Typing of Actinomycetes by DNA amplification techniques

248

Abstracts

I Journal

of Microbiological

tion of several large fragments, e.g. primers reading out of repeats repMP1 (forward) and out of repMP5 (reversed) should yield fragments of 5.4, 5.6, 14.7, and 19.8 kb. The PCR products formed, or restriction patterns of these fragments should allow discrimination of M. pneumoniae strains.Initialy, 4 M. pneumoniae strains (1 of type 1 and 3 of type 2) were used to evaluate the primer sets. Apparently smaller fragments (l-6

due to preferential amplification of the kb), the long PCR in all cases failed to

Methods

30 (1997)

42 Realiability

Depurtment

obtained

References

1.

A. Cousin et al. IOM Letters

2. 3.

D. Ursi et al. J. Clin. Microbial. 1994, 2873-2875. R. Himmelreich et al. Nucl. Acids Res. 1996, 24: 4420-4449.

1994, 3: 494-495.

41 Typing of Actinomycetes by DNA amplification techniques L. Gallego, F. Lopez-Otsoa, I. Pujana, J. Canduela and R. Cisterna Department versity

of Inmunology,

?f the Basque

Microbiology

Country,

Apdo.

and Parasitology,

699-48080

Bilbao,

Uni-

Microbiology

Country,

Apdo.

and Parasitology,

699-48080

Bilbao,

UniSpain

two

PCR-based

DNA

fingerprinting

techniques

for

typing

baumannii.

A total of 34 isolates of Acinetobacter baumannii from 4 differents hospitals of Spain were analized by

Methods:

RAPD and ERIC-PCR.

Chromosomal

DNA was isolated by using

a modification of the CTAB methods. DNA was someted to amplification using 100 pmol of the following primers AP3(S’TCACGAATGCA3’) and ERIC2 (AAGTAAGTGACTGGGGTGAGCG3’). The temperature cycles ramped as follows: 1 cycle of 5 min. at 94°C 5 min. at 35°C and 5 min. at 72°C 28 cycles of 1 min at 94°C 2 min. at 35°C and 2 min. at 72°C and a final extension step of 10 min. at 72°C. Results: Band profiles obtained with AP3 ranged from 400 to 4000 bp. and showed 9 different genotypes. Band profiles obtained with ERIC2 ranged from 400 to 2500 bp, and showed 11 genotypes. The analysis of results obtained with both primers allowed us the discrimination of 12 genotypes. Conclusion: Although strains had similar profiles, differences between genotypes were due to the presence or abscence of 2-3 bands. The results obtained using the two sequence improved the level of discrimination,

Spain

Diagnosis of infections caused by actimomycetes are sometimes hindered by several factors such as difficulties of isolation, or in the classification and identification based on conventional morphological, phisiological and biochemical properties. Molecular techniques represent an alternative to the traditional microbiological methods. Methods: A total of 10 isolates of Actinomycetul were analized by AP-PCR and ERIC-PCR. Chromosomal DNA was isolated by using two lytic solutions containing tween 20, triton X- 100, NP40 and lyticase and protinase K enzymes. DNA was someted to amplification using 100 pmol of the following primers AP3 (5’TCACGAATGCA3’) and ERIC2 (AAGTAAGTGACTGGGGTGAGCG3’). The temperature cycles ramped as follows: 1 cycle of 5 min. at 94°C 5 min. at 35°C and 5 min. at 72°C 28 cycles of 1 min at 94”C, 2 min. at 35°C and 2 min. at 72”C, and a final extension step of 10 min. at 72°C. Results: Band profiles obtained with AP3 ranged from 300 to 3000 bp. and showed 5 different genotypes. Band profiles obtained with ERIC2 ranged from 200 to 2000 bp, and showed also, 5 genotypes. Differences between genotypes were due to the presence or abscence of 2-3 bands. Conclusion: PCR techniques may be a good alternative to conventional methods for typing Actinomycetales. fntroduction:

for typing Acinetobuc-

Introduction: Nosocomial outbreaks of infections involving strains of Acinerobrrcter buumannii are increasing. Traditional methods for identification of the strains involved have a low discriminatory power. The purpose of this study was to evaluate

fragments restriction

presently being applied to a large series of M. pneumoniae isolates, in order to gain more insight into the epidemiology of this microorganism. The results of these studies will be presented.

of Inmunology,

versity of the Basque

Acinetobacter

could be distinguished after restriction of the PCR fragments. This combination of primer sets and restriction endonucleases is

of AP-PCR and ERIC-PCR

ter baumannii isolates from different sources F. Lopez-Otsoa, L. Gallego, I. Pujana, J. Canduela and R. Cistema

produce the larger fragments (> 10 kb) expected. The repMPlrepMP5 PCR described above only yielded the 5.4 and 5.6 kb fragments, plus an unpredicted 1.5 kb fragment, but the expected 14.7 and 19.8 kb fragments were not observed. Despite this, the 4 M. pneumoniae strains could be discriminated based on the formed with one of the 3 primer sets, even without digestion. With a second primer set individual strains

235-253

43 An automated system (COBAS AMPLICORTM) for the routine diagnostic detection and quantitation of viral nucleic acids K. Gutekunst, T. Haley, K. Hasselbring, W. Iszczyszyn, K. Logan, D. Petersen, W. Schilling, S. Soviero and J.P. Spadoro Roche Molecular 08876,

Systems, 1080 US Highway

202, Somerville,

NJ

USA

Accurate quantitation of Hepatitis C Virus (HCV) RNA in serum or plasma has been shown to be a useful tool for monitoring patients on interferon therapy. This report describes an instrument system (COBAS AMPLICORTM) that performs all of the steps necessary for the PCR amplification and quantitative detection of HCV RNA that has been isolated from human serum or plasma. The general principle of the test is similar to the AMPLICOR HCV MONITORTM test that has been described previously. The amplification system amplifies all known genotypes of HCV with relatively equal efficiency. The S’UTR of HCV is amplified using a single primer pair and rTth DNA polymerase in a single-tube, single-enzyme reaction system. A quantitation standard (QS) is incorporated into each reaction during sample preparation in order to monitor both RNA recovery and amplification efficiency. The QS is used to determine the copy number of