Ultrasensitive, recyclable and portable microfluidic surface-enhanced raman scattering (SERS) biosensor for uranyl ions detection

Journal Pre-proof Ultrasensitive, recyclable and portable microfluidic surface-enhanced Raman scattering (SERS) biosensor for uranyl ions detection Xuan He, Xin Zhou, Yu Liu, XiaoLin Wang

PII:

S0925-4005(20)30023-X

DOI:

https://doi.org/10.1016/j.snb.2020.127676

Reference:

SNB 127676

To appear in:

Sensors and Actuators: B. Chemical

Received Date:

13 October 2019

Revised Date:

19 December 2019

Accepted Date:

5 January 2020

Please cite this article as: He X, Zhou X, Liu Y, Wang X, Ultrasensitive, recyclable and portable microfluidic surface-enhanced Raman scattering (SERS) biosensor for uranyl ions detection, Sensors and Actuators: B. Chemical (2020), doi: https://doi.org/10.1016/j.snb.2020.127676

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier.

Ultrasensitive, recyclable and portable microfluidic surface-enhanced Raman scattering (SERS) biosensor for uranyl ions detection Xuan He 1,2, Xin Zhou2, Yu Liu2, & XiaoLin Wang1,3*

1

College of Chemistry, Sichuan University, Chengdu 610064, People’s Republic of

China. 2

Institute of Chemical Materials, China Academy of Engineering Physics, Mianyang

621900, China. 3

China Academy of Engineering Physics, Mianyang 621900, China.

na

lP

re

-p

Graphical abstract

ro of

Corresponding Author: [email protected];

The ultra-sensitive, efficient, and recyclable trace analysis of UO22+ ions in water

ur

using a surface enhanced Raman scattering (SERS)-based microfluidic biosensor was reported. And this biosensor has a certain application prospect in the field of nuclear

Jo

emergency scenario.

Highlights: 

A portable and ultrasensitive, recyclable SERS-based microfluidic biosensor was firstly reported for trace UO22+ ions detection.



The novel designed UO22+-specific response DNAzyme bioprobe greatly improved the detection efficiency by shorten the cleavage-reaction time.



Highly ordered ZnO-Ag arrays as rigid SERS substrates in microfluidic device, which construct by flexible transferred templates, ensured ultrasensitivity and reproducibility.

Abstract: Sensitive, fast and reliable detection of UO22+ ions is of great significance in nuclear industry and environment protection, due to the serious threats of UO22+ ions to human health. However, such suitable sensor is still rare. Herein, an ultrasensitive and

ro of

recyclable SERS-microfluidic biosensor with specific UO22+ response has been developed. Aptamer-modified ZnO-Ag hybrids arrays was firstly designed and

utilized as highly functional sensor by colloidal crystals templating method. The

relationship between aptamers (different types, length and reaction time) and UO22+

-p

ions was fully screened to improve the detection efficiency. In the absence of UO22+,

Rhodamine B (RhB)-labeled double-stranded DNA formed a rigid structure, and weak Raman signals were detected. After pumping the UO22+ solution into microdevice,

re

DNAzyme-cleavage reaction was triggered. And RhB-modified 5’-single DNA strand (cleavage production) dropped down to the surface of SERS substrates, leading to

lP

strong Raman signals. After signal amplification, the detection limit of UO22+ achieved as low as 7.2×10-13 M, which is nearly five orders below the EPA-defined maximum contaminant level. More importantly, the specially designed microfluidic

na

device could be reused and refreshed by supplementation of substrate strands DNA for three times. A further application to determine UO22+ ions in natural real systems

ur

such as tap water and river water was also complied with good recoveries and RSDs. This SERS-based microfluidic sensor shows great potential for in-the-field sensing platforms, due to its ultra-sensitivity, high efficiency, and portability.

Jo

Keywords: Surface-enhanced Raman scattering (SERS), DNAzyme, Microfluidic, Recyclable trace analysis, UO22+ ions

1. Introduction Uranium is a very important nuclear element for civil and military fields.[1-2] However, uranium exposure is the most serious economic and environmental issue that could lead to terrible harm due to its long-lived radioactivity and chemical toxicity.[3-4] The most common and stable chemical form of uranium in natural

aqueous environments is uranyl ion (UO22+), which has good biocompatibility and easily combinate with different organs, like liver, and kidney.[5] Moreover, UO22+ is radioactive and therefore non-biometabolism. Even a tiny amount of UO22+ can cause detrimental effects on human health due to the long-term accumulation in the human body.[6-7] Although some organic ligands (such as sulfonated salophen, and cyclodextrin) have been utilized as chemical sensors for UO22+, there are also limitations in the practical applications of chelators owing to their low sensitivity and selectivity.[8-9] Therefore, ultrasensitive and highly selective detection of trace UO22+ is highly desirable, but it still in the developing stage. Therefore, numerous attentions have been paid to DNA reagents which can

ro of

specifically respond to UO22+ ions. DNAzymes with catalytic activity, has been found that its secondary structure can specifically recognize metal ions triggering the

DNA/RNA self-cleavage reactions reversibly happened at the cleavage site.[10-11] This unique reaction provides a good opportunity for metal detection. Moreover,

-p

different kinds of DNAzymes which were elegantly tailored by Lu and Yang, were specific response to different metal ions, such as Pb2+, Hg2+, Cu2+, UO22+.[12-16]

re

Among them, DNAzyme-based sensors have been expanded into a variety of signal transduction strategies, including colorimetry, fluorescence and electrochemistry, to

lP

detect UO22+.[17-21] However, most of them showed only moderate sensitivity. In addition, the reported technology still relied on laboratory operation and large-scale equipment, which were unable to carry out an on-site emergency scenario.

na

Surface-enhanced Raman spectroscopy (SERS) holds great potential as a nextgeneration detection strategy owning to its miniaturized instruments, ultra-fast detection speed, and ultra-sensitive detection capabilities.[22-24] SERS has

ur

ultrasensitive detection ability, and gradient microfluidic platforms offered merits in micro-volume biological reactions and high-throughput screening.[25] Therefore,

Jo

integration of SERS with microfluidic gradient platforms provides wide application in chemical or biological on-site analysis.[26] Nevertheless, SERS-microfluidic devices have seldom been reported for UO22+ analysis.[27] Besides, in past reports, SERSbased DNAzyme biosensor did not show desirable sensing effect due to the limitation of DNAzyme probes, such as long annealing time and one-time used problem. Consequently, designing effective DNA probe and applying them to SERSmicrofluidic devices are the key points to realize rapid and sensitive on-site detection of UO22+ ions.

Generally, SERS active materials were typically bonded in-situ to the microfluidic channel, resulting in the entire SERS-microfluidic sensor being used for only once. [2829]

The deposition of nanoparticle aggregates of liquid SERS substrates often induces

the “memory effect” on channel surfaces, affecting both sensitivity and reproducibility. Moreover, semiconductor–noble-metal nanocomposites induced much higher SERS effects than single noble metals, because their enhancement effect were constructed by both the chemical and the electromagnetic effects owing to the semiconductor support. But there is no report on the application of semiconductor–noblemetal nanocomposites in SERS-microfluidic system. To overcome these limitations, we proposed reusable aptamer modified sea urchin

ro of

ZnO-Ag arrays as rigid SERS biochip, and put it in the special designed “open-close” microfluidic device. This microfluidic device combined reaction and detection in the same place. With the help of monolayer colloidal crystal template technique, the

flexibility and controllable sea urchin ZnO-Ag hybrids micro/nanostructures arrays

-p

had been fabricated as rigid SERS substrates ensured highly sensitivity and

reproducibility. Meanwhile, DNAzyme bioprobes modified on sea urchin ZnO-Ag

re

hybrids could amplify signal again and held specificity of UO22+ ions detection. By screening the reaction conditions between the probes and uranyl ions, the designed

lP

DNAzyme bioprobes greatly improved the detection efficiency. In addition to its portability and high sensitivity, this biosensor could be reused more than three times by supplementation of DNAzyme substrate strands and rewashing microfluidic

na

devices. New SERS-based microfluidic biosensor holds great ability for ultrasensitive and efficient detection for natural samples, such as UO22+ ions spiked tap water and river water. All the experiments show that this method has a certain application

ur

prospect in the field of nuclear emergency scenario.

Jo

2. Experimental details 2.1 Preparation of sea urchin ZnO-Ag arrays hybrids SERS substrates The fabrication processes for sea urchin ZnO-Ag arrays hybrids SERS substrates were illustrated in Scheme S1 in Supporting Information. First, the poly-styrene (PS) nanosphere was prepared as template,[30] and then Zn seeds were deposited of 2 min by a radio frequency (RF) magnetron sputtering. Zinc nitrate hexahydrate [Zn(NO3)26H2O] and methenamine [C6H12N4] (mixed with 1:1 ) were prepared the pre-solution at the concentrations of 0.1 M. The solution was stirred by 2 h for

mixture thoroughly and Zn-seeds on polystyrene (PS) nanospheres quartz sheets were immersed in the solution, reacted at 95 oC for 5h in a water bath. Subsequently, Ag nanoparticles were sputtered by magnetron sputtering to construct sea-urchin shaped ZnO-Ag nanocomposites substrates. 2.2 DNAzyme modified of SERS biochip Three different kinds of enzyme strand solution (pH 6.88) was dropped onto the ZnOAg hybrid substrates for 12h. Then, the RhB-enzyme strand-SH was self-assembled as a single molecule monolayer on the surface of Ag NPs. Afterwards, the selfassemble enzyme strand was hybridized with single substrate strand for 12h at 37oC

ro of

to establish the ds-DNA structure. Then, PBS buffer (pH 6.88) was used for washing

the excess DNA solution away. And the concentration of DNA aptamers, the length of

re

-p

DNA strand had been strictly controlled in the fabrication of SERS biochips.

Polystyrene transfered

ZnO-Ag hybrids sea urchin arrays

lP

Monolayer colloidal crytals templates

ur

na

Signal on

SERS-Microfluidic device for UO22+ detection

DNAzyme bioprobes modified on arrays

Jo

38.6 mm

Scheme 1. Schematic illustration of the principle and design of the UO22+ ions sensor based on the SERS-based microfluidic device. 2.3 Regeneration and reusing of ZnO-Ag arrays hybrids SERS biochips After the DNAzyme-cleavage reaction with UO22+ ions, the resultant ZnO-Ag arrays hybrids SERS biochips was subsequently rinsed with 100mM PBS buffer for 5 times to remove the free DNA strands and UO22+ ions. After that, the biochips were sunk in

the solution containing the supplementation of SS10 and incubated with PBS buffer (pH 6.88 containing 0.1M NaCl) for 12h at 37oC to contribute a new double DNA structure.[31] Wash the chips with PBS buffer solution to remove residual DNA. Then, reusing this afresh biochips carried UO22+ ions detection experiments. 2.4 Detection of UO22+ ions by SERS-based microfluidic device in natural systems. Different concentrations of UO22+ ions were injected into the microfluidic device for 60 min at room temperature then detected by a Raman microscope equipped spectrum with a 532 nm laser. Other 15 interfering ions solution like (Pb2+, Th4+, Ag+, Mg2+,

using the efficient SERS-based microfluidic device.

ro of

Ca2+, Ba2+, Mn2+, Fe2+, Fe3+, Co2+, Ni2+, Cu2+, Zn2+, Cd2+, Hg2+) were also detected Following, to simulate the real water samples detection which contaminated by UO22+ ions, river water and tap water were fetched and filtered through Millipore filters

(0.22μm). Then, the UO22+ ions spiked in river water and tap water with different

-p

concentrations were dropped on the SERS-based microfluidic device for 60 min

re

reaction.

Table 1. Sequence information for the bioprobes used in this study

Double-stranded

HS-(CH2)6CACGTCCATCTCTGCAGTCGGGTAGTTAAACCG ACCTTCAGACATAGTGAGT-RhB (ES0)

na

DNA-0 (dsDNA0)

lP

Sequences (5’-3’)

Name

ACTCACTATrAGGAAGAGATGGACGTG (SS0)

Double-stranded

Jo

ur

DNA-5 (dsDNA5)

Double-stranded DNA-10 (dsDNA10)

HS-(CH2)6CACGTCCATCTCTGCAGTCGGGTAGTTAAACCG ACCTTCAGACATAGTGAGTTTAAG-RhB (ES5) CTTAAACTCACTATrAGGAAGAGATGGACGTG (SS5) HS-(CH2)6CACGTCCATCTCTGCAGTCGGGTAGTTAAACCG ACCTTCAGACATAGTGAGTTTAAGGGTTC-RhB (ES10) GAACCCTTAAACTCACTATrAGGAAGAGATGGA CGTG (SS10)

Double-stranded

HS-(CH2)6CACGTCCATCTCTGCAGTCGGGTAGTTAAACCG

DNA-15 (dsDNA15)

ACCTTCAGACATAGTGAGTTTAAGGGTTCCCAA G-RhB (ES15) GAACCCTTAAGTTGGACTCACTATrAGGAAGAG ATGGACGTG (SS15)

3. Results and discussion 3.1 Working principle of the SERS-based microfluidic device As shown in Scheme 1 and Figure S1, monolayer colloidal crystals were transferred as templates under circular quartz sheets (Figure S2), then highly ordered ZnO-Ag

ro of

hybrids arrays prepared based on the templates to obtain SERS substrates (Figure S3). Then, DNA probes were modified on the SERS substrates constructed as SERS

biochips, which was placed in liquid cell to build a SERS-microfluidic biodevice for UO22+ ions detection. The design of microfluidic device is simple, practical and low cost. The whole device can be reused three times by simply cleaning with PBS

na

lP

re

-p

solution.

ur

Figure 1. (a) FE-SEM of sea urchin ZnO arrays; (b) the enlarged FE-SEM of the left image; (c) the enlarged FE-SEM of (b); (d) FE-SEM image of sea urchin ZnO-Ag

Jo

arrays; (e) the HR-TEM images of (d). Next, from bioprobe design of view, SERS bioprobes for UO22+ ions analysis were constructed with double-stranded DNA-0 (dsDNA0), which was composed of UO22+ ions-specific DNAzyme strand (RhB-ES0-SH) and corresponding substrate strand (SS0). Among them, the HS- group and a Raman reporter RhB were conjugated to the 5’ and 3’ ends of ES0, respectively. The complementary DNA chain (SS0) was hybridized with the above DNAzyme to form a ds-DNA in Table 1. In the absence of

UO22+ ions, RhB labeled at one end of the enzyme strand kept far from the hybrid

（b）

（c）

（d）

re

-p

（a）

ro of

SERS

Figure 2 Biosensor screening: (a) Stem length of enzyme stranded; (b) Concentrations

lP

of ds-DNA10 bioprobe; (c) Reaction time of ds-DNA10 between UO22+ ions at concentration of 10-8 M; (d) Corresponding Raman intensities of 1650 cm-1 were collected at 5 min intervals in the presence of UO22+ ions at different concentrations.

na

substrate, and the Raman signal was very weak due to the rigid structure of the dsDNA0. By contrary, DNAzyme-cleavage reaction would happen in the presence of UO22+ ions via the complexation reaction. [32-34] And the rigid dsDNA-0 structures

single

ur

would be split into flexible single-stranded structure. Then, the RhB-modified 5’-

Jo

DNA strand would drop down to the ZnO-Ag substrates, producing strong Raman signals. And the change of Raman intensity clearly depended on the UO22+ concentration. According to this principle, the UO22+ ions could be quantitatively detected by using the calibration curves. The DNAzyme bioprobe can also be replaced by DNA responsive hydrogel, or antigen-antibody sequence to generate large amounts of signaling molecules for a variety of readout devices, such as a gluocometer, electrochemical device and fluorescent device etc.

3.2 Structural and morphological characterizations of sea urchin ZnO-Ag arrays hybrids SERS substrates One of the significant points for the reliable rapid and sensitive SERS detection of UO22+ ions is the fabrication of uniform and highly sensitive SERS substrates. In this work, the preparing details of sea urchin ZnO-Ag arrays hybrids SERS substrates were elaborated in experimental part and Scheme S1.[30] SEM experiments were utilized to investigate the morphologies of these substrates (Figure 1 and Figure S4S6). The diameter of each sea urchin was about 2 μm. And the length of each ZnO nanorod was

ro of

about 2 μm, on which Ag nanoparticles with a diameter of about 10 nm were attached. The TEM and XRD experiments confirmed that in the ZnO-Ag composite structures, the ZnO surface corresponded to the (001) crystal plane and the Ag surface

corresponded to the (111) crystal plane. (Figure 1 and Supporting Information Figure S7).

-p

Next, the highly sensitive ability was proved by the SERS measurements because the detection limit was about 10-12 M for Raman probe 4-ATP (see Supporting

re

Information Figure S8-S9). The enhancement factor (EF) was calculated about 1.12×108 (Figure S10). [35-36] The Raman mapping experiment was carried out to

lP

ensure the reproducibility of SERS substrates within a 180 ×120 µm2(see Supporting Information Figure S11). These experiments showed that the sea urchin ZnO-Ag arrays hybrids SERS substrates owned outstanding sensitivity and stability, which

na

possessed a certain practical application potential. [37-38]

ur

3.3 Effect of biosensor screening on UO22+ ions detection; After verifying the ultrasensitivity and reproducibility of the sea urchin ZnO-Ag arrays hybrids substrates, the next step is the biosensor screening. Ensure to achieve a

Jo

better performance, the detection conditions were optimized in the following work, such as stem length of enzyme stranded, concentrations of ds-DNA bioprobe, the reaction time with UO22+ ions. Other parameters were fixed and only one condition was changed for each optimization. First, the stem length of cleavage flexible structure of enzyme strand related to finally impacts the sensitivity of our strategy. Several enzyme strands with different stem length had been investigated. As shown in Figure 2a and Table 1, ES10 (10 base pairs more than ES0) was superior to ES5 (5 base pairs more than ES0) in detecting UO22+ ions. ES15 (15 base pairs more than

ES0) was less sensitive to UO22+ ions than ES10. The reason would be following: because of the rigid structure of ds-DNA, the Raman reporter of RhB labeled at one end of the enzyme strand kept more than about 13 nm away from the SERS substrate, resulting in a feeble Raman signal. The shorter stem ES0 and ES5 were much easier to cause high background of noise for sensing. In the presence of UO22+ ions, RhB was close to the SERS substrate because of flexible structure of enzyme strand. And the longer stem of ES15 was more flexible, but also promoted to mismatches, which made little help to enhance sensitivity. Next, concentrations of ds-DNA-10 bioprobe modified on substrates were

ro of

optimized in the presence of 10nM UO22+ ions (Figure 2b). The signal of RhB reporter increased slowly with DNA concentration from 0.01mM to 0.05mM, but it

decreased at relatively high DNA concentration at 0.1mM. Affluent concentration of

ds-DNA ensured a uniformity single-molecule probe layer on the substrate, and could increase the sensitivity. However, with the increase of concentration, the adsorptive

-p

density of single-molecule DNA probe layer was fixed. And when the flexible enzyme strand fell, it would be entangled with the dense chains around it. It was difficult to

re

obtain Raman signals directly due to the far distance from substrate surface. So, the sensitivity was reduced. In all , the preferred concentration of ds-DNA was selected as

lP

0.05mM in our experiment.

At last, the reaction time of DNAzyme was optimized in the presence of 100nM UO22+ ions. Raman signal increased slowly with time and leveled off at 30 min, which

na

was identical with the saturated state. Other different concentrations of UO22+ ions (0, 1×10-12 M, 1×10-11 M, 1×10-10 M, 1×10-9 M, and 1×10-8 M) were also investigated to explore the relationship between reaction time and UO22+ ions

ur

concentrations. The kinetic experiments displayed in Figure 2c-d which contained the reaction time versus Raman intensity of 1650 cm-1 in the presence of UO22+ ions.

Jo

Obviously, with the UO22+ ions concentration increasing, the time to achieve steadystate was gradually shortened. According to the literature report, the DNAzyme cleavage reaction was highly efficient and normally completed within 5 min. As illustrated in Scheme 1, there were three steps in our detection process. Firstly, UO22+ ions attacked substrate strands. Second, the substrate strand cleaved into two fragments from the DNAzyme. Following, because of flexible structure of enzyme strand, RhB was close to the SERS substrate resulted in significant Raman signals.

So, the third step might cause longer cleavage reaction time because it’s a ratelimiting process. Finally, 60min was selected as the best reaction time to ensure a sufficient reaction.

（b）

ro of

（a）

Figure 3 (a) SERS responses of RhB collected from SERS-based microfluidic device with increasing concentration of UO22+ ions 10-12 M to 10-7 M; (b) the inset provided

-p

the dynamic range of the SERS-based microfluidic device for UO22+ ions detection. 3.4 Sensitive and selective UO22+ ions detection by using SERS-based

re

microfluidic device

Under optimal conditions, in order to evaluate the response range and sensitivity, the

lP

identification of UO22+ ions from the distilled water samples was first investigated to validate the application feasibility of SERS-based microfluidic device. Figure 3a displayed a series of Raman spectra of RhB when the concentration of UO22+ ions

na

ranging from 10-12 M to 10-7 M. Raman intensity of RhB at 1650 cm-1 gradually increased along with the increase of UO22+ ions concentration. And the increasing of

Jo

ur

Raman spectroscopy could be attributed to the narrowing distance between RhB and

ro of

Figure 4. Selective UO22+ ions detection by using the SERS-based microfluidic device. Other comparison metal ions were listed on the X-axis and their

corresponding RhB 1650 cm-1 band intensities were shown on the Y-axis. Different

-p

concentrations were shown by different color bars.

re

Table 2. Recovery studies of natural samples spiked with three levels of UO22+ ions concentrations (n = 3) Sample

Spiked UO22+ (M)

Measured ± SDa (M)

Tap water 1

10-8

Tap water 2

10-9

(1.057±0.039)×10-9

105.7

3.6

(0.976±0.065)×10-10

97.6

5.4

River water 1 10-8

(1.061±0.049)×10-8

106.1

5.1

River water 2 10-9

(1.075±0.065) ×10-9

107.5

3.9

River water 3 10-10

(0.984±0.058) ×10-10

98.4

6.1

na

3.1

Measured concentration of three replicates ± standard deviation(M); bMean

Jo

a

10-10

ur

Tap water 3

lP

RSD (%)

(1.082±0.043)×10-8

Mean Recovery (%)b 108.2

recovery (%) = 100 × (cmean measured/ cspiked). Ag NPs. Meantime, the corresponding regression equation between Logarithm of

concentration and Raman intensity showed in Figure 3b. The limit of detection(LOD) was as low as 7.2×10-13 M, which was nearly five orders of magnitude lower than the value prescribed by the U. S. EPA in drinking water (130 nM for UO22+ ions).[39-42] This is also the most sensitive biosensor for UO22+ ions detection reported so far (See

comparison of analytical method for UO22+ ion detection from years 2015 to present in Table S1 supporting information).

(a)

Wash DS10

Signal on

Rehybridization

Signal off

UO22+ Recycling detection

(b)

re

-p

ro of

(c)

lP

Figure 5 (a) Schematic illustration of the recycling detection; (b) Corresponding Raman intensities of 1650 cm-1 when the SERS chip was recycling in the detection of

detection.

na

UO22+ ions (10-9 M) for three times; (c) SERS spectra of RhB in recycling UO22+ ions Following, the selectivity of our SERS-based microfluidic device for UO22+ ions

ur

was considered by parallelly detecting 15 kinds of interfering metal ions (Pb2+, Th4+, Ag+, Mg2+, Ca2+, Ba2+, Mn2+, Fe2+, Fe3+, Co2+, Ni2+, Cu2+, Zn2+, Cd2+, Hg2+) at two different level concentrations (10μM, and 100μM), respectively. Relatively, the

Jo

concentrations of UO22+ ions were only 1nM and 10nM. As shown in Figure 4, in the presence of UO22+ ions, obvious SERS signals were obtained at very low concentrations of 1nM and 10nM (Figure 4 black and red stripes). The SERS intensity of other metal ions was much weaker, even at a very high concentration (blue and green bars in Figure 4). Remarkably, obvious signal response was obtained for UO22+ ions in comparison to other interfering groups, which manifested that our SERSmicrofluidic biodevice could specifically distinguish UO22+ ions from interfering

metal ions. 3.5 Analysis of UO22+ ions in real samples by SERS-based microfluidic device With this ultrasensitive good selective SERS-microfluidic device in hand, the next goal was explored for analyzing of UO22+ ions in real samples. Different concentrations of UO22+ ions were initially spiked into tap water and river water. And these samples were diluted to the linear range and then inspected using SERS-based microfluidic biodevice. Recovery detection was carried out by adding a known amount of UO22+ ions to samples and results were displayed in Table 2. The

ro of

recoveries and RSDs were range from 97.6 to 108.2% and 3.1% to 6.1%, respectively. All the experiments clearly demonstrated the biosensor had potential for analytical application in real samples.

-p

3.6 Recyclable detection for UO22+ ions by using SERS-based microfluidic device In previous reports, it should be noted that all of SERS sensors for UO22+ ions detection cannot be cyclically used in the previous study. [37, 44] However, the

re

cyclically used DNA probe could decrease the detection cost, and accelerated the popularization and application of the biosensor. Hence it was highly desirable for

lP

fabrication a recyclable UO22+ ions SERS biosensor. In addition, the part of the microfluidic chip should also be recyclable through simple channel flushing. In our design, in the presence of UO22+ ions, the substrate DNA strand (ES10) was cleaved

na

into two free DNA strands by the RhB-terminated DNAzyme connected to the surface of ZnO-Ag arrays SERS substrates (Figure 5a). In this case, Raman reporter RhB was

ur

absorbed on the SERS surface and represented very strong SERS signals. After reacted with UO22+ ions firstly, microfluidic devices and SERS substrates were

Jo

flushed with buffer solution. Then, supplementation strand DNA (SS10) was used to rehybridize between RhB-ES10-SH, and regenerated the new dsDNA10 bioprobe. As a result, because the rigid ds-DNA10 structure caused the RhB far away from the SERS substrate surface, then the Raman signal decreased significantly. In the process of recycling, SERS signal enhanced obviously when adding UO22+ ions at 0.1nM. Then, after regenerating the new SS10 bioprobe, SERS signal rapidly descended to a state close to the background signal (Figure 5b-c). It was remarkable that our biosensor could display three cycles performance of UO22+ ions detection with the

good reproducibility by only 9.07% SERS intensity losing (1650cm-1). All the regenerating reaction and UO22+ ions detection was performed in microfluidic chips.

4. Conclusions In summary, an effective SERS-microfluidic biodevice has been successfully developed for ultrasensitive, selective and recyclable detection of UO22+ ions in real systems. Combining the transferable colloidal crystal template array with the UO22+ ions specific DNAzyme modification, the limits of detection UO22+ ions was down to 7.2×10-13 M. It was well below the maximum contamination levels defined by the US EPA in drinking water (130 nM). And an excellent specificity on UO22+ ions against

ro of

other 15 interfering metal ions had also been proved. Moreover, the biodevice

featured good recyclability after three cycles with only 9.07 % SERS intensity losing. It was worth mentioning that three natural samples spiked with different

concentrations of UO22+ ions could be detected with desirable recoveries (ranging

-p

from 97.6 to 108.2%). This work is expected to open a new avenue for preparation of transferable highly ordered arrays and DNAzyme modified SERS substrates as ions pollution, such as UO22+ ions.

re

recyclable SERS-microfluidic biodevice for ultrasensitive detection of heavy metal

5. Acknowledgements

lP

Declaration of Interest Statement We have no declaration of interest statement with other people or group.

na

Xuan appreciated Pu Huang for his kindly discussion and help. This work was supported by the Science Challenge Project (TZ201804), and the National Natural

ur

Science Foundation of China (21502179).

Jo

6. References

1. W. Briner, Int. J. Environ. Res. Public Health 7(2010) 303-313; 2. A. Bleise, P. R. Danesi, W. Burkart, J. Environ. Radioact. 64 (2003) 93-112; 3. P. C. Burns, Can. Mineral. 43 (2005) 1839-1894; 4. P. C. Burns,R. C. Ewing, F. C. Hawthorne, Can. Mineral. 35 (1997) 1551-1570; 5. P. C. Burns, M. L. Miller, R. C. Ewing, Can. Mineral. 34 (1996) 845-880; 6. J. L. Domingo, Reprod. Toxicol. 15 (2001) 603-609; 7. D. Brugge,V. Buchner, Rev. Environ. Health 26 (2011) 231-249;

8. Z. Jiang and X. Liu, Adv. Mater. Res. 1095(2015) 341-344; 9. L. Li, Y. Zhang, X. Li, S.Shen, H. Huang, Y. Bai, H. Liu, Electrophoresis. 37(2016) 2567-2573; 10. Y. Xiang, Y. Lu, Nature Chem., 3 (2011) 697-703; 11. J. Liu et al. Proc. Natl. Acad. Sci. USA 104 (2007) 2056-2061; 12. Y. Shi, H. Wang, X. Jiang, B. Sun, B. Song, Y. Su, Y. He, Anal. Chem. 88 (2016) 3723-3729; 13. Y. S. Huang, Y. L. Ma, Y. H. Chen, X. M. Wu, L. T. Fang, Z. Zhu, C. Y. Yang, Anal. Chem. 86 (2014) 11434-11439;

ro of

14. H. X. Lin, Y. Zou, Y. S. Huang, J. Chen, W. Zhang, Z. Zhuang, G. Jenkins, C. Y. Yang, Chem. Commun. 47 (2011) 9312-9314;

15. J. Liu, D. Mazumdar, Y. Lu, Angew. Chem. Int. Ed. 45 (2006) 7955-7959; 16. V. Kumar, S.P. Anthony, Sens. Actuators B 191 (2014) 31–36;

17. Y. Huang, L. Fang, Z. Zhu, Y. Ma, L. Zhou, X. Chen, D. Xu, C. Y. Yang Biosens

-p

Bioelectron, 85 (2016) 496–502;

18. L. Hu, X. W. Yan, Q. Li, X. J. Zhang, D. Shan, J. Hazard Mater., 329 (2017) 205-

re

210;

19. R. Ziółkowski, Ł. M. Górski, E. Linowska, Sens Actuators B-Chem, 238 (2017)

lP

540–547;

20. W. Yun, H. Wu, X. Liu, H. Zhong, M. Fu, L. Yang, Y. Huang, Sens Actuators BChem, 255 (2018) 1920-1926;

na

21. M. H. Li, Y. S. Wang, J. X. Cao, S. H. Chen, X. Tang, X. F. Wang, Y. F. Zhu, Y. Q. Huang Biosens Bioelectron, 72 (2015) 294-299; 22. A. Moeinian, F. N. Gür, J. Gonzalez-Torres, L. Zhou, V. D. Murugesan, A. D.

ur

Dashtestani, H. Guo, T. L. Schmidt, S. Strehle, Nano letters, 19 (2019) 1061-1066; 23. B. Sharma, R. R. Frontiera, A. I. Henry, E. Ringe, R. P. Van Duyne, Materials

Jo

Today, 15 (2012) 16-25;

24. S. Schlücker, Angew. Chem. Int. Ed. 53 (2014) 4756-4795;



25. Y. Song, B. Lin, T. Tian, X. Xu, W. Wang, Q. Ruan, J. Guo, Z. Zhu, C. Y. Yang, Anal. Chem.91 (2019) 388-404; 26. P. Agrawal, and K. D. Dorfman, Lab Chip, 19 (2019) 281-290; 27. X. He, S. Wang, Y. Liu, X. L. Wang, Sci China Chem, 8 (2019) 1064-1071;

28. C. Fu, Y. Wang, G. Chen, L. Yang, S. Xu, W. Xu, Anal Chem, 87 (2015)

9555-9558; 29. N. Singh, M. Ali, P. Rai, A. Sharma, B. D. Malhotra, R. John ACS Appl Mater Interfaces, 9 (2017) 33576-33588; 30. X. He, C. Yue, Y. Zang, J. Yin, S. Sun, J. Li, J. Kang, J. Mater. Chem. A, 1 (2013) 15010-15015; 31. C. Fu, W. Xu, H. Wang, H. Ding, L. Liang, M. Cong, S. Xu, Anal. Chem.

86 (2014) 11494-11497; 32. Q. Liu, L. Jiang, L. Guo, Small, 10 (2013) 48-51; 33. K. L. Meagley, S. P. Garcia, Cryst Growth Des, 12 (2012) 707-713;

ro of

34. D. Zhang, S. Wang, K. Cheng, S. Dai, B. Hu, X. Han, Q. Shi, Z. Du, ACS Appl Mater Interfaces, 4 (2012) 2969-2977;

35. Z. Huang, G. Meng, Q. Huang, Y. Yang, C. Zhu, C. Tang, Adv Mater, 22 (2010) 4136-4139;

-p

36. Y. Xiang, Y. Liu, Chem. Commun., 49 (2013) 585-587;

37. R. Gwak, H. Kim, S. M. Yoo, S. Y. Lee, G. J. Lee, M. K. Lee, C. K. Rhee,

re

T. Kang, B. Kim, Sci Rep, 6 (2016) 19646-19653;

38. A. K. Brown, J. Liu, Y. He and Y. Lu, ChemBioChem, 10 (2009) 486-492;

lP

39. Y. He, X. Yang, R. Yuan, Y. Chai. Anal Chem, 89 (2017) 8538-8544; 40. A. E. Radi, J. L. Acero Sánchez, E. Baldrich, C. K. O’Sullivan, J. Am.

na

Chem. Soc, 128 (2006) 117-124;

41. Huang, Y.; Ma, Y.; Chen, Y.; Wu, X.; Fang, L.; Zhu, Z.; Yang,C. J. Anal. Chem. 86 (2014) 11434–11439;

ur

42. Panich, S.; Wilson, K. A.; Nuttall, P.; Wood, C. K.; Albrecht, T.; Edel, J. B. Anal. Chem. 86 (2014) 6299–6306;

Jo

43. Z. Jiang, D. Yao, G. Wen, T. Li, B. Chen, A. Liang Plasmonics, 8 (2013) 803– 810.

Author biographies Xuan He received her Ph.D. degree in Analytical Chemistry from Sichuan University. From 2012 she was a Lecturer in Institute of Chemical Materials, China Academy of Engineering Physic. She has published extensively in journals such as Nanoscale, Small, Organic Letter, Chemical Communications, Journal of Materials Chemistry C, etc. And her interest fields are focus on chiral recognition, SERS biosensors, trace explosives and uranyl ions detection. Xin Zhou received his Ph.D. degree from National University of Singapore in 2019. He is a Lecturer in Institute of Chemical Materials, China Academy of Engineering

ro of

Physic now. He has published extensively in journals such as Journal of Materials Chemistry A, Polymer, etc. His current research interests is interaction between polymer and energy materials.

Yu Liu is a professor in Institute of Chemical Materials, China Academy of

-p

Engineering Physic. He obtained his Ph.D. degree at Nanjing University of science and technology. His current research interests are the modification of surface morphology of explosives, explosive microstructure, etc.

re

Xiaolin Wang is a professor in China Academy of Engineering Physic. He is

Jo

ur

na

lP

supervisor of Dr Xuan He.

ro of

-p

re

lP

na

ur

Jo