Type IV phosphodiesterase inhibition in experimental allergic encephalomyelitis of Lewis rats: Sequential gene expression analysis of cytokines, adhesion molecules and the inducible nitric oxide synthase

Journal of the Neurological Sciences 164 (1999) 13–23

Type IV phosphodiesterase inhibition in experimental allergic encephalomyelitis of Lewis rats: Sequential gene expression analysis of cytokines, adhesion molecules and the inducible nitric oxide synthase a, * ´ a , Carmen Puerta a , Clara Redondo b , Antonio Garcıa-Merino ´ Isabel Martınez a

´ ´ Puerta de Hierro, Universidad Autonoma de Madrid, Madrid, Spain Neuroimmunology Laboratory, Department of Neurology, Clınica b ´ y Cajal, Universidad de Alcala´ , Madrid, Spain Department of Pathology, Hospital Ramon Received 4 November 1998; received in revised form 12 January 1999; accepted 25 January 1999

Abstract Type IV phosphodiesterase inhibitors are able to suppress EAE. To investigate the effects of this therapy in the central nervous system, we serially analyzed from days 7 to 17 postinoculation the gene expression pattern of tumor necrosis factor (TNF), lymphotoxin, interferon-g, interleukin-1b, the inducible nitric oxide synthase (iNOs), interleukin-10, the vascular cell adhesion molecule-1 (VCAM-1) and the intercellular adhesion molecule-1 (ICAM-1) in the spinal cord of Lewis rats with actively induced EAE, treated with Rolipram. Treated rats had a delayed and milder disease, and reduced numbers of infiltrates in the nervous tissue. The gene expression profile was similar to that of untreated rats, although delayed, with no evidence of IL-10 upregulation during the observation period. The delayed inflammation was not associated with changes in the expression of VCAM-1 and ICAM-1. In peripheral blood mononuclear cells, TNF mRNA levels were decreased and interleukin-10 was unchanged. This therapy did not alter the proliferative ability of T lymphocytes against myelin basic protein. The encephalitogenic potential of splenocytes from treated animals was also unaffected. The high levels of both iNOs mRNA and nitric oxide (NO) found before the appearance of clinical signs, suggests that NO generation might be a contributing factor to the therapeutic benefit achieved by Rolipram in the rat.  1999 Elsevier Science B.V. All rights reserved. Keywords: Experimental allergic encephalomyelitis; Phosphodiesterase IV; Cytokines; Nitric oxide; Adhesion molecules; Central nervous system

1. Introduction Experimental allergic encephalomyelitis (EAE) is a neuroinflammatory disease induced in genetically susceptible animals by active immunization against myelin antigens of the central nervous system (CNS) or by adoptive transfer of activated CD4 1 Th1 cells, specific for these antigens [1,2]. It is employed as a model of the human demyelinating disease, multiple sclerosis (MS). During the course of EAE, lymphocytes and macrophages enter the CNS and elicit demyelination [3,4]. The ongoing

*Corresponding author. Tel.: 134-91-3162-341; fax: 134-91-3737667. ´ E-mail address: [email protected] (A. Garcıa-Merino)

inflammation is manifested by clinical signs like paresis and paralysis of the limbs. In EAE, proinflammatory cytokines such as IFN-g, LT, TNF and IL-1b are closely related to disease activity, and immunomodulating cytokines like IL-4, IL-10 and TGF-b seem to have a role in disease limitation [5]. Th2 cells are potent inhibitors of encephalitogenic Th1 cells as measured by cell proliferation and IFN-g production [6]. High mRNA levels of the inducible nitric oxide synthase (iNOs), the isoform of the enzyme responsible for the excess production of NO in acute and chronic states of inflammation, have been found in the CNS of rats [7] and mice [8] with EAE. In humans, iNOs mRNA is increased in astrocytes of MS lesions [9]. Inflammatory mediators such as IL-1b, TNF and especially IFN-g are thought to be necessary for iNOs expression in cells responsible for NO

0022-510X / 99 / $ – see front matter  1999 Elsevier Science B.V. All rights reserved. PII: S0022-510X( 99 )00050-7

14

´ et al. / Journal of the Neurological Sciences 164 (1999) 13 – 23 I. Martınez

production in EAE [10,11]. In addition, encephalitogenic cells are capable of inducing the expression of iNOs in a murine macrophage line [12] and in murine astrocytes [13]. Several studies on the role of NO in EAE using inhibitors of the inducible synthase have reported conflicting results, including exacerbation of disease [14,15], no effect [14] or protection from disease [16]. In recent years, the possible use of phosphodiesterase (PDE) inhibitors as antiinflammatory drugs has gained increasing interest. This family of compounds induces a rise in intracellular cyclic AMP (cAMP) that is of potential significance in the balance between the Th1 and Th2 subsets. Treatments that increase intracellular cAMP generally deliver an ‘off’ signal for immune cells, selectively blocking IL-2 mRNA transcription [17], and inhibiting lymphocyte proliferation and immune effector function [18]. In addition, drugs that increase cAMP may control adhesion, secretion and recycling of cytotoxic T lymphocytes [19]. Rolipram (64,39-cyclopentyloxy-49methoxyphenyl-2pyrrolidone), is a selective inhibitor of PDE-IV [20], an isoform expressed in low concentrations in the CNS [21]; PDE-IV is considered a major PDE isoenzyme responsible for catabolism of cAMP and regulation of the inflammatory function in many cells, including monocytes and lymphocytes [22,23]. Recently, it has been reported that Rolipram may prevent, delay and reduce the clinical severity of EAE in rats [24]; in non-human primates it protects against EAE [25]. Recent experiments demonstrated a limited inhibitory effect of Rolipram on clinical signs of MBP-induced EAE when applied before but not after the onset of the disease [26]. The precise molecular mechanisms of this drug remain elusive, but its therapeutic effect has been related to inhibition of proinflammatory cytokines, TNF in particular [24,25]. To investigate the effects of Rolipram in the CNS, Lewis rats with actively induced EAE were treated with this compound and a serial histology and gene expression study in the spinal cord was performed throughout the course of the disease. We found that the suppressive effect observed in treated rats was related to a delayed entry of inflammatory cells in the nervous tissue; however cells in the CNS had the same cytokine mRNA profile as the untreated group. In the periphery, we observed a profound decrease in TNF mRNA expression by peripheral blood mononuclear cells (PBMCs), independent of IL-10. The possible contribution of iNOs mRNA expression and NO production to the therapeutic effect was investigated.

weighing 200–300 g were immunized by subcutaneous injection into the hind footpads with 100 ml of an inoculum containing 25 mg of guinea pig spinal cord, 500 mg of M. tuberculosis (strain H37 Ra, Difco, Detroit, MI), 50 ml of saline buffer and 50 ml of incomplete Freunds´ adjuvant (Difco). Non-immunized rats were inoculated with M. tuberculosis and adjuvant in the same way. EAE rats were treated with the racemate of Rolipram, (kindly provided by Dr E. Cedillo from Schering Spain), suspended in physiological saline with the dispersing agent Tween 80 (Sigma Chemical Co., St. Louis, MO) 2:25 v / v; a single dose of 5 mg / kg per day was administered subcutaneously. Non-immunized rats and immunized EAE rats were sham-treated with saline / Tween 80. For adoptive transfer-EAE experiments, rats were immunized with 50 mg of guinea pig myelin basic protein (GP-MBP) (Sigma Chemical Co., St. Louis, MO) using the same protocol as for guinea pig spinal cord. All experiments were performed following the Spanish regulations for experimental work with animals.

2. Materials and methods

2.4. Histological studies

2.1. Animals, induction of EAE and treatment protocols

Paraffin-embedded blocks were cut into five-micron thick sections and stained with hematoxylin-eosin and ¨ Kluver-Barrera. The presence of cellular infiltrates in the subarachnoid space and the perivascular space was graded

Lewis rats and guinea pigs were obtained from Charles River (France) or from our own breeding facility. Rats

2.2. Clinical evaluation Rats were examined daily for the presence of neurological signs, using the following scale: 0, no clinical signs; 1, limp tail; 2, hind limb weakness; 3, severe hind limb paralysis; 4, moribundity or death due to EAE. Grades 3 and 4 were often accompanied by urinary and fecal incontinence. Daily weights were recorded for individual rats and weight loss was expressed relative to initial weight.

2.3. Tissue collection Three to five rats from each group (untreated and treated with Rolipram) were sacrificed on alternate days, over a period spanning days 7–17 postinoculation (PI). Anesthetized rats were perfused with sterile saline buffer via cardiac puncture before removal of their spinal cords. One part of the lumbar cord was immediately frozen in liquid nitrogen, stored at 2808C and used for RNA extraction. The rest of the cord was fixed in 10% formaldehyde and stored for histological examination. Non-immunized rats, inoculated with M. tuberculosis and adjuvant, were killed on days 9 and 15 PI. Blood was drawn by cardiac puncture on day 13 PI. Plasma was obtained after centrifugation. Peripheral blood mononuclear cells (PBMCs) were isolated using LymphoprepE (Nycomed Pharma AS., Norway). Viable cells were counted using trypan blue exclusion.

´ et al. / Journal of the Neurological Sciences 164 (1999) 13 – 23 I. Martınez

as follows: 6 occasional; 1 slight; 11 moderate; 111 intense. Perivascular cuffing and the presence of parenchymatous infiltrates were classified as negative (N) or positive (Y).

2.5. Plasma nitrite and nitrite measurement Nitric oxide was quantified by the accumulation of nitrite and nitrate as stable end products, using a microplate assay (Cayman’s Nitrate / Nitrite Assay Kit., Alexis ¨ Corp., Laufelfingen, Switzerland). The nitrate was reduced to nitrite utilizing nitrate reductase, and nitrite was measurement with Griess reagent. The absorbance at 540 nm was determined with a microplate reader. Nitrite / nitrate concentrations were calculated by comparison with the absorbance of standard NaNO 2 .

2.6. RNA and cDNA preparation Total RNA was extracted from frozen segments of the spinal cords and fresh PBMCs using TriPureE(Boehringer Mannheim, Heidelberg, Germany) according to the manufacturers´ instructions and dissolved in diethyl pyrocarbonate-treated distilled water. RNA concentration was calculated spectrophotometrically and the quality of the RNA was determined by the ratio OD 260 / 280 and by the integrity of the 18S and 28S ribosomal bands on electrophoresis of 1mg of RNA on a 1% agarose gel. The dissolved RNA samples were stored at 2808C until further use. One mg RNA was reverse transcribed, using 15 U of AMV reverse transcriptase (Promega Corporation, Madison, WI) and 0.07 U of random hexamer oligonucleotide primer (Pharmacia Biotech, Uppsala, Sweden). Following initial heating for 10 min at 658C and incubation at 428C for 120 min, the enzyme was inactivated for 10 min at 958C.

2.7. Polymerase chain reaction ( PCR) Table 1 shows sense and antisense sequences of all the primers used in this work, as well as basepair size of the fragments amplified. Primers used for TNF, IFN-g and b-actin were obtained from Clontech (Palo Alto, CA). The

15

set of primers for IL-1b, were designed by Minami et al. [27] and synthesized by Laboratorios Syntex, S.L. Barcelona, Spain. The computer program Amplify was used to design the set of primers for IL-10, LT, iNOs, ICAM-1, VCAM-1; primers for these genes were synthesized by Laboratorios Syntex. All primers used span introns. Reactions were performed in a total volume of 25 ml containing 3 ml of template (cDNA content equivalent to 30 ng of total RNA), 0.1 mM each of dNTP (Pharmacia), 2.5 ml 103PCR buffer, 1.75 mM MgCl 2 (both from Promega), 0.4 mM of each primer and 1 U Taq Polymerase (Promega). Cycle conditions were 948C for 45 s, 608C for 45 s, and 728C for 2 min. The optimal number of cycles was determined in preliminary experiments intended to identify a linear range of amplification for each gene, using cDNA obtained from spinal cords of rats with full blown EAE. Cycles used were 22 for VCAM-1, 23 for b-actin and TNF, 26 for IFN-g, 28 for IL-1b and ICAM-1, 30 for LT, and 32 for iNOs and IL-10. Cycles used with PBMCs samples were 25 for TNF and iNOS, 27 for IL-10 and 23 for b-actin. PCR reactions for each gene were performed simultaneously to minimize variability. Negative controls (samples lacking cDNA) were included in each assay to confirm that none of the reagents was contaminated by cDNA or previous PCR products.

2.8. Southern hybridization of RT-PCR amplified products and semiquantitative analysis PCR products were separated by electrophoresis in 1% agarose gel (0.53Tris-borate-EDTA) and the gel was stained with ethidium bromide to confirm the presence of amplified products for subsequent transfer to membrane. DNA was blotted on nylon membranes (Boehringer Mannheim) by capillary action under alkaline conditions [28]. DNA was then fixed on the membrane by UV cross-linking (254 nm) for 3 min. Specific probes were generated by incorporation of digoxigenin-dUTP during 40 cycles of PCR. Briefly, the probes were produced utilizing the specific sets of primers shown in Table 1, in conjunction with a cDNA template derived from spinal cords of rats with full blown EAE. These primers spanned introns in the genomic DNA sequence, and under the PCR conditions

Table 1 Sequence of rat primers (59–39) Primer

Sense sequence

Antisense sequence

Size, bp

IL-1b IFN-g TNF LT b-Actin iNOs IL-10 VCAM-1 ICAM-1

GAAGCTGTGGCAGCTACCTATGTCT ATCTGGAGGAACTGGCAAAAGGACG TACTGAACTTCGGGGTGATCGGTCC TGACACCACTTGGACGTCTCCA TTGTAACCAACTGGGACGATATGG GGAAGTTTCTCTTCAGAGTCAAATCCTACCAAGGTGACCT TGCAGGACTTTAAGGGTTACTTGGGTT CAAGGGTGACCGTCTCATGA ATGAAAGACGAACTATCGAGTGGG

CTCTGCTTGAGAGGTGCTGATGTAC CCTTAGGCTAGATTCTGGTGACAGC CAGTTCCGTCCCTTGAAGAGAACC GTTGTTCAAAGAGAAGCCATGTCG GATCTTGATCTTCATGGTGCTAGG TTACGGCTTCCAGCCTGGCCAGATGTTCCTCTATTTTTGC ATTTGGAGAGAGGTACAAACGAGGTTT TGTGCAGCCACCTGAGATC TAGTCGGAAGATCGAAAGTCCG

520 288 295 278 764 485 445 521 450

16

´ et al. / Journal of the Neurological Sciences 164 (1999) 13 – 23 I. Martınez

described above, produced a specific band when cDNA was used as a template. The initial PCR product was gel-purified using Sephaglas BandPrep Kit (Pharmacia), diluted and employed as the template for a second PCR reaction using digoxigenin-dUTP to label cDNA. For each gene, the dilution of template DNA was determined empirically. The digoxigenin-dUTP PCR was performed in a total volume of 50 ml containing 6 ml of diluted template in presence of 2 U of Taq Polymerase (Promega), 0.4 mM of each specific primer, 0.2 mM of dATP, dCTP, dGTP, 0.13 mM of dTTP (Pharmacia), 0.07 mM of digoxigenindUTP (Boehringer Mannheim), 5 ml 103PCR buffer and 1.75 mM MgCl 2 (both from Promega). An aliquot of the PCR product labeled with digoxigenin-dUTP was run on 1% agarose gel, in parallel with an unlabeled product and stained with ethidium bromide to check the increase in molecular weight due to incorporation of digoxigenindUTP. To estimate the labeling efficiency we used the DIG control Teststrips (Boehringer Mannheim). The probe was stored at 2208C. Hybridization was carried out overnight at 688C in a hybridization oven. The amount of probe solution to be used in the hybridization reaction was determined empirically for each gene to prevent background problems. The washing procedure and the chemiluminescent detection were applied according to a standard protocol (DIG Luminescent Detection Kit, Boehringer Mannheim). The luminescent signal was recorded on X-ray film, and the autoradiographic image was captured with a high resolution video camera and digitized in TIFF format. Densitometry was carried out with a Macintosh computer using specialized software (AAB, Fullerton, CA). Band intensity was normalized to the b-actin signal to account for any differences in total RNA content for each sample. Values were expressed as relative densitometric units. The units were calculated as a fraction of the maximum sample density for each blot. In order to compare data from treated and untreated animals, all RTPCR products of each gene were measured from the same blot.

2.9. Cell culture and induction of adoptive transfer EAE Spleen cells from rats immunized with GP-MBP/ CFA were obtained on day 11 PI and washed three times in Hanks BSS. Red blood cells were removed from spleen cell suspensions with ACK lysing buffer. For serial transfer experiments, splenocytes from Rolipram treated and controls EAE rats were cultured in Dulbecco’s Modified Eagle medium (DMEM) supplemented with 10% fetal calf serum (Life Technologies, Spain), 100 U / ml penicillin, 100 U / ml streptomycin, 0.02 mM b-mercaptoethanol, 2 mM L-glutamine and 25 mM Hepes. GP-MBP was added at a concentration of 5 mg / ml. Cells (2310 6 cells / ml) were incubated for 72 h at 378C in humidified 5% CO 2 / air. Cells were harvested, washed with Hanks BSS

and transferred to naive recipients via a lateral tail vein. Each recipients received 20310 6 cells.

2.10. Data analysis Mann-Whitney rank sum test and Student’s t-test were applied to compare clinical scores and cytokine expression, respectively. A P-value of ,0.05 was considered significant. Results of cytokine expression were given as the mean6standard error of the mean (SEM) of at least three animals.

3. Results

3.1. Effects of Rolipram upon clinical symptoms of EAE Untreated rats showed classical signs of acute monophasic EAE; the first signs appeared on days 10–11 postinoculation (PI), reaching the maximum clinical score of 360.29 (SEM) on day 14 PI and then gradually recovering (Fig. 1A). Treatment with Rolipram from the day of active induction of EAE delayed the first clinical signs until days 12–13 PI and the disease showed a slower progress compared to control rats. The mean clinical score was significantly lower from days 10 to 15 PI. In the treated group, the maximal score was found on days 16–17 PI and was also significantly less severe. Continued observation of treated rats did not show further progress of the clinical signs beyond day 17 PI; CFA-immunized controls remained healthy throughout the study (data not shown). Compared to untreated animals, the weight loss curve presented statistical differences during the induction phase of the disease, from days 7–10 PI, when the weight of the Rolipram-treated rats was below that of the control group (Fig. 1B). However, the 17 day cumulative average weight loss was higher in untreated rats (57.83 g) when compared to the Rolipram-treated group (37.34 g). Untreated animals began to lose weight on day 10, 4 days earlier than those in the Rolipram group. Due to the uniformity of clinical signs in both groups, animals used for CNS sampling on days 7, 9, 11, 13, 15 and 17 PI had similar clinical scores.

3.2. Pathological findings As shown in Table 2, treated animals displayed delayed and milder signs of inflammation in the CNS than untreated animals. Demyelination was not present in any of the groups.

3.3. Adoptive transfer experiments To analyze possible effects of the therapy on the encephalitogenic potential of lymphocytes, splenocytes from treated and untreated EAE animals were transferred

´ et al. / Journal of the Neurological Sciences 164 (1999) 13 – 23 I. Martınez

17

Fig. 1. Effect of treatment with Rolipram in EAE. 50 Lewis rats were immunized with encephalitogen and divided in two groups. Rolipram was given from day 1 to 17 in a single daily dose of 5 mg / kg body weight s.c. (d). Control EAE rats were similarly injected with diluent (s). Clinical scores (A) and weight (B) were recorded daily. On day 7 PI data points represent the mean of 25 rats; afterwards 3 to 5 animals of each group were sacrificed every other day for histological and CNS gene expression studies. Note the delay in the appearance of the first signs and the lower maximum score induced by Rolipram. Animals treated with this drug also had a significantly lower mean weight from day 7 to day 10 PI, although the weight loss started 4 days later than in the untreated group. P-values ,0.05 were considered significant (*). Bars indicate6SEM.

to naive recipients after GP-MBP stimulation: EAE induction was equally effective in both groups (Fig. 2).

3.4. Effects of Rolipram on plasma nitrite /nitrate levels, iNOs, TNF and IL-10 expression in PBMC from control and EAE animals The levels of nitrite / nitrate (a final oxidation product of NO) were used as an indicator of NO production. In healthy rats, the effect of treatment with 5 mg / kg b.w. / day of Rolipram was a 7-fold increase of those levels with regard to untreated controls. During EAE, the plasma nitrite / nitrate concentration was increased compared to healthy controls; in these EAE rats, therapy with Rolipram

resulted in a significant additional increase of that concentration (Fig. 3). On day 13 PI, the expression of iNOs gene was also upregulated in PBMC from treated EAE rats; this therapy induced a significant decrease of TNF mRNA, but IL-10 expression was unaffected. (Fig. 4). Considering the effects of the cAMP elevation on cytokine gene expression, and the pronounced effect on CNS infiltration among treated animals, we asked whether the mRNA pattern of cytokine, iNOs and adhesion molecules in the target organ of EAE could be affected by therapy. The genes of interest were divided into the following groups: 1 / proinflammatory, myelinotoxic and immunomodulatory genes (TNF, LT, IFN-g, IL-1b, iNOs and IL-10); and 2 / adhesion molecules (ICAM-1 and

Table 2 CNS inflammation and clinical score of rats with EAE, treated with 5 mg / kg body weight of Rolipram from day 0 post-inoculation and without treatment a Day PI

Clinical score

Untreated EAE 7 0, 0, 0 9 0, 0, 0 11 0, 0, 0 13

2, 1, 1

15

3, 4, 3

17

2, 2, 1

a

Subarach. infiltrates

Perivascul. infiltrates

Cuffing

Parenchym infiltrates

Day PI

2(n: 3) 2(n: 3) 2(n: 1) 1(n: 2) 11(n: 1) 111(n: 2) 2(n: 1) 6(n: 2)

2(n: 3) 2(n: 3) 2(n: 2) 1(n: 1) 11(n: 1) 111(n: 2) 2(n: 1) 6(n: 1) 11(n: 1) 6(n: 1) 1(n: 2)

N(n: 3) N(n: 3) N(n: 3)

N(n: 3) N(n: 3) N(n: 3)

Y(n: 3)

N(n: 1) Y(n: 2) Y(n: 3)

13

Y(n: 3)

2(n: 3)

N(n: 2) Y(n: 1) N(n: 2) Y(n: 1)

Clinical score

Subarach. infiltrates

Perivascul. infiltrates

Cuffing

Parenchym infiltrates

EAE treated with Rolipram 7 0, 0, 0 2(n: 3) 9 0, 0, 0 2(n: 3) 11 0, 0, 0 2(n: 3)

2(n: 3) 2(n: 3) 2(n: 3)

N(n: 3) N(n: 3) N(n: 3)

N(n: 3) N(n: 3) N(n: 3)

0, 0, 0

2(n: 3)

2(n: 3)

N(n: 3)

N(n: 3)

15

0, 0, 0, 1

2(n: 4)

2(n: 3) 1(n: 1)

N(n: 3) Y(n: 1)

N(n: 3) Y(n: 1)

17

0, 1, 1, 2, 3

6(n: 3) 1(n: 2)

6(n: 1) 1(n: 1) 11(n: 3)

N(n: 2) Y(n: 3)

N(n: 2) Y(n: 3)

6: occasional; 1: slight; 11: moderate; 111: intense; Y: positive; N: negative. Numbers in parentheses indicate animals with the same pathologic degree. Non-immunized animals showed no inflammation on days 9 and 15 PI.

18

´ et al. / Journal of the Neurological Sciences 164 (1999) 13 – 23 I. Martınez

Fig. 2. Serial transfer experiments with splenocytes obtained on day 11 PI from Rolipram treated (d) and untreated EAE rats (s). Splenocytes (2310 6 cells / ml) were cultured for 72 h at 378C in humidified 5% CO 2 / air with 5 mg / ml of GP-MBP, harvested and washed with Hanks BSS. Twenty million cells were transferred to each naive recipient via a lateral tail vein. Rats were scored for clinical EAE as described under Material and methods. Each figure represents a single animal.

VCAM-1). Fig. 5 shows the results of the first group of genes. In untreated animals, TNF was expressed at detectable levels before the clinical onset of the disease (day 7 PI), and the highest values were found on days 11, 13 and 15 PI, increasing as the disease progressed; these levels decreased when the animals recovered, on day 17 PI. IFN-g and LT gene expression had a similar behavior, peaking on day 13 PI and then decreasing simultaneously with the recovery phase. iNOs mRNA was undetectable on days 7 and 9 PI, but from day 11 PI onwards, with the first signs of EAE, there was a rapid increase, which declined coinciding with the clinical recovery (day 17 PI). Densitometric analysis of IL-1b mRNA revealed low levels of

Fig. 3. Plasma nitrite / nitrate levels of Lewis rats. (a) Sham-treated non-inoculated animals; n: 4. (b) Non-inoculated animals treated with Rolipram 5 mg / kg given in a single daily dose for 13 days; n: 4. (c) Sham-treated EAE rats on day 13 PI; n: 10. (d) EAE rats treated with Rolipram 5 mg / kg given in a single daily dose on day 13 PI; n: 10. Bars indicate SEM. P,0.05 was considered significant (*).

expression until day 13 PI when they increased markedly; the increase persisted until day 17 PI. The expression of these genes was markedly modified by treatment: the increases in mRNA were delayed for several days and reached their highest levels on the last day studied (day 17 PI). Significant differences were found on days 7, 13 and 17 PI for TNF; on days 11, 13 and 15 for LT; on days 11,

Fig. 4. Gene expression of blood mononuclear cells obtained on day 13 PI from: sham-treated non-immunized rats, n: 4; sham-treated EAE rats, n: 4; and from EAE animals treated with Rolipram, n: 4. Peripheral blood mononuclear cells (PBMCs) were separated by Ficoll Hypaque centrifugation using standard techniques. cDNA was synthesized from RNA and PCR-amplified using specific primers, separated by agarose gel electrophoresis, transferred to a nylon membrane and visualized by hybridization with specific cDNA probes. Semi-quantitative RT-PCR was performed as described under Material and methods. Band intensity was normalized to the b-actin signal to account for differences in total RNA content for each sample. Values are expressed as relative densitometric units. Each point represents mean values of 4 rats; bars indicate SEM; asterisks denote statistically significant differences (P,0.05).

´ et al. / Journal of the Neurological Sciences 164 (1999) 13 – 23 I. Martınez

19

Fig. 5. Patterns of expression of TNF, LT, IFN-g, IL-1b, iNOs and IL-10 mRNA in spinal cord of sham-treated EAE rats (s) and rats treated daily with 5 mg / kg of Rolipram (d), throughout the course of the disease. Methods are the same as in Fig. 4.

13 and 17 for iNOs; on days 13 and 15 for IL-1b; and on days 13 and 17 for IFN-g. IL-10 mRNA was detectable at low levels throughout the study in untreated rats, with an increase on day 17 PI. This pattern was unchanged by Rolipram. Data for the second group of genes are presented in Fig. 6. The levels for both ICAM-1 and VCAM-1 did not exhibit significant fluctuations at any time during the days studied. Except for VCAM-1 on day 17 PI, therapy with

Rolipram induced no changes on the expression of these genes

4. Discussion In keeping with previous reports [29–34], our study of the temporal profile of cytokine gene expression, revealed that untreated EAE rats expressed high levels of IL-1b,

20

´ et al. / Journal of the Neurological Sciences 164 (1999) 13 – 23 I. Martınez

Fig. 6. Patterns of ICAM-1 and VCAM-1 expression in spinal cord tissue from the same groups of animals as in Fig. 5.

IFN-g, TNF and LT mRNAs in the spinal cords on day 13 PI, during the peak of the disease, and showed a decline of these levels during the recovery phase. Rolipram therapy induced a delayed expression of these genes, all of them reaching maximum levels on day 17 PI. Compared to the untreated group, certain levels were significantly lower on days 11 (LT, and iNOs), 13 (TNF, LT, IFN-g, IL-1b and iNOs) and 15 (LT and IL-1b), and higher on day 17 PI (TNF, IFN-g and iNOs). As in the untreated group, expression patterns correlated with the severity of EAE. In spite of the important protective role on EAE ascribed to IL-10 [35] and the ability of cAMP to induce a shift towards a Th-2 response in vitro [17] our analysis of the serial expression in the CNS revealed that the therapeutic effect of Rolipram was independent of this antiinflammatory cytokine. The data from our serial histological and gene expression analysis in the CNS performed throughout the course of EAE are consistent with the idea that: a) Rolipram induces an important delay in the entry of inflammatory cells in the CNS, which agrees with the suggestion made by Jung et al. [26]; b) cells that eventually enter the CNS seem to bear encephalitogenic potential as judged by their cytokine profile, virtually identical to that of EAE animals. Therefore, the reduction of proinflammatory cytokines in the CNS at the peak of the disease reported by others [36] would not be a direct modulatory effect of Rolipram in the CNS, but the result of a delayed entry of encephalitogenic cells, as the comparison of the temporal profiles of gene expression between the two groups suggests. This delay achieved by Rolipram is in contrast with the effect of TNF blockade with a p55-TNF-IgG fusion protein: accumulation of autoreactive T cells in the CNS is not prevented, but the activation state of the infiltrate is reduced [37]. To explore whether Rolipram could affect lymphocyte infiltration through inhibitory effects on adhesion molecules, we analyzed VCAM-1 and ICAM-1 mRNA expression. In EAE, inhibition of the expression of these adhe-

sion molecules might serve to limit inflammation and consequently to ameliorate the disease. Previous reports with PDE inhibitors showed contradictory results [26,38]. In our study, the two adhesion molecules were similarly expressed in spinal cords of treated and untreated rats, although VCAM-1 had a significant elevation on day 17 PI in the untreated group. The mRNA profile of these adhesion molecules did not correlate with the inflammatory response. Rolipram might reduce the cellular infiltration in the CNS through mechanisms independent of VCAM-1 and ICAM-1 expression. Intracellular elevation of cAMP prevents the anti CD3-induced upregulation of LFA-1 avidity for ICAM-1 [39], and can revert the conformationally active state to a low avidity for the ligand, resulting in deadhesion [40]; it also inhibits cytotoxic T lymphocyte adhesion and motility by interfering with the dynamics of the actin and tubulin cytoskeleton [19]. cAMP-elevating agents such as prostaglandin E 2 inhibit the transendothelial migration of human T lymphocytes, possibly through changes in the cytoskeleton of both T lymphocytes and endothelial cells; interestingly, this effect was not seen if these agents were applied after the binding of T cells and endothelial cells [41]. The latter observation might partially explain the reported lack of effectiveness of Rolipram when given after the appearance of EAE signs [26]. As NO is a powerful downregulator of TNF, IL-2 and IFN-g production during inflammatory responses [42,43], and the inducible NO synthase (iNOs) is transcriptionally regulated by cAMP elevations, particularly in the rat species [44–47], we considered that the generation of NO would represent an additional mechanism of action of Rolipram. The current controversy on the pathogenetic implication of NO in EAE has been partially clarified by the use of selective iNOs inhibitors, showing that NO is protective during the sensitization phase of EAE, but elicits damage once inflammatory cells enter the nervous parenchyma [48]. In the CNS, iNOs mRNA has been

´ et al. / Journal of the Neurological Sciences 164 (1999) 13 – 23 I. Martınez

associated with the severity of the disease [7,34,49–51]. However, new experimental data suggest that the role of NO in autoimmune demyelination is more complex than thought: generation of NO may be a factor to eliminate inflammatory cells infiltrating the CNS, contributing therefore to remission of EAE [8]. Recent work emphasizes the immunoregulatory and protective role of NO in EAE: transgenic mice with inactivation of the iNOs gene are susceptible to the actively induced disease [52] and may have a more severe course and less remission than mice of the wild type [53]. Furthermore, NO inhibition renders resistant rats highly susceptible to EAE [54]. As described in vitro for the rat system, our experiments confirm that continued treatment with a cAMP-elevating drug such as Rolipram increases levels of both iNOs mRNA and NO: we found that healthy rats on Rolipram had higher values of plasma NO than normal rats. In EAE animals, levels of iNOs mRNA in PBMCs and levels of NO in plasma were also high on day 13 PI, when the clinical signs began to peak. However, therapy with Rolipram induced significantly higher values of both iNOs mRNA and NO on the same day, when signs were barely detectable. Considering the increasingly recognized protective role of NO against EAE during the afferent arm of the immune response against antigens of the white matter [48], it is tempting to speculate that the excess of NO production induced by Rolipram might be, in fact, one of the therapeutic mechanisms of this drug in the rat. When we analyzed the effect of Rolipram on the serial expression of the iNOs gene in the CNS, we found that treated animals had a delayed expression of this gene by 6 days with regard to untreated EAE, which showed a peak of iNOs expression on day 11 PI, 2 days earlier than their maximum signs. As the main cellular source of iNOs in the spinal cord of EAE are macrophages [34], the delay of iNOs expression in the CNS elicited by Rolipram would indicate a late presence of macrophages in the nervous tissue. This explanation is entirely consistent with our histological analysis of the spinal cords, showing that inflammation occurred later and was less intense than that of the untreated animals. We also studied the effect of Rolipram on cytokine gene expression in the periphery. It was interesting to know if the expected downregulation of TNF mRNA in PBMCs was accompanied by a parallel increase of IL-10, since Rolipram has been shown to be involved in the production of IL-10, contributing to the inhibition of TNF in vitro [55]. However, inhibition of TNF mediated by this compound is independent of an increase of IL-10 production in murine endotoxemia [56]. Our results on day 13 PI agree with the latter observation, as the expected decrease of TNF mRNA levels in PBMCs was not accompanied by changes of IL-10 expression. The decrease in TNF mRNA was not associated with changes in the encephalitogenic potential of spleen cells: activated splenocytes from treated animals had the same ability to transfer the disease as

21

those from untreated EAE rats, as shown recently in mice [36]. In summary, our study shows that the important suppressive effect of PDE-IV inhibition on EAE is associated with a delayed entry and a reduced number of inflammatory cells in the CNS. At a molecular level, cells infiltrating the CNS have a pattern of cytokine gene expression similar to that of untreated EAE animals. We found no evidence of a Th2 shift in the CNS during the study period. VCAM-1 and ICAM-1 do not seem to be involved in the diminished migration of inflammatory cells into the CNS. Besides the important downregulation of TNF in PBMCs, other mechanisms explaining the reduced migration of cells into the CNS achieved by Rolipram would include changes in the cytoskeleton in both T lymphocytes and endothelial cells mediated by cAMP elevation. The strong stimulation of iNOs mRNA and the high levels of NO in the periphery before the peak of the disease suggest that NO generation might contribute to the protection achieved by Rolipram.

Acknowledgements This work has been supported by grants from the ´ Sanitaria (1295 / 95 and Spanish Fondo de Investigacion ˜ ´ Espanola ´ 0360 / 97) and Fundacion de Esclerosis Multiple. Dr Puerta is a recipient of a fellowship from the Spanish ´ Sanitaria. We are indebted to Dr E Fondo de Investigacion Cedillo from Schering Spain, for providing us with the drug used in this study. The editorial expertise of Martha Messman is gratefully acknowledged.

References [1] Swanborg RH. Experimental allergic encephalomyelitis. Methods Enzymol 1988;162:413–21. [2] Khoruts A, Miller SD, Jenkins MK. Neuroantigen-specific Th2 cells are inefficient suppressors of experimental autoimmune encephalomyelitis induced by effector Th1 cells. J Immunol 1995;155:5011–7. [3] Sobel RA, Blanchette BW, Bhan AK, Colvin RB. The immunopathology of experimental allergic encephalomyelitis: I. Quantitative analysis of inflammatory cells in situ. J Immunol 1984;132:2394– 401. [4] Polman CH, Dijkstra CD, Sminia T, Koetsier JC. Immunohistological analysis of macrophages in the central nervous system of Lewis rats with experimental allergic encephalomyelitis. J Neuroimmunol 1986;11:215–22. [5] Olsson T. Critical influences of the cytokine orchestration on the outcome of myelin antigen-specific T-cell autoimmunity in experimental autoimmune encephalomyelitis and multiple sclerosis. Immunological Reviews 1995;144:245–68. [6] Van der Veen RC, Stohlman SA. Encephalitogenic Th1 cells are inhibited by Th2 cells with related peptide specificity: relative roles of interleukin (IL)-4 and IL-10. J Neuroimmunol 1993;48:213–20. [7] Koproski H, Zheng YM, Heber-Katz E, Fraser N, Rorke L, Fu ZF, Hanlon C, Dietzschold B. In vivo expression of inducible nitric

22

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

´ et al. / Journal of the Neurological Sciences 164 (1999) 13 – 23 I. Martınez oxide synthase in experimentally induced neurologic disease. Proc Natl Acad Sci USA 1993;90:3024–7. Okuda Y, Sakoda S, Fujimura H, Yanagihara T. Nitric oxide via an inducible isoform of nitric oxide synthase is a possible factor to eliminate inflammatory cells from the central nervous system of mice with experimental allergic encephalomyelitis. J Neuroimmunol 1997;73:107–16. ¨ S, Choi S, Kons PA, Bo¨ L, Dawson TM, Wesselingh S, Mork Hanley D, Trapp B. Induction of nitric oxide synthase in demyelinating regions of multiple sclerosis brains. Ann Neurol 1994;36:778–86. Ding M, Zhang M, Wong JL, Rogers NE, Ignarro LJ, Voskuhl RR. Cutting edge: antisense knockdown of inducible nitric oxide synthase inhibits induction of experimental autoimmune encephalomyelitis in SJL / J mice. J Immunol 1998;160:2560–4. Lee SC, Dickson DW, Liu W, Brosnan CF. Induction of nitric oxide synthase activity in human astrocytes by interleukin-1b and interferon-g. J Neuroimmunol 1993;46:19–24. Misko TP, Trotter JL, Cross AH. Mediation of inflammation by encephalitogenic cells: interferon-g induction of nitric oxide synthase and cyclooxygenase 2. J Neuroimmunol 1995;61:195–204. Hewett SJ, Misko TP, Keeling RM, Behrens MM, Choi DW, Cross AH. Murine encephalitogenic lymphoid cells induce nitric oxide synthase in primary astrocytes. J Neuroimmunol 1996;64:201–8. Zielasek J, Jung S, Gold R, Liew FY, Toyka KV, Hartung HP. Administration of nitric oxide synthase inhibitors in experimental autoimmune neuritis and experimental autoimmune encephalomyelitis. J Neuroimmunol 1995;58:81–8. Ruuls S, Van Der Linden S, Sontrop K, Huitinga Y, Dijkstra C. Aggravation of experimental allergic encephalomyelitis (EAE) by administration of nitric oxide (NO) synthase inhibitors. Clin Exp Immunol 1996;103:467–74. Cross AH, Misko TP, Lin RF, Hickey WF, Trotter JL, Tilton RG. Aminoguanidine, an inhibitor of inducible nitric oxide synthase, ameliorates experimental autoimmune encephalomyelitis in SJL mice. J Clin Invest 1994;93:2384–90. Novak TJ, Rothenberg EV. cAMP inhibits induction of interleukin 2 but not of interleukin 4 in T cell. Proc Natl Acad Sci USA 1990;87:9353–7. Kammer GM. The adenylate cyclase-cAMP-protein kinase A pathway and regulation of the immune response. Immunol Today 1988;9:222–9. Valitutti S, Dessing M, Lanzavecchia A. Role of cAMP in regulating cytotoxic T lymphocyte adhesion and motility. Eur J Immunol 1993;23:790–5. Wachtel H, Schneider HH. Rolipram, a novel antidepressant drug, reverse the hypothermia and hypokinesia of monoamine-depleted mice by an action beyond postsynaptic monoamine receptor. Neuropharmacology 1986;25:1119–26. Mac Laughlin MM, Cieslinski LB, Burman M, Torphy TJ, Livi GP. A low-Km Rolipram-sensitive, cAMP-specific phosphodiesterase from human brain. J Biol Chem 1993;268:6470–6. Livi GP, Kmetz P, Mac Hale MM, Cieslinski LB, Sathe GM, Taylor DP, Davis LR, Torphy TJ, Balcarek JM. Cloning and expression of cDNA for a human low-KM Rolipram-sensitive cyclic AMP phosphodiesterase. Mol Cell Biol 1990;10:2678–86. Ichimura M, Kase H. A new cyclic nucleotide phosphodiesterase isozyme expressed in the T-lymphocyte cell lines. Biochem Biophys Res Commun 1993;193:985–90. ¨ Sommer N, Loschmann PA, Northoff GH, Weller M, Steinbrecher A, ¨ Steinbach JP, Lichtenfels R, Meyermann R, Riethmuller Fontana A, Dichgans J, Martin R. The antidepressant Rolipram suppresses cytokine production and prevents autoimmune encephalomyelitis. Nature Med 1995;1:243–8. Genain CP, Roberts T, Davis RL, Nguyen M, Uccelli A, Faulds D, Li Y, Hedgpeth J, Hauser SL. Prevention of autoimmune demyelination in nonhuman primates by a cAMP-specific phosphodiesterase inhibitor. Proc Natl Acad Sci USA 1995;92:3601–5.

[26] Jung S, Zielasek J, Kollner G, Donhauser T, Toyka K, Hartung H. Preventive but not therapeutic application of Rolipram ameliorates experimental autoimmune encephalomyelitis in Lewis rats. J Neuroimmunol 1996;68:1–11. [27] Minami M, Kuraishi Y, Satoh M. Effects of kainic acid on messenger RNA levels of IL-1b, IL-6 and LIF in the rat brain. Biochem Biophys Res Commun 1991;176:593–8. [28] Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. In: Short Protocols in Molecular Biology, 2nd edition, Harvard Medical School, 1992, pp. 2–24. [29] Kennedy MK, Torrance DS, Picha KS, Mohler KM. Analysis of cytokine mRNA expression in the central nervous system of mice with experimental autoimmune encephalomyelitis reveals that IL-10 mRNA expression correlates with recovery. J Immunol 1992;149:2496–505. [30] Bauer J, Berkenbosch F, Van Dam A, Dijkstra CD. Demonstration of interleukin-1b in Lewis rats during experimental allergic encephalomyelitis by immunocytochemistry at the light and ultrastructural level. J Neuroimmunol 1993;48:13–22. [31] Khoury SJ, Hancock WW, Weiner HL. Oral tolerance to myelin basic protein and natural recovery from experimental autoimmune encephalomyelitis are associated with downregulation of inflammatory cytokines and differential upregulation of transforming growth factor b, interleukin 4, and prostaglandin E expression in the brain. J Exp Med 1992;176:1355–64. ¨ [32] Issazadeh S, Ljungdahl A, Hojeberg B, Mustafa M, Olsson T. Cytokine production in the central nervous system of Lewis rats with experimental autoimmune encephalomyelitis: dynamics of mRNA expression for interleukin-10, interleukin-12, cytolysin, tumor necrosis factor a and tumor necrosis factor b. J Neuroimmunol 1995;61:205–12. ¨ [33] Issazadeh S, Mustafa M, Ljungdahl A, Hojeberg B, Dagerlind A, Elde R, Olsson T. Interferon g, interleukin 4 and transforming growth factor b in experimental autoimmune encephalomyelitis in Lewis rats: dynamics of cellular mRNA expression in the central nervous system and lymphoid cells. J Neurosci Res 1995;40:579– 90. [34] Okuda Y, Nakatsuji Y, Fujimura H, Esumi H, Ogura T, Yanagihara T, Sakoda S. Expression of the inducible isoform of nitric oxide synthase in the central nervous system of mice correlates with the severity of actively induced experimental allergic encephalomyelitis. J Neuroimmunol 1995;62:103–12. [35] Rott O, Fleischer B, Cash E. Interleukin-10 prevents experimental allergic encephalomyelitis in rats. Eur J Immunol 1994;24:1434–40. [36] Sommer N, Martin R, McFarland HF, Quigley L, Cannella B, Raine ¨ CS, Scott DE, Loschmann PA, Racke MK. Therapeutic potential of phosphodiesterase type 4 inhibition in chronic autoimmune demyelinating disease. J Neuroimmunol 1997;79:54–61. ¨ [37] Korner H, Lemckert FA, Chaudhri G, Etteldorf S, Sedgwick JD. Tumor necrosis factor blockade in actively induced experimental autoimmune encephalomyelitis prevents clinical disease despite activated T cell infiltration to the central nervous system. Eur J Immunol 1997;27:1973–81. ¨ [38] Rieckmann P, Weber F, Gunther A, Martin S, Bitsch A, Broocks A, ¨ Kitze B, Weber T, Borner T, Poser S. Pentoxifilline a phosphodiesterase inhibitor induces immune deviation in patients with multiple sclerosis. J Neuroimmunol 1996;64:193–200. [39] Dustin ML, Springer TA. T-cell receptor cross-linking transiently stimulates adhesiveness through LFA-1. Nature 1989;341:619–24. [40] Rovere P, Inverardi L, Bender JR, Pardi R. Feedback modulation of ligand-engaged aL / b2 leukocyte integrin (LFA-1) by cyclic AMPdependent protein kinase. J Immunol 1996;156:2273–9. [41] Oppenheimer-Marks N, Kavanaugh AF, Lipsky PE. Inhibition of the transendothelial migration of human T lymphocytes by prostaglandin E2. J Immunol 1994;152:5703–13. [42] Taylor-Robinson AW, Liew FY, Severn A, Xu D, McSorley SJ, Garside P, Padron J, Phillips RS. Regulation of the immune response

´ et al. / Journal of the Neurological Sciences 164 (1999) 13 – 23 I. Martınez

[43]

[44]

[45]

[46]

[47]

[48]

[49]

by nitric oxide differentially produced by T helper type 1 and T helper type 2 cells. Eur J Immunol 1994;24:980–4. Florquin S, Amraoui Z, Dubois C, Decuyper J, Goldman M. The protective role of endogenously synthesized nitric oxide in staphylococcal enteroxin B-induced shock in mice. J Exp Med 1994;180:1153–8. ¨ H, Walker G, Pfeilschifter J. Two distinct signalling Kunz D, Muhl pathways trigger the expression of inducible nitric oxide synthase in rat mesangial cells. Proc Natl Acad Sci USA 1994;91:5387–91. ´˜ Alonso A, Carvalho J, Alonso-Torres SR, Nunez L, Boska L, ´ Sanchez Crespo M. Nitric oxide synthesis in rat peritoneal macrophages is induced by IgE / DNP complexes and cyclic AMP analogues. Evidence in favor of a common signalling mechanism. J Immunol 1995;154:6475–83. Eberhardt W, Kunz D, Hummel R, Pfeilschifter J. Molecular cloning of the rat inducible nitric oxide synthase gene promoter. Biochem Biophys Res Comm 1996;233:752–6. ´ Y, Alonso A, Sanchez ´ Bayon Crespo M. Immunoglobulin-E / Dinitrophenyl complexes induce nitric oxide synthesis in rat peritoneal macrophages by a mechanism involving CD23 and NF-kB activation. Biochem Biophys Res Com 1998;242:570–4. Gold DP, Schroder K, Powell HC, Kelly CJ. Nitric oxide and the immunomodulation of experimental allergic encephalomyelitis. Eur J Immunol 1997;27:2863–9. Cross AH, Keeling RM, Goorha S, San M, Rodi C, Wyatt PS, Manning PT, Misko TP. Inducible nitric oxide synthase gene expression and enzyme activity correlate with disease activity in murine experimental autoimmune encephalomyelitis. J Neuroimmunol 1996;71:145–53.

23

[50] Merrill JE, Ignarro LJ, Sherman MP, Melinek J, Lane TE. Microglial cell cytotoxicity of oligodendrocytes is mediated through nitric oxide. J Immunol 1993;151:2132–41. [51] Lin RF, Lin TS, Tilton RG, Cross AH. Nitric oxide localized to spinal cords of mice with experimental allergic encephalomyelitis: an electron paramagnetic study. J Exp Med 1993;178:643–8. [52] Sahrbacher UC, Lechner F, Eugster HP, Frei K, Lassmann H, Fontana A. Mice with inactivation of the inducible nitric oxide synthase are susceptible to experimental autoimmune encephalomyelitis. Eur J Immunol 1998;28:1332–8. [53] Fenyk-Melody JE, Garrison AE, Brunnert SR, Weidner JR, Shen F, Shelton BA, Mudgett JS. Experimental autoimmune encephalomyelitis is excaerbated in mice lacking the NOS2 gene. J Immunol 1998;160:2940–6. [54] Crowden WB, Cullen FA, Staykova MA, Willenborg DO. Nitric oxide is a potential down-regulating molecule in autoimmune disease: inhibition of nitric oxide production renders PVG rats highly susceptible to EAE. J Neuroimmunol 1998;88:1–8. [55] Kambayashi T, Jacob CO, Zhou D, Mazurek N, Fong M, Strassmann G. Cyclic nucleotide phosphodiesterase type IV participates in the regulation of IL-10 and in the subsequent inhibition of TNF-alpha and IL-6 release by endotoxin-stimulated macrophages. J Immunol 1995;155:4909–16. ´ [56] Hasko´ G, Zsabo´ C, Nemeth ZH, Salzman AL, Vizi ES. Suppression of IL-12 production by phosphodiesterase inhibition in murine endotoxemia is IL-10 independent. Eur J Immunol 1998;28:468–72.