- Email: [email protected]
Ultra-sensitive detection of Ag+ ions based on Ag+-assisted isothermal exponential degradation reaction
Biosensors and Bioelectronics 39 (2013) 183–186
Contents lists available at SciVerse ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
Ultra-sensitive detection of Ag þ ions based on Ag þ -assisted isothermal exponential degradation reaction Jing Zhao a, Qi Fan a, Sha Zhu a,b, Aiping Duan c, Yongmei Yin b, Genxi Li a,c,n a
Laboratory of Biosensing Technology, School of Life Sciences, Shanghai University, Shanghai 200444, PR China Department of Oncology, the First Affiliated Hospital of Nanjing Medical University, Nanjing 210029, PR China c Department of Biochemistry and State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing 210093, PR China b
a r t i c l e i n f o
abstract
Article history: Received 28 April 2012 Received in revised form 11 July 2012 Accepted 18 July 2012 Available online 8 August 2012
Ag þ ions are greatly toxic to a lot of algae, fungi, viruses and bacteria, which can also induce harmful side-effects to environments and human health. Herein we report an ultra-sensitive method for the selective detection of Ag þ ions with electrochemical technique based on Ag þ -assisted isothermal exponential degradation reaction. In the presence of Ag þ , mismatched trigger DNA can transiently bind to template DNA immobilized on an electrode surface through the formation of C–Ag þ –C base pair, which then initiates the isothermal exponential degradation reaction. As a result, the mismatched trigger DNA may melt off the cleaved template DNA to trigger rounds of elongation and cutting. After the cyclic degradation reactions, removal of the template DNA immobilized on the electrode surface can be efficiently monitored by using electrochemical technique to show the status of the electrode surface, which can be then used to determine the presence of Ag þ . Further studies reveal that the proposed method can be ultra-sensitive to detect Ag þ at a picomolar level. The selectivity of the detection can also be satisfactory, thus the proposed method for the Ag þ ions detection may be potentially useful in the future. & 2012 Elsevier B.V. All rights reserved.
Keywords: Ag þ detection Exponential degradation reaction C–Ag þ –C base pair Electrochemical technique
1. Introduction Ag þ ions are greatly toxic to algae, fungi, virus and bacteria, thus silver salts and silver nanoparticles have been broadly applied for the disinfection of drinking water and the preparation of medical supplies, e.g., catheters, topical gels and specialty bandages (Lai et al., 2010; Bhardwaj et al., 2006). Nevertheless, high concentration of Ag þ ions may cause harmful side-effects to the environment and human health (Iyoshi et al., 2008; Freeman et al., 2009). Based on the reports of U.S. Environmental Protection Agency (EPA), Ag þ ions are toxic to fish and microorganisms when the concentration is higher than 1.6 nM, and the maximum concentration for this contaminant is restricted to 0.9 mM in drinking water (Lai et al., 2010; Zhang et al., 2012; Wygladacz et al., 2005). On the other hand, every year, huge amounts of silver are produced from industrial wastes, about 80 t of which may finally enter into the surface water (Ratte, 1999). So, it is of great importance to sensitively and accurately detect Ag þ in water samples. However, the traditional methods, for instance, inductively coupled plasma mass spectrometry (ICP-MS), atomic n Corresponding author at: Department of Biochemistry and State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing 210093, PR China. Tel.: þ 86 25 83593596; fax: þ86 25 83592510. E-mail address: [email protected] (G. Li).
0956-5663/$ - see front matter & 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.bios.2012.07.073
absorption spectrometry, etc., usually have some limitations in practical application, such as high cost, complicated operation and time-consuming (Resano et al., 2006; Dadfarnia et al., 2004; Liu et al., 2009). Therefore, it is highly required to develop more useful techniques for rapid, simple, accurate and sensitive analysis of Ag þ ions. Owing to the potential application in the detection of metal ions, the selective binding of metal ions with the native or artificial bases to form metal-mediated base pairs has aroused increasing interest in researches. For example, Hg2 þ can specifically interact with thymine–thymine (T–T) mismatch, and cytosine–cytosine (C–C) pairs are able to exclusively capture Ag þ (Clever et al., 2007; Ono et al., 2008; Ono et al., 2011). Therefore, based on the formation of metal-mediated base pairs, several DNA-based biosensors for the detection of Hg2 þ ions has been developed (Zhu et al., 2009; Miao et al., 2009), while some methods to detect Ag þ ions are reported by using colorimetry, surface plasmon resonance and fluorescence, etc. (Zhou et al., 2010; Li et al., 2009; Chang et al., 2012; Lin and Tseng, 2009; Li et al., 2011). Moreover, metal ions that can specifically interact with mismatched base pairs are discovered to be able to intentionally trigger polymerase activity (Park et al., 2010; Urata et al., 2010), so highly sensitive detection of Ag þ might be possible since polymerase strand extension has been commonly involved in many target-based amplification processes, such as polymerase
184
J. Zhao et al. / Biosensors and Bioelectronics 39 (2013) 183–186
chain reaction (PCR) and exponential amplification reaction (EXPAR) (Giljohann and Mirkin, 2009; Van Ness et al., 2003; Zhao et al., 2011). Therefore, based on our designed target triggered isothermal exponential degradation reaction (isoTexpDR), which integrates polymerase strand extension and double-strand DNA cleavage, we have proposed Ag þ -assisted isoTexpDR (AA-isoTexpDR) in this work for the electrochemical detection of Ag þ . The proposed method may not only have greatly increased reaction efficiency but also show ultra-sensitive detection sensitivity. The selectivity of the method is also satisfactory, so it may have potential applications in the future.
2. Experimental 2.1. Materials and reagents Mercaptohexanol (MCH), hexaammineruthenium (III) chloride ([Ru(NH3)6]3 þ ) and tris (2-carboxyethyl) phosphine hydrochloride (TCEP) were purchased from Sigma. The Bst DNA polymerase, Large Fragment and BsaBI endonuclease were purchased from New England Biolabs Inc. Other chemicals were of analytical grade and were used without further purification. For all experiments, Milli-Q water (18.0 MO) purified by a Milli-Q Plus 185 ultrapure water system (Millipore Purification Pack) was used. DNA oligonucleotides were synthesized by Sangon (Shanghai, China) and used without further purification. The DNA sequences are as follows. Template DNA: 50 –CCTACGACTGGATGACGATCCCTACGACTGAAAAAAAAA AAA-C6-SH–30 . Mismatched trigger DNA: 50 –CAGTCCTAGG–30 .
2.2. Preparation of template DNA modified gold electrode Firstly, the gold electrode was polished on fine sand papers and alumina (particle size of about 0.05 mm)/water slurry on silk, and ultrasonicated in ethanol and doubly distilled water for 5 min, respectively. Then, the electrode was electrochemically cleaned to remove any remaining impurities in 0.5 M H2SO4. After being dried with nitrogen, the electrode was immediately used for the immobilization of template DNA by immersing into a solution containing 1 mM template DNA, 10 mM Tris–HCl, 1 mM EDTA, 10 mM TCEP and 0.1 M NaCl (pH 7.4) for 16 h at room temperature, followed by the treatment with 1 mM MCH for 1 h. Finally, the electrode was thoroughly rinsed by doubly distilled water, which was then ready for further experiments. Based on the principle of chronocoulometric method (Steel et al., 1998), the surface density of the loading template DNA can be calculated to be 1.33 1013 molecule/cm2.
2.4. Electrochemical measurements Cyclic voltammetry (CV) and chronocoulometry (CC) were carried out on a CHI440A electrochemical analyzer in 10 mM Tris–HCl solution (pH 7.4) containing 50 mM [Ru(NH3)6]3 þ . For CV, the scan rate was 50 mV/s and the scan range was from 0.45 to 0.05 V. For CC, the pulse period was 250 ms and pulse width was 700 mV. A three-electrode system consisting of the modified gold electrode, saturated calomel reference electrode (SCE) and platinum counter electrode was used for all the electrochemical measurements. Before the measurements, the test solution should be thoroughly deoxygenated by bubbling high-purity nitrogen through the solution for at least 10 min. A stream of nitrogen was then blown gently across the surface of the solution in order to maintain the solution anaerobic throughout all the experiments. 2.5. Gel electrophoresis assay For gel electrophoresis assay, 100 nM template DNA, 100 nM mismatched trigger DNA and 1 mM Ag þ were firstly added into the AA-isoTexpDR reaction solution, which was then incubated at 60 1C for 7 min. After AA-isoTexpDR, the reaction mixture was monitored by using denaturing polyacrylamide gel electrophoresis (20% acrylamide, acrylamide/bisacrylamide ¼19:1, 7 M Urea). Electrophoresis was carried out in 1 TBE (pH 8.0) at 150 V constant voltages for 1.5 h. After being stained by SYBR Green, the gel was recorded by a GelDoc XR þ System (Bio-Rad).
3. Results and discussion Fig. 1 may illustrate the principle of the proposed method for the highly sensitive detection of Ag þ ions. Firstly, the template DNA is immobilized on the surface of the gold electrode via Au–S bond. Since the mismatched trigger DNA is not designed to be completely complementary to the template DNA, the hybridization cannot be achieved. Nevertheless, in the presence of Ag þ ions, the mismatched trigger DNA can transiently bind to the template DNA through the formation of C–Ag þ –C base pair, which then works as a primer to start the polymerization reaction. As the result of polymerase strand extension, a thermo-stable duplex containing a recognition site for BsaBI action is formed by the hybridization of the elongated trigger strand and template DNA strand. Then, the duplex is immediately cleaved by the restriction endonuclease, thus the two short strands resulted from the cleavage
2.3. AA-isoTexpDR protocol AA-isoTexpDR was carried out in a reaction solution containing 0.08 unit/mL Bst polymerase, 0.4 unit/mL BsaBI endonuclease, 250 mM dNTPs, 1 NE buffer 4 (50 mM KAc, 10 mM Mg(Ac)2, 20 mM Tris–HAc, pH 7.9). To perform AA-isoTexpDR, the above template DNA modified gold electrode was firstly immersed into the reaction solution which also contained 100 nM mismatched trigger DNA and desired amount of Ag þ at 60 1C for 7 min. After being thoroughly rinsed with double-distilled water, the electrode was then ready for the following electrochemical measurements. In the control experiments, 1 mM Na þ , Zn2 þ , Fe2 þ , Pb2 þ , Al3 þ or Cr6 þ instead of Ag þ were added in the reaction solution.
Fig. 1. Schematic illustration of ultra-sensitive detection of Ag þ ions via AA-isoTexpDR.
J. Zhao et al. / Biosensors and Bioelectronics 39 (2013) 183–186
of the elongated trigger strand will release from the cleaved template DNA, because the reaction temperature (60 1C) is much higher than the melting temperature of the cleaved duplex. Consequently, the mismatched trigger DNA is free again and a fully complementary trigger DNA is produced. They may both bind with other intact template DNA, and moreover, new rounds of elongation and scission with or even without the assistance of Ag þ are initiated. As the reaction cyclically occurs, the trigger DNA is exponentially amplified, while the template DNA is exponentially degraded. After the AA-isoTexpDR, the degraded template DNA immobilized on the electrode surface can be efficiently monitored with electrochemical techniques by using [Ru(NH3)6]3 þ as the signal molecules, and the ultra-sensitive detection of Ag þ ions can be realized since the degradation reaction is actually triggered by Ag þ ions. As a comparison, if other control ions instead of Ag þ ion are used, since the mismatched DNA cannot effectively bind with the template DNA to initiate AA-isoTexpDR, removal of the template DNA cannot be achieved. So, the selectivity of the detection is also highly feasible.
3.1. Studies of the degradation of template DNA by cyclic voltammetry and gel electrophoresis It has been known that electroactive molecules [Ru(NH3)6]3 þ can bind to the anionic phosphate of DNA molecules through electrostatic interaction, so the redox charges of adsorbed [Ru(NH3)6]3 þ have been demonstrated to be positively correlated with the amounts of surface confined DNA (Shen et al., 2008). In this work, by using [Ru(NH3)6]3 þ as the signaling transducer, we have firstly characterized the degradation of template DNA on the electrode surface with CV. As shown in Fig. 2, a pair of welldefined, reversible oxidation/reduction peaks can be observed with the formal potential at 0.313 V (vs. SCE), ascribing to the electrostatic binding of [Ru(NH3)6]3 þ to the immobilized template DNA on the electrode surface (Fan et al., 2012; Miao et al., 2009; Shen et al., 2012). Since the peak current is directly proportional to the amount of adsorbed [Ru(NH3)6]3 þ , representing the amount of surface immobilized DNA, it can be observed that the peak current will be decreased after the achievement of AA-isoTexpDR in the presence of 1 mM Ag þ . The reason is clear, since AA-isoTexpDR happens due to the binding of the mismatched trigger DNA to the template DNA through the formation of
Fig. 2. Cyclic voltammogram obtained at the template DNA modified gold electrode for a 10 mM Tris–HCl buffer (pH 7.4) containing 50 mM [Ru(NH3)6]3 þ (the solid line). The dotted and dashed lines are separately the curves after AAisoTexpDR in the presence and absence of 1 mM Ag þ . Scan rate: 50 mV/s. Inset is polyacrylamide gel assay of the degradation of template DNA.
185
C–Ag þ –C base pair, which thus induces the degradation of the template DNA immobilized on the electrode surface. As a result, an obvious decrease of peak current can be observed after the performance of the AA-isoTexpDR, since the amount of [Ru(NH3)6]3 þ that can be adsorbed to the cleaved template DNA is reduced. In contrast, without Ag þ being involved, nearly no change of the peaks can be observed. We have also employed polyacrylamide gel electrophoresis (PAGE) to verify the degradation of template DNA that happened in this work. As shown in the inset of Fig. 2, template DNA can be efficiently degraded via AA-isoTexpDR in the presence of 1 mM Ag þ , proven by the disappeared electrophoresis band of template DNA. Meanwhile, it can be known that no degradation happens without the participance of Ag þ ions. Therefore, both CV and PAGE studies have confirmed that degradation of the template DNA can only be initiated in the presence of Ag þ ions.
3.2. Detection of Ag þ ions with chronocoulometry Since CV technique is not sensitive enough to show the changes of the surface charge, we have further used a much more precise and sensitive technique, chronocoulometry, for the characterization of the degradation of template DNA as well as the quantitative detection of Ag þ (Lao et al., 2005; Miao et al., 2011). Fig. 3 shows the relationship between the surface charge density of the gold electrode and the concentration of Ag þ ranging from 0 to 1 mM. It can be observed that with the addition of Ag þ into the test solution, since the mismatched trigger DNA can bind with the template DNA via the formation of C–Ag þ –C base pairs, degradation of the template DNA is achieved and consequently, the amount of [Ru(NH3)6]3 þ molecules that bind to the template DNA is decreased, leading to the decrease of the surface charge density. Further studies reveal that the surface charge density decreases in an Ag þ concentration-dependent manner, and the decrease of the surface charge (DCharge) is proportional to the logarithmic concentration of Ag þ (x) from 10 pM to 100 nM (Fig. 3, inset). The regression equation is DCharge (10 6 C) ¼ 0.1216þ0.03324 log x (10 9 M), R¼0.997. Moreover, the limit of detection (LOD) can be achieved as low as 3 pM, which is not only much lower than that in the previous reports but also good enough to satisfy the detection demand of EPA (Li et al., 2009;
Fig. 3. Chronocoulometric curves obtained at the template DNA modified electrode after AA-isoTexpDR with different concentrations of Ag þ (from top to bottom: 0, 10 pM, 50 pM, 100 pM, 1 nM, 10 nM, 50 nM, 100 nM, 250 nM, 500 nM and 1 mM). Inset shows a linear relationship between DCharge and log of the concentrations of Ag þ from 10 pM to 100 nM. Error bars represent the standard deviations of three independent measurements. Buffer: 10 mM Tris–HCl buffer (pH 7.4) containing 50 mM [Ru(NH3)6]3 þ . Pulse period: 250 ms. Pulse width: 700 mV.
186
J. Zhao et al. / Biosensors and Bioelectronics 39 (2013) 183–186
based on the specific interaction of metal ions and base pairs, this proposed method may be expanded to detect more metal ions with the well-designed trigger DNA and template DNA. Therefore, we expect our method may have potential use in ion detection as well as environmental monitoring in the future.
Acknowledgments This work is supported by the National Science Fund for Distinguished Young Scholars (Grant no. 20925520), and the Leading Academic Discipline Project of Shanghai Municipal Education Commission (J50108).
Fig. 4. The surface charges obtained in the presence of different metal ions. The concentrations of the metal ions are 1 mM.
Trnkovaa et al., 2011). Certainly, a better LOD cannot be obtained, since the cleaved template DNA that remained on the electrode surface may still bind with [Ru(NH3)6]3 þ to induce background signal, which limits the improvement of the sensitivity. Nevertheless, this is a lowest LOD to the best of our knowledge. The relative standard deviation for series of repetitive measurements with different concentrations of Ag þ may all be within 10%, so the reproducibility of the detection can be also satisfactory. Besides, since the template DNA modified electrode can be stored in a refrigerator without significant loss of electrochemical responses for at least one week, the stability of our method is also quite well. 3.3. The specificity of the detection To examine the selectivity of this method, some control metal ions have been used for this study. As shown in Fig. 4, nearly no evident change of the surface charge can be observed when Na þ , Zn2 þ , Fe2 þ , Pb2 þ , Al3 þ or Cr6 þ are employed, while the surface charge decreased significantly if Ag þ is used. Therefore, the control experiments have not only confirmed the important role of the formation of C–Ag þ –C in the proposed method for Ag þ ion detection, but also assured the high specificity of the method. Moreover, since 7 min has been demonstrated to be sufficient for the degradation of template DNA without the interference from the non-specific background degradation, the performance is quite fast, which is totally no more than 10 min.
4. Conclusions In conclusion, we have proposed an ultra-sensitive and easilyoperated electrochemical method for selective detection of Ag þ ions by using Ag þ -assisted isothermal exponential degradation reaction. With the formation of C–Ag þ –C base pair, mismatched trigger DNA can efficiently initiate the polymerase strand extension and the subsequent strand cleavage by binding to the template DNA that has been previously immobilized on an electrode surface. Degradation of the template DNA may result in significant decrease of electrochemical signal, so Ag þ ions can be ultra-sensitively detected at pM level. The detection can also be highly selective, since only Ag þ instead of other ions can bind with the template DNA to form C–Ag þ –C pair. On the other hand,
References Bhardwaj, V.K., Singh, N., Hundal, M.S., Hundal, G., 2006. Tetrahedron 62 (33), 7878–7886. Chang, C.C., Lin, S., Wei, S.C., Chu-Su, Y., Lin, C.W., 2012. Analytical and Bioanalytical Chemistry 402 (9), 2827–2835. Clever, G.H., Kaul, C., Carell, T., 2007. Angewandte Chemie-International Edition 46 (33), 6226–6236. Dadfarnia, S., Shabani, A.M.H., Gohari, M., 2004. Talanta 64 (3), 682–687. Fan, Q., Zhao, J., Li, H., Zhu, L., Li, G.X., 2012. Biosensors and Bioelectronics 33 (1), 211–215. Freeman, R., Finder, T., Willner, I., 2009. Angewandte Chemie (International Edition in English) 48 (42), 7818–7821. Giljohann, D.A., Mirkin, C.A., 2009. Nature 462 (7272), 461–464. Iyoshi, S., Taki, M., Yamamoto, Y., 2008. Inorganic Chemistry 47 (10), 3946–3948. Lai, C.Z., Fierke, M.A., da Costa, R.C., Gladysz, J.A., Stein, A., Buhlmann, P., 2010. Analytical Chemistry 82 (18), 7634–7640. Lao, R.J., Song, S.P., Wu, H.P., Wang, L.H., Zhang, Z.Z., He, L., Fan, C.H., 2005. Analytical Chemistry 77 (19), 6475–6480. Li, H.L., Zhai, J.F., Sun, X.P., 2011. Langmuir 27 (8), 4305–4308. Li, T., Shi, L.L., Wang, E., Dong, S.J., 2009. Chemistry – A European Journal 15 (14), 3347–3350. Lin, Y.H., Tseng, W.L., 2009. Chemical Communications 45 (43), 6619–6621. Liu, J.F., Chao, J.B., Liu, R., Tan, Z.Q., Yin, Y.G., Wu, Y., Jiang, G.B., 2009. Analytical Chemistry 81 (15), 6496–6502. Miao, P., Liu, L., Li, Y., Li, G.X., 2009. Electrochemistry Communications 11 (10), 1904–1907. Miao, P., Ning, L.M., Li, X.X., Shu, Y.Q., Li, G.X., 2011. Biosensors and Bioelectronics 27 (1), 178–182. Ono, A., Cao, S., Togashi, H., Tashiro, M., Fujimoto, T., Machinami, T., Oda, S., Miyake, Y., Okamoto, I., Tanaka, Y., 2008. Chemical Communications 44 (39), 4825–4827. Ono, A., Torigoe, H., Tanaka, Y., Okamoto, I., 2011. Chemical Society Reviews 40 (12), 5855–5866. Park, K.S., Jung, C., Park, H.G., 2010. Angewandte Chemie-International Edition 49 (50), 9757–9760. Ratte, H.T., 1999. Environmental Toxicology and Chemistry 18 (1), 89–108. Resano, M., Aramendia, M., Ruiz, E.G., Crespo, C., Belarra, M.A., 2006. Analytica Chimica Acta 571 (1), 142–149. Shen, L., Chen, Z., Li, Y., He, S., Xie, S., Xu, X., Liang, Z., Meng, X., Li, Q., Zhu, Z., Li, M., Le, X.C., Shao, Y., 2008. Analytical Chemistry 80 (16), 6323–6328. Shen, M., Yang, M., Li, H., Liang, Z.Q., Li, G.X., 2012. Electrochimica Acta 60, 309–313. Steel, A.B., Herne, T.M., Tarlov, M.J., 1998. Analytical Chemistry 70, 4670–4677. Trnkovaa, L., Krizkovab, S., Adamb, V., Hubalekc, J., Kizek, R., 2011. Biosensors and Bioelectronics 26 (5), 2201–2207. Urata, H., Yamaguchi, E., Funai, T., Matsumura, Y., Wada, S., 2010. Angewandte Chemie-International Edition 49 (37), 6516–6519. Van Ness, J., Van Ness, L.K., Galas, D.J., 2003. Proceedings of the National Academy of Sciences of the United States of America 100 (8), 4504–4509. Wygladacz, K., Radu, A., Xu, C., Qin, Y., Bakker, E., 2005. Analytical Chemistry 77 (15), 4706–4712. Zhang, T., Chai, Y.Q., Yuan, R., Guo, J.X., 2012. Analytical Methods 4 (2), 454–459. Zhao, J., Liu, T., Fan, Q., Li, G.X., 2011. Chemical Communications 47 (18), 5262–5264. Zhou, X.H., Kong, D.M., Shen, H.X., 2010. Analytica Chimica Acta 678 (1), 124–127. Zhu, Z.Q., Su, Y.Y., Li, J., Li, D., Zhang, J., Song, S.P., Zhao, Y., Li, G.X., Fan, C.H., 2009. Analytical Chemistry 81 (18), 7660–7666.
Contents lists available at SciVerse ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
Ultra-sensitive detection of Ag þ ions based on Ag þ -assisted isothermal exponential degradation reaction Jing Zhao a, Qi Fan a, Sha Zhu a,b, Aiping Duan c, Yongmei Yin b, Genxi Li a,c,n a
Laboratory of Biosensing Technology, School of Life Sciences, Shanghai University, Shanghai 200444, PR China Department of Oncology, the First Affiliated Hospital of Nanjing Medical University, Nanjing 210029, PR China c Department of Biochemistry and State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing 210093, PR China b
a r t i c l e i n f o
abstract
Article history: Received 28 April 2012 Received in revised form 11 July 2012 Accepted 18 July 2012 Available online 8 August 2012
Ag þ ions are greatly toxic to a lot of algae, fungi, viruses and bacteria, which can also induce harmful side-effects to environments and human health. Herein we report an ultra-sensitive method for the selective detection of Ag þ ions with electrochemical technique based on Ag þ -assisted isothermal exponential degradation reaction. In the presence of Ag þ , mismatched trigger DNA can transiently bind to template DNA immobilized on an electrode surface through the formation of C–Ag þ –C base pair, which then initiates the isothermal exponential degradation reaction. As a result, the mismatched trigger DNA may melt off the cleaved template DNA to trigger rounds of elongation and cutting. After the cyclic degradation reactions, removal of the template DNA immobilized on the electrode surface can be efficiently monitored by using electrochemical technique to show the status of the electrode surface, which can be then used to determine the presence of Ag þ . Further studies reveal that the proposed method can be ultra-sensitive to detect Ag þ at a picomolar level. The selectivity of the detection can also be satisfactory, thus the proposed method for the Ag þ ions detection may be potentially useful in the future. & 2012 Elsevier B.V. All rights reserved.
Keywords: Ag þ detection Exponential degradation reaction C–Ag þ –C base pair Electrochemical technique
1. Introduction Ag þ ions are greatly toxic to algae, fungi, virus and bacteria, thus silver salts and silver nanoparticles have been broadly applied for the disinfection of drinking water and the preparation of medical supplies, e.g., catheters, topical gels and specialty bandages (Lai et al., 2010; Bhardwaj et al., 2006). Nevertheless, high concentration of Ag þ ions may cause harmful side-effects to the environment and human health (Iyoshi et al., 2008; Freeman et al., 2009). Based on the reports of U.S. Environmental Protection Agency (EPA), Ag þ ions are toxic to fish and microorganisms when the concentration is higher than 1.6 nM, and the maximum concentration for this contaminant is restricted to 0.9 mM in drinking water (Lai et al., 2010; Zhang et al., 2012; Wygladacz et al., 2005). On the other hand, every year, huge amounts of silver are produced from industrial wastes, about 80 t of which may finally enter into the surface water (Ratte, 1999). So, it is of great importance to sensitively and accurately detect Ag þ in water samples. However, the traditional methods, for instance, inductively coupled plasma mass spectrometry (ICP-MS), atomic n Corresponding author at: Department of Biochemistry and State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing 210093, PR China. Tel.: þ 86 25 83593596; fax: þ86 25 83592510. E-mail address: [email protected] (G. Li).
0956-5663/$ - see front matter & 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.bios.2012.07.073
absorption spectrometry, etc., usually have some limitations in practical application, such as high cost, complicated operation and time-consuming (Resano et al., 2006; Dadfarnia et al., 2004; Liu et al., 2009). Therefore, it is highly required to develop more useful techniques for rapid, simple, accurate and sensitive analysis of Ag þ ions. Owing to the potential application in the detection of metal ions, the selective binding of metal ions with the native or artificial bases to form metal-mediated base pairs has aroused increasing interest in researches. For example, Hg2 þ can specifically interact with thymine–thymine (T–T) mismatch, and cytosine–cytosine (C–C) pairs are able to exclusively capture Ag þ (Clever et al., 2007; Ono et al., 2008; Ono et al., 2011). Therefore, based on the formation of metal-mediated base pairs, several DNA-based biosensors for the detection of Hg2 þ ions has been developed (Zhu et al., 2009; Miao et al., 2009), while some methods to detect Ag þ ions are reported by using colorimetry, surface plasmon resonance and fluorescence, etc. (Zhou et al., 2010; Li et al., 2009; Chang et al., 2012; Lin and Tseng, 2009; Li et al., 2011). Moreover, metal ions that can specifically interact with mismatched base pairs are discovered to be able to intentionally trigger polymerase activity (Park et al., 2010; Urata et al., 2010), so highly sensitive detection of Ag þ might be possible since polymerase strand extension has been commonly involved in many target-based amplification processes, such as polymerase
184
J. Zhao et al. / Biosensors and Bioelectronics 39 (2013) 183–186
chain reaction (PCR) and exponential amplification reaction (EXPAR) (Giljohann and Mirkin, 2009; Van Ness et al., 2003; Zhao et al., 2011). Therefore, based on our designed target triggered isothermal exponential degradation reaction (isoTexpDR), which integrates polymerase strand extension and double-strand DNA cleavage, we have proposed Ag þ -assisted isoTexpDR (AA-isoTexpDR) in this work for the electrochemical detection of Ag þ . The proposed method may not only have greatly increased reaction efficiency but also show ultra-sensitive detection sensitivity. The selectivity of the method is also satisfactory, so it may have potential applications in the future.
2. Experimental 2.1. Materials and reagents Mercaptohexanol (MCH), hexaammineruthenium (III) chloride ([Ru(NH3)6]3 þ ) and tris (2-carboxyethyl) phosphine hydrochloride (TCEP) were purchased from Sigma. The Bst DNA polymerase, Large Fragment and BsaBI endonuclease were purchased from New England Biolabs Inc. Other chemicals were of analytical grade and were used without further purification. For all experiments, Milli-Q water (18.0 MO) purified by a Milli-Q Plus 185 ultrapure water system (Millipore Purification Pack) was used. DNA oligonucleotides were synthesized by Sangon (Shanghai, China) and used without further purification. The DNA sequences are as follows. Template DNA: 50 –CCTACGACTGGATGACGATCCCTACGACTGAAAAAAAAA AAA-C6-SH–30 . Mismatched trigger DNA: 50 –CAGTCCTAGG–30 .
2.2. Preparation of template DNA modified gold electrode Firstly, the gold electrode was polished on fine sand papers and alumina (particle size of about 0.05 mm)/water slurry on silk, and ultrasonicated in ethanol and doubly distilled water for 5 min, respectively. Then, the electrode was electrochemically cleaned to remove any remaining impurities in 0.5 M H2SO4. After being dried with nitrogen, the electrode was immediately used for the immobilization of template DNA by immersing into a solution containing 1 mM template DNA, 10 mM Tris–HCl, 1 mM EDTA, 10 mM TCEP and 0.1 M NaCl (pH 7.4) for 16 h at room temperature, followed by the treatment with 1 mM MCH for 1 h. Finally, the electrode was thoroughly rinsed by doubly distilled water, which was then ready for further experiments. Based on the principle of chronocoulometric method (Steel et al., 1998), the surface density of the loading template DNA can be calculated to be 1.33 1013 molecule/cm2.
2.4. Electrochemical measurements Cyclic voltammetry (CV) and chronocoulometry (CC) were carried out on a CHI440A electrochemical analyzer in 10 mM Tris–HCl solution (pH 7.4) containing 50 mM [Ru(NH3)6]3 þ . For CV, the scan rate was 50 mV/s and the scan range was from 0.45 to 0.05 V. For CC, the pulse period was 250 ms and pulse width was 700 mV. A three-electrode system consisting of the modified gold electrode, saturated calomel reference electrode (SCE) and platinum counter electrode was used for all the electrochemical measurements. Before the measurements, the test solution should be thoroughly deoxygenated by bubbling high-purity nitrogen through the solution for at least 10 min. A stream of nitrogen was then blown gently across the surface of the solution in order to maintain the solution anaerobic throughout all the experiments. 2.5. Gel electrophoresis assay For gel electrophoresis assay, 100 nM template DNA, 100 nM mismatched trigger DNA and 1 mM Ag þ were firstly added into the AA-isoTexpDR reaction solution, which was then incubated at 60 1C for 7 min. After AA-isoTexpDR, the reaction mixture was monitored by using denaturing polyacrylamide gel electrophoresis (20% acrylamide, acrylamide/bisacrylamide ¼19:1, 7 M Urea). Electrophoresis was carried out in 1 TBE (pH 8.0) at 150 V constant voltages for 1.5 h. After being stained by SYBR Green, the gel was recorded by a GelDoc XR þ System (Bio-Rad).
3. Results and discussion Fig. 1 may illustrate the principle of the proposed method for the highly sensitive detection of Ag þ ions. Firstly, the template DNA is immobilized on the surface of the gold electrode via Au–S bond. Since the mismatched trigger DNA is not designed to be completely complementary to the template DNA, the hybridization cannot be achieved. Nevertheless, in the presence of Ag þ ions, the mismatched trigger DNA can transiently bind to the template DNA through the formation of C–Ag þ –C base pair, which then works as a primer to start the polymerization reaction. As the result of polymerase strand extension, a thermo-stable duplex containing a recognition site for BsaBI action is formed by the hybridization of the elongated trigger strand and template DNA strand. Then, the duplex is immediately cleaved by the restriction endonuclease, thus the two short strands resulted from the cleavage
2.3. AA-isoTexpDR protocol AA-isoTexpDR was carried out in a reaction solution containing 0.08 unit/mL Bst polymerase, 0.4 unit/mL BsaBI endonuclease, 250 mM dNTPs, 1 NE buffer 4 (50 mM KAc, 10 mM Mg(Ac)2, 20 mM Tris–HAc, pH 7.9). To perform AA-isoTexpDR, the above template DNA modified gold electrode was firstly immersed into the reaction solution which also contained 100 nM mismatched trigger DNA and desired amount of Ag þ at 60 1C for 7 min. After being thoroughly rinsed with double-distilled water, the electrode was then ready for the following electrochemical measurements. In the control experiments, 1 mM Na þ , Zn2 þ , Fe2 þ , Pb2 þ , Al3 þ or Cr6 þ instead of Ag þ were added in the reaction solution.
Fig. 1. Schematic illustration of ultra-sensitive detection of Ag þ ions via AA-isoTexpDR.
J. Zhao et al. / Biosensors and Bioelectronics 39 (2013) 183–186
of the elongated trigger strand will release from the cleaved template DNA, because the reaction temperature (60 1C) is much higher than the melting temperature of the cleaved duplex. Consequently, the mismatched trigger DNA is free again and a fully complementary trigger DNA is produced. They may both bind with other intact template DNA, and moreover, new rounds of elongation and scission with or even without the assistance of Ag þ are initiated. As the reaction cyclically occurs, the trigger DNA is exponentially amplified, while the template DNA is exponentially degraded. After the AA-isoTexpDR, the degraded template DNA immobilized on the electrode surface can be efficiently monitored with electrochemical techniques by using [Ru(NH3)6]3 þ as the signal molecules, and the ultra-sensitive detection of Ag þ ions can be realized since the degradation reaction is actually triggered by Ag þ ions. As a comparison, if other control ions instead of Ag þ ion are used, since the mismatched DNA cannot effectively bind with the template DNA to initiate AA-isoTexpDR, removal of the template DNA cannot be achieved. So, the selectivity of the detection is also highly feasible.
3.1. Studies of the degradation of template DNA by cyclic voltammetry and gel electrophoresis It has been known that electroactive molecules [Ru(NH3)6]3 þ can bind to the anionic phosphate of DNA molecules through electrostatic interaction, so the redox charges of adsorbed [Ru(NH3)6]3 þ have been demonstrated to be positively correlated with the amounts of surface confined DNA (Shen et al., 2008). In this work, by using [Ru(NH3)6]3 þ as the signaling transducer, we have firstly characterized the degradation of template DNA on the electrode surface with CV. As shown in Fig. 2, a pair of welldefined, reversible oxidation/reduction peaks can be observed with the formal potential at 0.313 V (vs. SCE), ascribing to the electrostatic binding of [Ru(NH3)6]3 þ to the immobilized template DNA on the electrode surface (Fan et al., 2012; Miao et al., 2009; Shen et al., 2012). Since the peak current is directly proportional to the amount of adsorbed [Ru(NH3)6]3 þ , representing the amount of surface immobilized DNA, it can be observed that the peak current will be decreased after the achievement of AA-isoTexpDR in the presence of 1 mM Ag þ . The reason is clear, since AA-isoTexpDR happens due to the binding of the mismatched trigger DNA to the template DNA through the formation of
Fig. 2. Cyclic voltammogram obtained at the template DNA modified gold electrode for a 10 mM Tris–HCl buffer (pH 7.4) containing 50 mM [Ru(NH3)6]3 þ (the solid line). The dotted and dashed lines are separately the curves after AAisoTexpDR in the presence and absence of 1 mM Ag þ . Scan rate: 50 mV/s. Inset is polyacrylamide gel assay of the degradation of template DNA.
185
C–Ag þ –C base pair, which thus induces the degradation of the template DNA immobilized on the electrode surface. As a result, an obvious decrease of peak current can be observed after the performance of the AA-isoTexpDR, since the amount of [Ru(NH3)6]3 þ that can be adsorbed to the cleaved template DNA is reduced. In contrast, without Ag þ being involved, nearly no change of the peaks can be observed. We have also employed polyacrylamide gel electrophoresis (PAGE) to verify the degradation of template DNA that happened in this work. As shown in the inset of Fig. 2, template DNA can be efficiently degraded via AA-isoTexpDR in the presence of 1 mM Ag þ , proven by the disappeared electrophoresis band of template DNA. Meanwhile, it can be known that no degradation happens without the participance of Ag þ ions. Therefore, both CV and PAGE studies have confirmed that degradation of the template DNA can only be initiated in the presence of Ag þ ions.
3.2. Detection of Ag þ ions with chronocoulometry Since CV technique is not sensitive enough to show the changes of the surface charge, we have further used a much more precise and sensitive technique, chronocoulometry, for the characterization of the degradation of template DNA as well as the quantitative detection of Ag þ (Lao et al., 2005; Miao et al., 2011). Fig. 3 shows the relationship between the surface charge density of the gold electrode and the concentration of Ag þ ranging from 0 to 1 mM. It can be observed that with the addition of Ag þ into the test solution, since the mismatched trigger DNA can bind with the template DNA via the formation of C–Ag þ –C base pairs, degradation of the template DNA is achieved and consequently, the amount of [Ru(NH3)6]3 þ molecules that bind to the template DNA is decreased, leading to the decrease of the surface charge density. Further studies reveal that the surface charge density decreases in an Ag þ concentration-dependent manner, and the decrease of the surface charge (DCharge) is proportional to the logarithmic concentration of Ag þ (x) from 10 pM to 100 nM (Fig. 3, inset). The regression equation is DCharge (10 6 C) ¼ 0.1216þ0.03324 log x (10 9 M), R¼0.997. Moreover, the limit of detection (LOD) can be achieved as low as 3 pM, which is not only much lower than that in the previous reports but also good enough to satisfy the detection demand of EPA (Li et al., 2009;
Fig. 3. Chronocoulometric curves obtained at the template DNA modified electrode after AA-isoTexpDR with different concentrations of Ag þ (from top to bottom: 0, 10 pM, 50 pM, 100 pM, 1 nM, 10 nM, 50 nM, 100 nM, 250 nM, 500 nM and 1 mM). Inset shows a linear relationship between DCharge and log of the concentrations of Ag þ from 10 pM to 100 nM. Error bars represent the standard deviations of three independent measurements. Buffer: 10 mM Tris–HCl buffer (pH 7.4) containing 50 mM [Ru(NH3)6]3 þ . Pulse period: 250 ms. Pulse width: 700 mV.
186
J. Zhao et al. / Biosensors and Bioelectronics 39 (2013) 183–186
based on the specific interaction of metal ions and base pairs, this proposed method may be expanded to detect more metal ions with the well-designed trigger DNA and template DNA. Therefore, we expect our method may have potential use in ion detection as well as environmental monitoring in the future.
Acknowledgments This work is supported by the National Science Fund for Distinguished Young Scholars (Grant no. 20925520), and the Leading Academic Discipline Project of Shanghai Municipal Education Commission (J50108).
Fig. 4. The surface charges obtained in the presence of different metal ions. The concentrations of the metal ions are 1 mM.
Trnkovaa et al., 2011). Certainly, a better LOD cannot be obtained, since the cleaved template DNA that remained on the electrode surface may still bind with [Ru(NH3)6]3 þ to induce background signal, which limits the improvement of the sensitivity. Nevertheless, this is a lowest LOD to the best of our knowledge. The relative standard deviation for series of repetitive measurements with different concentrations of Ag þ may all be within 10%, so the reproducibility of the detection can be also satisfactory. Besides, since the template DNA modified electrode can be stored in a refrigerator without significant loss of electrochemical responses for at least one week, the stability of our method is also quite well. 3.3. The specificity of the detection To examine the selectivity of this method, some control metal ions have been used for this study. As shown in Fig. 4, nearly no evident change of the surface charge can be observed when Na þ , Zn2 þ , Fe2 þ , Pb2 þ , Al3 þ or Cr6 þ are employed, while the surface charge decreased significantly if Ag þ is used. Therefore, the control experiments have not only confirmed the important role of the formation of C–Ag þ –C in the proposed method for Ag þ ion detection, but also assured the high specificity of the method. Moreover, since 7 min has been demonstrated to be sufficient for the degradation of template DNA without the interference from the non-specific background degradation, the performance is quite fast, which is totally no more than 10 min.
4. Conclusions In conclusion, we have proposed an ultra-sensitive and easilyoperated electrochemical method for selective detection of Ag þ ions by using Ag þ -assisted isothermal exponential degradation reaction. With the formation of C–Ag þ –C base pair, mismatched trigger DNA can efficiently initiate the polymerase strand extension and the subsequent strand cleavage by binding to the template DNA that has been previously immobilized on an electrode surface. Degradation of the template DNA may result in significant decrease of electrochemical signal, so Ag þ ions can be ultra-sensitively detected at pM level. The detection can also be highly selective, since only Ag þ instead of other ions can bind with the template DNA to form C–Ag þ –C pair. On the other hand,
References Bhardwaj, V.K., Singh, N., Hundal, M.S., Hundal, G., 2006. Tetrahedron 62 (33), 7878–7886. Chang, C.C., Lin, S., Wei, S.C., Chu-Su, Y., Lin, C.W., 2012. Analytical and Bioanalytical Chemistry 402 (9), 2827–2835. Clever, G.H., Kaul, C., Carell, T., 2007. Angewandte Chemie-International Edition 46 (33), 6226–6236. Dadfarnia, S., Shabani, A.M.H., Gohari, M., 2004. Talanta 64 (3), 682–687. Fan, Q., Zhao, J., Li, H., Zhu, L., Li, G.X., 2012. Biosensors and Bioelectronics 33 (1), 211–215. Freeman, R., Finder, T., Willner, I., 2009. Angewandte Chemie (International Edition in English) 48 (42), 7818–7821. Giljohann, D.A., Mirkin, C.A., 2009. Nature 462 (7272), 461–464. Iyoshi, S., Taki, M., Yamamoto, Y., 2008. Inorganic Chemistry 47 (10), 3946–3948. Lai, C.Z., Fierke, M.A., da Costa, R.C., Gladysz, J.A., Stein, A., Buhlmann, P., 2010. Analytical Chemistry 82 (18), 7634–7640. Lao, R.J., Song, S.P., Wu, H.P., Wang, L.H., Zhang, Z.Z., He, L., Fan, C.H., 2005. Analytical Chemistry 77 (19), 6475–6480. Li, H.L., Zhai, J.F., Sun, X.P., 2011. Langmuir 27 (8), 4305–4308. Li, T., Shi, L.L., Wang, E., Dong, S.J., 2009. Chemistry – A European Journal 15 (14), 3347–3350. Lin, Y.H., Tseng, W.L., 2009. Chemical Communications 45 (43), 6619–6621. Liu, J.F., Chao, J.B., Liu, R., Tan, Z.Q., Yin, Y.G., Wu, Y., Jiang, G.B., 2009. Analytical Chemistry 81 (15), 6496–6502. Miao, P., Liu, L., Li, Y., Li, G.X., 2009. Electrochemistry Communications 11 (10), 1904–1907. Miao, P., Ning, L.M., Li, X.X., Shu, Y.Q., Li, G.X., 2011. Biosensors and Bioelectronics 27 (1), 178–182. Ono, A., Cao, S., Togashi, H., Tashiro, M., Fujimoto, T., Machinami, T., Oda, S., Miyake, Y., Okamoto, I., Tanaka, Y., 2008. Chemical Communications 44 (39), 4825–4827. Ono, A., Torigoe, H., Tanaka, Y., Okamoto, I., 2011. Chemical Society Reviews 40 (12), 5855–5866. Park, K.S., Jung, C., Park, H.G., 2010. Angewandte Chemie-International Edition 49 (50), 9757–9760. Ratte, H.T., 1999. Environmental Toxicology and Chemistry 18 (1), 89–108. Resano, M., Aramendia, M., Ruiz, E.G., Crespo, C., Belarra, M.A., 2006. Analytica Chimica Acta 571 (1), 142–149. Shen, L., Chen, Z., Li, Y., He, S., Xie, S., Xu, X., Liang, Z., Meng, X., Li, Q., Zhu, Z., Li, M., Le, X.C., Shao, Y., 2008. Analytical Chemistry 80 (16), 6323–6328. Shen, M., Yang, M., Li, H., Liang, Z.Q., Li, G.X., 2012. Electrochimica Acta 60, 309–313. Steel, A.B., Herne, T.M., Tarlov, M.J., 1998. Analytical Chemistry 70, 4670–4677. Trnkovaa, L., Krizkovab, S., Adamb, V., Hubalekc, J., Kizek, R., 2011. Biosensors and Bioelectronics 26 (5), 2201–2207. Urata, H., Yamaguchi, E., Funai, T., Matsumura, Y., Wada, S., 2010. Angewandte Chemie-International Edition 49 (37), 6516–6519. Van Ness, J., Van Ness, L.K., Galas, D.J., 2003. Proceedings of the National Academy of Sciences of the United States of America 100 (8), 4504–4509. Wygladacz, K., Radu, A., Xu, C., Qin, Y., Bakker, E., 2005. Analytical Chemistry 77 (15), 4706–4712. Zhang, T., Chai, Y.Q., Yuan, R., Guo, J.X., 2012. Analytical Methods 4 (2), 454–459. Zhao, J., Liu, T., Fan, Q., Li, G.X., 2011. Chemical Communications 47 (18), 5262–5264. Zhou, X.H., Kong, D.M., Shen, H.X., 2010. Analytica Chimica Acta 678 (1), 124–127. Zhu, Z.Q., Su, Y.Y., Li, J., Li, D., Zhang, J., Song, S.P., Zhao, Y., Li, G.X., Fan, C.H., 2009. Analytical Chemistry 81 (18), 7660–7666.