783 (2008) 953–963. [11] A.M. Sakwe, R. Koumangoye, B. Guillory, J. Ochieng, Annexin A6 contributes to the invasiveness of breast carcinoma cells by influencing the organization and localization of functional focal adhesions, Exp. Cell Res. 317 (2011) 823–837. [12] A. Ramírez-Mata, C. Michalak, G. Mendoza-Hernández, A. León-Del-Río, A. González-Noriega, Annexin VI is a mannose-6-phosphate-independent endocytic receptor for bovine β-glucuronidase, Exp. Cell Res. 317 (2011) 2364–2373. [13] A. González-Noriega, D.D. Ortega Cuellar, C. Michalak, 78 kDa receptor for Man6Pindependent lysosomal enzyme targeting: biosynthetic transport from endoplasmic reticulum to “high-density vesicles”, Exp. Cell Res. 312 (2006) 1065–1078. [14] A. González-Noriega, C. Michalak, Mannose 6-phosphate-independient endocytosis of β-glucuronidase by human fibroblasts: II. Purification of a cation-dependent receptor from bovine liver, Biochim. Biophys. Acta 1538 (2001) 152–161. [15] A. González-Noriega, C. Michalak, J.A. Sosa-Melgarejo, Cation-independent mannose 6-phosphate and 78 kDa receptors for lysosomal enzyme targeting are located in different cell compartments, Biochim. Biophys. Acta 1745 (2005) 7–19. [16] M.R. Crompton, R.J. Owens, N.F. Totty, S.E. Moss, M.D. Waterfield, M.J. Crumpton, Primary structure of the human, membrane-associated Ca2+-binding protein p68 a novel member of a protein family, EMBO J. 7 (1988) 21–27. [17] G.M. Daniels, S.G. Amara, Selective labeling of neurotransmitter transporters at the cell surface, Methods Enzymol. 296 (1998) 307–318. [18] P.D. Smith, A.D. Michael, M.J. Crumpton, S.E. Moss, Structure of the human annexin VI gene, Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 2713–2717. [19] M.M. Domon, M.N. Nasir, S. Pikula, F. Besson, Influence of the 524-VAAEIL-529 sequence of annexins A6 in their interfacial behavior and interaction with lipid monolayers, J. Colloid Interface Sci. 403 (2013) 99–104. [20] D.J. JosiC, R. Gossrau, R. Habermann, Y.P. Lim, W. Reutter, Calcium-binding proteins 33 kDa, 35 kDa, and 65·67 kDa in normal rat and Morris hepatoma tissues a biochemical and immunohistochemical study, Histochemistry 93 (1990) 389–395. [21] H. Fan, D.J. JosiC, Y.P. Lim, W. Reutter, cDNA cloning and tissue-specific regulation of expression of rat calcium-binding protein 65/67 identification as a homologue of annexin VI, Eur. J. Biochem. 230 (1995) 741–751. [22] A.J. Avila-Sakar, R.H. Kretsinger, C.E. Creutz, Membrane-bound 3D structures reveal the intrinsic flexibility of annexin VI, J. Struct. Biol. 130 (2000) 54–62. [23] R. Langen, J.M. Isas, W.L. Hubbel, H.T. Haigler, A transmembrane form of annexin XII detected by site-directed spin labeling, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 14060–14065. [24] R. Bianchi, I. Giambanco, P. Ceccarelli, G. Pula, R. Donato, Membrane-bound annexin V isoforms (CaBP33 and CaBP37) and annexin VI in bovine tissues behave like integral membrane proteins, FEBS Lett. 296 (1992) 158–162. [25] M. Golczak, A. Kirilenko, J. Bandorowicz-Pikula, S. Pikula, Conformational states of annexin VI in solution induced by acidic pH, FEBS Lett. 496 (2001) 49–54.
Please cite this article as: A. González-Noriega, et al., Two translation initiation codons direct the expression of annexin VI 64 kDa and 68 kDa isoforms, Mol. Genet. Metab. (2016), http://dx.doi.org/10.1016/j.ymgme.2016.10.002
6
A. González-Noriega et al. / Molecular Genetics and Metabolism xxx (2016) xxx–xxx
[26] M. Golczak, A. Kicinska, J. Bandorowicz-Pikula, R. Buchet, A. Szewczyk, S. Pikula, Acidic pH-induced folding of annexin VI is a prerequisite for its insertion into lipid bilayers and formation of ion channels by the protein molecules, FASEB J. 15 (2001) 1083–1085. [27] C.J. Jeffery, Moonlighting proteins, Trends Biochem. Sci. 24 (1999) 8–11. [28] A. León-Del-Rio, D. Leclerc, B. Akerman, N. Wakamatsu, R.A. Gravel, Isolation of a cDNA encoding human holocarboxylase synthetase by functional complementation of a biotin auxotroph of Escherichia coli, Proc. Natl. Acad. Sci. U. S. A. 92 (1995) 4626–4630. [29] S. Lecat, P. Verkade, C. Thiele, K. Fiedler, K. Simons, F. Lafont, Different properties of two isoforms of annexin XIII in MDCK cells, J. Cell Sci. 113 (2000) 2607–2618. [30] C. Freye-Minks, H. Robert, R.H. Kretsinger, C.E. Creutz, Structural and dynamic changes in human annexin VI induced by a phosphorylation-mimicking mutation, Biochemistry 42 (2003) 620–630.
[31] A. Strzelecka-Kiliszek, M.E. Buszewska, P. Podszywalow-Bartnicka, S. Pikula, K. Otulak, R. Buchet, J. Bandorowicz-Pikula, Calcium- and pH-dependent localization of annexin A6 isoforms in Balb/3T3 fibroblasts reflecting their potential participation in vesicular transport, J. Cell. Biochem. 104 (2008) 418–434. [32] G. Kim, N.B. Cole, J.C. Lim, H. Zhao, R.L. H, Dual sites of protein initiation control the localization and myristoylation of methionine sulfoxide reductase A, J. Biol. Chem. 285 (2010) 18085–18094. [33] L.M. Bailey, J.C. Wallace, S.W. Polyak, Holocarboxylase synthetase: correlation of protein localization with biological function, Arch. Biochem. Biophys. 496 (2010) 45. [34] M. Luo, K.A. Hajjar, Annexin A2 system in human biology: cell surface and beyond, Semin. Thromb. Hemost. 39 (2013) 338–346.
Please cite this article as: A. González-Noriega, et al., Two translation initiation codons direct the expression of annexin VI 64 kDa and 68 kDa isoforms, Mol. Genet. Metab. (2016), http://dx.doi.org/10.1016/j.ymgme.2016.10.002