- Email: [email protected]
Ultraviolet-B Exposure of Human Skin Induces Cytochromes P450 1A1 and 1B1
Ultraviolet-B Exposure of Human Skin Induces Cytochromes P450 1A1 and 1B1 Santosh K. Katiyar, Mary S. Matsui,* and Hasan Mukhtar
Department of Dermatology, Case Western Reserve University, and University Hospitals of Cleveland, Cleveland, Ohio, U.S.A.; *Biological Research Division, Estee Lauder Companies Inc., Research Park, Melville, New York, U.S.A.
The cytochromes P450 belong to a multigene superfamily and are responsible for the metabolic activation of both xenobiotics and endobiotics. The expression of cytochrome P450 genes in target cells is an important determinant of human susceptibility to cancers and other chemically initiated diseases. In this study using immunohistochemistry, reverse transcription polymerase chain reaction, and western blot analysis, we investigated the cellular distribution and localization of cytochrome P450 1A1 and cytochrome P450 1B1 in human skin, and their induction by ultraviolet-B. Through the use of immunohistochemistry, cytochrome P450 1A1 was found to be primarily localized in the basal cell layer of the epidermis in non-ultraviolet-B exposed skin, whereas cytochrome P450 1B1 was localized in the epidermal cells other than the basal cell layer. Thus, localizations of cytochrome P450 1A1 and cytochrome P450 1B1 in human skin are different and may be related to keratinocyte differentiation. Ultraviolet-B exposure to solar-ultraviolet-protected skin (buttock
site) resulted in an ultraviolet-B dose-dependent (0-4 minimal erythema doses) and time-dependent (048 h) induction of both cytochrome P450 1A1 and cytochrome P450 1B1 in the epidermis. Reverse transcription polymerase chain reaction and western blot analyses revealed that exposure of human skin to ultraviolet-B (4 minimal erythema doses) resulted in enhanced expression of mRNA and protein of both cytochrome P450 1A1 and cytochrome P450 1B1 in the epidermis. Ultraviolet-B induction of both cytochrome P450 1A1 and cytochrome P450 1B1 in human skin will probably result in enhanced bioactivation of polycyclic aromatic hydrocarbons and other environmental pollutants to which humans are exposed, which in turn could make the human skin more susceptible to ultraviolet-B-induced skin cancers or allergic and irritant contact dermatitis. Key words: cytochromes P450/ultraviolet/immunohistochemistry/reverse transcription polymerase chain reaction/ human skin. J Invest Dermatol 114:328±333, 2000
T
he cytochromes P450 (CYP) belong to a multigene superfamily of genes that code for an array of enzymes catalyzing the mixed function oxidation of a wide variety of endogenous compounds and xenobiotics including environmental pollutants, proximate mutagens, and carcinogens (Gonzalez, 1989; Ioannides and Parke, 1990; Nelson et al, 1996). By increasing the polarity of their substrates, CYP in general facilitate elimination of xenobiotics and for this reason are often referred to as detoxi®cation enzymes. In many instances, however, CYP-catalyzed metabolic products are more toxic than the parent compounds (Ahmad et al, 1996). Chemical carcinogens are generally biologically inert and require metabolic activation by CYP enzymes to exert their detrimental effects. The most notable example of this activation pathway relevant for skin is the ubiquitous environmental pollutant benzo(a)pyrene, which through successive reactions catalyzed in order by CYP, epoxide hydrolase, and again by CYP, is metabolized to its
ultimate carcinogenic form benzo(a)pyrene-7,8-diol-9,10-epoxide (Conney, 1982; Katiyar et al, 1993). CYP 1A1 and 1B1 code for inducible CYP isozymes responsible for the bioactivation of numerous carcinogenic polycyclic aromatic hydrocarbons (PAH) and aromatic amines to mutagenic metabolites (Alexander et al, 1997). Moreover, CYP 1B1, which is dioxin inducible, was also found to be expressed at a high frequency in a wide range of human cancers of different histogenic types, including cancers of the breast, colon, lung, esophagus, and skin (Murray et al, 1997). Several studies have suggested that the rodent epidermis expresses both constitutive and inducible CYP-1A1-dependent monooxygenase activities (Bickers et al, 1982; Guo et al, 1990; Reiners et al, 1992; Stauber et al, 1995). The inducible expression of CYP 1A1 in the epidermis has been shown to be in¯uenced by keratinocyte differentiation. Keratinocytes of the interfollicular epidermis undergo a well-de®ned program of differentiation in which proliferation is limited to the basal layer. Keratinocytes that commit to differentiation cease dividing and migrate towards the spinous layer (Fuchs, 1990). These studies also demonstrated that preferential increase in CYP 1A1 protein or activity in differentiated keratinocytes is found after exposure of rodent skin to PAH (Mukhtar et al, 1982; Guo et al, 1990; Raza et al, 1992; Reiners et al, 1992; Stauber et al, 1995). In addition to CYP 1A1, several other genes encoding proteins involved in phase I and phase II metabolism are transcriptionally activated after exposure to
Manuscript received March 1, 1999; revised October 14, 1999; accepted for publication October 18, 1999. Reprint requests to: Dr. Hasan Mukhtar, Department of Dermatology, Case Western Reserve University, 11100 Euclid Avenue, Cleveland, OH 44106. Email: [email protected] Abbreviations: CYP, cytochrome P450; PAH, polycyclic aromatic hydrocarbon; RT-PCR, reverse transcription polymerase chain reaction. 0022-202X/00/$15.00
´ Copyright # 2000 by The Society for Investigative Dermatology, Inc. 328
VOL. 114, NO. 2 FEBRUARY 2000
2,3,7,8-tetrachlorodibenzo-p-dioxin by a mechanism involving the aryl hydrocarbon receptor (Nebert, 1994; Hankinson, 1995). This transcriptional activation occurred preferentially in differentiating keratinocytes (Jones and Reiners, 1997) and is mediated by the binding of 2,3,7,8-tetrachlorodibenzo-p-dioxin or a PAH to the cytosolic aryl hydrocarbon receptor and the subsequent interaction of the activated receptor complex with enhancer sequences proximal to the promoter of the CYP 1A1 gene (Whitlock, 1993; Nebert, 1994; Hankinson, 1995). Because CYP 1A1 and 1B1 are involved in the metabolic activation of many environmental pollutants such as PAH to which the skin is constantly exposed, they are implicated in the development of various forms of cancers, including skin cancers. Most of the studies examining the role of CYP in skin have used rodent models and were limited to chemically induced expression of CYP 1A1, and to a limited extent 1B1. Very little is known about the effect of ultraviolet-B (UVB) exposure on these CYP in mammalian skin. UVB exposure to neonatal rats has been shown to result in induction of CYP-1A1-dependent ethoxyresoru®n deethylase activities (Mukhtar et al, 1986b). Solar UV radiation induces a number of pathologic conditions in mammalian skin including in¯ammatory responses, photoaging, and cancer. With respect to skin cancer, solar UV radiation acts as a tumor initiator (Kligman et al, 1980), tumor promoter (Katiyar et al, 1997), and a complete carcinogen (Brash et al, 1991; Donawho and Kripke, 1991; Ziegler et al, 1994). The frequency of skin cancers induced by solar UV in the U.S.A. approaches that of all other cancers combined and is doubling each decade (Glass and Hoover, 1989). Ninety-®ve percent of these are nonmelanoma skin cancers, resulting in one-third as many deaths as melanoma (Boring et al, 1991). In this study, we were interested in exploring the interaction of these factors related to carcinogenesis by determining the effect of UV radiation exposure of humans on CYP 1A1 and CYP 1B1 in the skin. In this study, we demonstrate for the ®rst time the constitutive cellular distribution of CYP 1A1 and CYP 1B1 and their induction by UVB exposure in human skin. MATERIALS AND METHODS Human subjects and skin keratome biopsies Experiments were performed in accordance with the approved institutional protocol. All individuals gave written informed consent to be included in this study/ protocol, which was approved by the Institutional Review Board of Case Western Reserve University, Cleveland, and University Hospitals of Cleveland, Cleveland. Nonsmoker human subjects of different age groups and from both genders were enrolled. Five female and four male individuals aged 29±55 y consented to undergo the entire protocol, which included removal of skin punch biopsies and keratomes. First, the minimal erythema dose (MED) was determined in each recruited individual. For this purpose, individuals were UV exposed at speci®c skin sites with graded low doses of UVB, and 24 h after UVB exposure development of erythema was determined. In all the experiments of this study solar-UV-protected buttock skin sites were used because it was much simpler to obtain the skin biopsies and keratomes from the covered area of the body of the human subjects. Many subjects were hesitant to provide skin samples from the other parts of the body. In the follow-up visit the buttock skin area was exposed to the desired doses of UVB irradiation. Keratome biopsies (1.5 3 5.0 cm, and 0.6 mm deep) were taken from the area of non-UVBexposed or UVB-exposed sites from each individual for preparation of epidermal cell suspension. Skin punch biopsies (4 mm diameter, 0.8 mm deep) for immunostaining were taken and snap frozen in OCT medium under liquid nitrogen immediately after removal, and stored at ±80°C until use. Punch or keratome biopsies were taken from normal buttock skin, and after 1, 2, or 4 MED of UVB irradiation from Westinghouse FS20 bulbs at the indicated time points. Because of the possibility for confounding variables, this report is limited to Caucasian individuals. Preparation of epidermal cell suspension Epidermal sheets were separated from whole skin following treatment of the skin with dispase (20 min, 37°C) (Collaborative Biomedical Products, Bedford, MA) as described earlier (Hammerberg et al, 1996). To obtain single-cell suspensions, epidermis was treated with enzyme-free Hank's-based cell dissociation buffer (Gibco Laboratories, Grand Island, NY) containing 0.1% DNase (Sigma, St. Louis, MO) (55±60 min, 37°C). Epidermal cell
UVB INDUCTION OF CYP 1A1 AND 1B1
329
suspension thus obtained was ®ltered through a 100 mm and 50 mm nylon mesh (BioDesign, Camel, NY). Cells were washed in Hank's balanced salt solution (Gibco) containing 1% heat-inactivated fetal bovine serum (HyClone Laboratories, Logan, UT). Viability of the cells was determined by trypan blue exclusion. The whole procedure for preparation of epidermal cell suspension from the skin keratomes takes approximately 80±90 min. The possibility of alteration in CYP content and their speci®cities during this procedure and time period is minimal. The time period, however, as well as the whole process of epidermal cell suspension preparation remained common in the control and the UV-exposed group. Immunostaining of CYP 1A1 and CYP 1B1 Six micron sections of frozen skin biopsies were stained with either rabbit antihuman CYP 1A1 antibody or its isotype control rabbit IgG (Research Diagnostic, Flanders, NJ), and either rabbit antihuman CYP 1B1 or its isotype control rabbit IgG (Gentest, Woburn, MA) after incubation with goat serum. Endogenous peroxidase in skin sections was blocked by 0.5% H2O2 in phosphatebuffered saline buffer. The presence of bound antihuman CYP 1A1 or CYP 1B1 was determined with secondary antibody sheep antirabbit IgG (Binding Site, Birmingham, U.K.) labeled with horseradish peroxidase. Sections were then incubated with diaminobenzidine substrate (Kirkgaard & Perry, Gaithersburg, MA) and counterstained with methylgreen. Pictures from immunostaining were obtained using an Axiophot microscope and Kodak Ektachrome 160T ®lm. These pictures were scanned using Sprint Scan 35 program and formatted as tiff images in Adobe Photoshop 3.0 and Microsoft Powerpoint in order to make the composite ®gures. Image analysis was performed using tiff ®les of immunostaining to compare the intensity of CYP 1A1 or CYP 1B1 immunostaining in control and UV-exposed groups using the OPTIMAS 6.1 software program (Bothell, Washington). Reverse transcription polymerase chain reaction (RT-PCR) For RT-PCR analysis, total RNA from epidermal cells was extracted using the Qiagen RNA minikit (Qiagen, Valencia, CA) according to the manufacturer's protocol. Following extraction, mRNAs were reverse transcribed using M-MLV reverse transcriptase (Gibco BRL, Gaithersburg, MD) and an oligo (dt) primer (Promega, Madison, WI). RNase-free water and RNasin, a ribonuclease inhibitor (Promega), were used in all steps involving RNA. For semiquantitative determination of ampli®cation of target genes, a series of experiments was performed. In these experiments, we tested different numbers of PCR cycles, such as 22, 25, 28, 32, and 35, and serial dilutions of cDNA concentrations, such as 2, 3, 4, 5, and 6 ml of cDNA (1 ml of cDNA was equivalent to 50 ng of total RNA) for PCR ampli®cation. On the basis of these trial experiments, PCR was performed using nonsaturated input RNA (»250 ng of total RNA) for 32 cycles (94°C, 1 min; 55°C, 1 min; 72°C, 2 min) in a Perkin Elmer GeneAmp PCR System model 9600. b-Actin was used as a housekeeping gene and was coampli®ed along with the CYP 1A1 and CYP 1B1 target genes to control for the amount of cDNA included in the reaction. Primers used in PCR for hCYP 1A1 correspond to nucleotides 928±947 of the forward strand (TCACAGACAGCCTGATTGAGA) and nucleotides 1341±1360 of the reverse strand (GATGGGTTGACCCATAGCTT), and hCYP 1B1 corresponds to nucleotides 2423±2442 of the forward strand (GTATATTGTTGAAGAGACAG) and nucleotides 2719±2738 of the reverse strand (AAAGAGGTACAACATCACCT) (Baron et al, 1998). For b-actin, the forward strand and the reverse strand were GTGGGGCGCCCCAGGCACCA and CTCCTTAATGTCACGCACGATTTC (Kang et al, 1996), respectively. Preparation of microsomal fraction and western blot analysis Single-cell epidermal cell suspensions from non-UVB-exposed (control) and UVB-exposed keratome biopsies were prepared (Hammerberg et al, 1996) and used for preparing microsomal fractions (Marikar et al, 1998) to detect both basal levels and UVB induction of CYP 1A1 and CYP 1B1 in the skin. Brie¯y, cells were suspended in ice-cold homogenization medium containing 10 mM Tris(hydroxymethyl)aminomethane-HCl (Tris-HCl) (pH 7.4), 1 mM ethylenediamine tetraacetic acid, 0.1 M sucrose, 1 mM phenylmethylsulfonyl ¯uoride, 0.1 mg leupeptin per ml, and 0.04 units aprotinin per ml and were subjected to homogenization, followed by sonication (30 pulses using a microprobe sonicator) at 4°C. The homogenate was centrifuged at 10,000 3 g for 10 min and the resulting supernatant was centrifuged at 100,000 3 g for 1 h. The microsomal pellet thus obtained was suspended in Tris-HCl buffer, snap frozen in liquid nitrogen, and stored at ±80°C. Protein was measured by the Bradford method (Bradford, 1976) with bovine serum albumin as standard.
330
KATIYAR ET AL
THE JOURNAL OF INVESTIGATIVE DERMATOLOGY
For semiquantitative determination of UV-induced CYP 1A1 and CYP 1B1 expression, microsomal proteins (25 mg) were separated on a 12% Trisglycine gel (Novex, San Diego, CA) for 2 h at 125 V; thereafter, proteins were transferred to a nitrocellulose membrane using the blot module of the electrophoresis equipment at 25 V for 2 h. After blocking nonspeci®c binding sites by using 5% nonfat dried milk in Tris-glycine buffer (pH 7.5), membranes were incubated separately with antihuman CYP 1A1, CYP 1B1, or b-actin antibodies in blocking buffer at room temperature for 2 h. Membranes were washed in washing buffer and then incubated with secondary antibody, peroxidase labeled rabbit immunoglobulins, at room temperature for 2 h. CYP 1A1 and CYP 1B1 speci®c proteins were detected by an enhanced chemiluminescence system from Amersham as described by the manufacturer. Human CYP 1A1 and CYP 1B1 positive microsomes were also used as a control in the western blotting analysis. The rabbit antihuman CYP 1A1 antibody was purchased from Research Diagnostic, and the rabbit antihuman CYP 1B1 western blotting kit and positive controls for CYP 1A1 and CYP 1B1 were purchased from Gentest. Anti-human CYP 1A1 and CYP 1B1 speci®cally detect human CYP 1A1 and CYP 1B1, respectively, on western blots, as recommended by the manufacturer. The semiquantitative densitometry of bands obtained either from PCR products or western blots was performed by employing computerized image analysis. Brie¯y, the bands from PCR products or western blots were photographed and acquired via GelDoc (BioRad, Hercules, CA). The bands were then analyzed by image analysis using OPTIMAS 6.1 software and the results were expressed as the relative density for either CYP 1A1 or CYP 1B1 following normalization for RNA or protein loading amounts based on the b-actin band. Quantitative estimation of CYP 1A1 in epidermal microsomal fraction Quantitative determination of CYP 1A1 in the microsomal fraction of epidermal cells was performed using a CYP 1A1 ¯uorescence detection kit (Sigma) following the manufacturer's protocol. The method is based on the fact that CYP 1A1 selectively hydrolyzes the non¯uorescent 7-ethoxyresoru®n substrate to the ¯uorescent product resoru®n (Nerurkar et al, 1993), which can be detected using a spectro¯uorometer (Boulenc et al, 1992). Although 7-ethoxyresoru®n is a substrate for both CYP 1A1 and CYP 1B1 this ¯uorescence detection kit is speci®cally useful for the assay of CYP 1A1 activity as mentioned by the manufacturer. Brie¯y, in this method 20 ml of 7-ethoxyresoru®n (1 mM) was added to 1.8 ml of CYP 1A1 assay buffer (Na/K phosphate buffer, pH 7.6, containing 2.5 mM MgCl2) at 37°C. Thereafter, 30±100 mg of the microsomal protein was added to the cuvette. The reaction was started by adding 100 ml of nicotinamide adenine dinucleotide (NADPH) solution (5 mM). The ¯uorescence intensity of the solution was measured at excitation wavelength to 530 nm and emission wavelength to 585 nm. Resoru®n was used as a standard. The sensitivity of this assay is between 30 and 120 pmol per mg protein according to the manufacturer.
RESULTS Immunohistochemical detection and cellular distribution of CYP 1A1 and CYP 1B1 in human skin Immunostaining was performed to determine the distribution and cell-speci®c localization of CYP 1A1 and CYP 1B1 in human skin. Data from a typical Caucasian individual are presented in Fig 1. Control (non-UVB-exposed) human skin demonstrates the presence of both CYP isozymes constitutively, but the cellular distributions of CYP 1A1 and CYP 1B1 are quite different. As shown in Fig 1 (Control panel), CYP 1A1 was found to be localized mainly in the basal cell layer of the epidermal keratinocytes, whereas CYP 1B1 was con®ned to the epidermal keratinocytes excluding the basal layer of the epidermis. In addition to the presence of CYP 1A1 and CYP 1B1 in the epidermis, a few dermal cells also showed positive staining of CYP 1A1 and CYP 1B1, but a uniform pattern of staining was not observed. Additionally, CYP 1A1 and CYP 1B1 cellular staining was found in the epidermal epithelium of the hair follicle (data not shown) within the dermis. UVB dose-dependent induction of CYP 1A1 and CYP 1B1 in human skin After establishing the presence of CYP 1A1 and CYP 1B1 in control non-UVB-exposed human skin, we then determined the effect of UVB exposure of human skin on CYP 1A1 and CYP 1B1. We used one to four times the MED of UVB to expose human skin. We found that 48 h after UVB exposure, UVB enhanced the expression of CYP 1A1 and CYP 1B1 and this
enhancement was dose dependent (Fig 1). Maximum induction of CYP 1A1 and CYP 1B1 was found to be at 4 MED of UVB exposure. At 6 MED of UVB exposure, we did not ®nd additional enhancement of the UVB induction of the two CYP compared with exposure of 4 MED of UVB (data not shown). UVB dosedependent induction of CYP 1A1 and 1B1 was not observed in dermal cells, but a few cells were observed to be CYP 1A1 and 1B1 positive, as marked by arrowheads in Figs 1 and 2. Time-dependent induction of CYP 1A1 and CYP 1B1 in human skin by UVB exposure From the UVB dosedependent induction of CYP 1A1 and CYP 1B1 experiments we concluded that 4 MED of UVB exposure resulted in maximum enhancement of CYP 1A1 and CYP 1B1. Therefore, in all further experiments, 4 MED of UVB exposure was employed. Figure 2 demonstrates that UVB exposure (4 MED) of humans resulted in a time-dependent induction of both CYP 1A1 and CYP 1B1 in skin. The maximum increase in both CYP isozymes occurred in the epidermis at 48 h after UVB exposure. As CYP 1A1 and CYP 1B1 were found to be primarily localized to the epidermis, all further studies were conducted with the epidermal cells of the skin. UVB exposure of human skin induces CYP 1A1 and CYP 1B1 mRNA expression To corroborate the results obtained from the UVB dose and time-course experiments, a 4 MED UVB dose and a 48 h time point after UVB exposure were used as the optimum conditions for further studies to demonstrate the effect of UVB exposure on the gene expression of CYP 1A1 and CYP 1B1. The results shown in Fig 3 illustrate the CYP 1A1 and CYP 1B1 PCR products in UVB-exposed and non-UVB-exposed skin. Higher levels of PCR products were evident in UVB-exposed skin than in non-UVB-exposed control skin. Based on computer image analysis, approximately 3.0-fold induction and 2.5-fold induction, respectively, was observed in CYP 1A1 and CYP 1B1 PCR products in UVB-exposed skin compared with PCR products from non-UVB-exposed skin. Similar results were obtained from four different Caucasian individuals examined. The data obtained by RT-PCR also con®rms the observation that UVB exposure of the skin increased the intensity of CYP 1A1 and CYP 1B1 positive cells detected by immunohistochemical analysis. UVB exposure of human skin induces CYP 1A1 and CYP 1B1 protein expression After showing that exposure of human skin to UVB induces the expression of CYP 1A1 and 1B1 in epidermal cells using immunostaining and RT-PCR, we were interested to see whether skin exposure to UVB also induces CYP 1A1 and CYP 1B1 protein expression in the skin. Western blot analysis of microsomal protein from the epidermal cells of nonUVB-exposed skin showed that both CYP 1A1 and CYP 1B1 proteins were readily detectable in the skin, whereas higher levels of CYP 1A1 and CYP 1B1 proteins were detected in the UVBexposed epidermal microsomal protein fraction, as shown in Fig 4. Similar results were obtained when microsomal protein samples from four additional individuals were examined. Further, we also quantitatively analyzed the activity of CYP 1A1 in control and UVB-exposed skin employing the ¯uorescence method (Boulenc et al, 1992). We found that exposure of human skin to 4 MED of UVB signi®cantly induced the enzyme activity of CYP 1A1 in the microsomal fraction of epidermal cells compared with the epidermal cells from non-UVB-exposed skin (Fig 5, p < 0.005). These data are also in accordance with our immunostaining and RT-PCR data, where we have shown that UVB exposure of skin increased the expression of both CYP isozymes compared with non-UVB-exposed control human skin. DISCUSSION Our data clearly demonstrate that CYP 1A1 and CYP 1B1 are expressed in normal human skin, with marked differences in their
VOL. 114, NO. 2 FEBRUARY 2000
UVB INDUCTION OF CYP 1A1 AND 1B1
331
Figure 1. UVB dose-dependent induction of CYP 1A1 and CYP 1B1 in human skin. Immunoperoxidase staining was performed to localize the cellular distribution of CYP 1A1 and CYP 1B1 positive cells in the skin. Six micron sections of control skin or skin exposed to different doses of UVB were stained with either rabbit antihuman CYP 1A1 and rabbit antihuman CYP 1B1 antibodies or the isotype control rabbit IgG. CYP 1A1 localization and UVmediated induction was mainly con®ned to the basal membrane of the epidermis, whereas CYP 1B1 was distributed among the keratinocytes other than the basal cell layer. The immunostaining of CYP 1A1 and CYP 1B1 positive cells is shown in brown. A few CYP 1A1 and CYP 1B1 positive cells were also observed in the dermis, and are marked by arrowheads. The data from immunostaining shown here are representative of four independent experiments conducted on four different individuals. Scale bar: 100 mm.
Figure 2. Time-dependent induction of CYP 1A1 and CYP 1B1 by exposure of human skin to UVB. Immunoperoxidase staining was performed to localize the cellular distribution of CYP 1A1 and CYP 1B1 positive cells in the skin. Six micron sections of control skin or skin after 4 MED of UVB exposure at different time points were stained with either rabbit antihuman CYP 1A1 and rabbit antihuman CYP 1B1 antibodies or the isotype control rabbit IgG. Induction of CYP 1A1 and CYP 1B1 was found to be maximum 48 h after UVB exposure. The immunostaining of CYP 1A1 and CYP 1B1 positive cells is shown in brown. A few CYP 1A1 and CYP 1B1 positive cells were also observed in the dermis, and are marked by arrowheads. The data from immunostaining shown here are representative of four independent experiments conducted on four different individuals. Scale bar: 100 mm.
332
KATIYAR ET AL
Figure 3. UVB exposure of human skin induces CYP 1A1 and CYP 1B1 mRNA expression in epidermal cells. Total RNA was extracted from the epidermal cells from non-UVB-exposed and UVB-exposed skin. mRNA was ampli®ed by RT-PCR as detailed in Materials and Methods. Quantitation of the PCR product signal from UVB-exposed cDNA relative to non-UVB-exposed cDNA was found to be approximately 3-fold in the case of CYP 1A1 and 2.5-fold in CYP 1B1. Representative data with similar results from three similar experiments on different human individuals are presented here.
Figure 4. UVB exposure of human skin induces CYP 1A1 and CYP 1B1 protein expression in epidermal cells. Microsomal protein fraction was isolated from the epidermal cell suspension as described in Materials and Methods. Twenty-®ve micrograms of protein was loaded from each sample for western blot analysis. Polyclonal rabbit antihuman CYP 1A1 and CYP 1B1 antibodies were used as primary antibodies, and peroxidase labeled sheep antirabbit (CYP 1A1) or goat antirabbit (CYP 1B1) antibodies were used as secondary antibodies. Quantitation of the protein bands indicates that an approximate 3-fold induction in CYP 1A1 and CYP 1B1 proteins was observed in UVB-exposed skin (epidermis) compared with non-UVBexposed skin. Representative data with similar results from four similar experiments on different human individuals are presented here.
localization and distribution (Figs 1, 2). We also showed that human skin exposure to UVB induces the expression of CYP 1A1 and CYP 1B1 at the mRNA level (Fig 3) as well as the protein level (Fig 4). It is well known that UV radiation acts as a tumor initiator (Kligman et al, 1980), tumor promoter (Katiyar et al, 1997), and complete carcinogen (Donawho et al, 1991; Ziegler et al,
THE JOURNAL OF INVESTIGATIVE DERMATOLOGY
Figure 5. UVB exposure of human skin induces CYP 1A1 activity in epidermal cells. Epidermal microsomal protein was employed to determine CYP 1A1 activity using the ¯uorescence detection method as described in Materials and Methods. Quantitative analysis of CYP 1A1 indicates that 48 h after UVB exposure of human skin CYP 1A1 activity was increased more than 2-fold in epidermal cells compared to epidermal cells from non-UVB-exposed skin (p < 0.005). Data represent the mean 6 SEM from four similar experiments on different human individuals.
1994). Several investigators have demonstrated that the regulation of CYP 1A1 expression plays a critical role in carcinogenesis, as many chemicals that induce skin CYP 1A1 expression are also initiators of skin tumors in man (Falk et al, 1964). In addition, CYP-1A1-dependent metabolic activation of procarcinogens into reactive carcinogenic metabolites in skin has been reported (Kinoshita and Gelboin, 1972). CYP 1A1 induction occurs in human skin after application of coal tar, which contains many PAH including the potent chemical carcinogen benzo(a)pyrene (Bickers and Kappas, 1978). Benzo(a)pyrene, a ubiquitous environmental pollutant also present in coal tar, possesses skin tumor initiating activity in mice (Mukhtar et al, 1986a) and can cause skin cancer in mice (Wallcave et al, 1971) and man (Falk et al, 1964). Thus a relationship between CYP 1A1 induction and tumorigenesis exists in mice and possibly in humans (Falk et al, 1964; Wallcave et al, 1971). Further, nonmelanoma skin cancer, comprising basal cell and squamous cell carcinomas derived from keratinocytes of the epidermis, are the most frequently diagnosed cancers in Caucasians. These skin cancers are caused by excessive exposure to solar UV radiation, thus making it more plausible that the UV radiation caused an induction of these CYP 1A1 and CYP 1B1 isozymes, which may be responsible for the induction of skin cancers or photocarcinogenesis. CYP 1B1 has been shown to be expressed in a wide variety of malignant tumors of different histogenic types, indicating that this CYP isozyme may be a tumor-speci®c form of P450 (Taylor et al, 1996; Kress and Greenlee, 1997; Murray et al, 1997). Although Murray et al (1997) could not detect the presence of CYP 1B1 in formalin ®xed wax embedded sections of normal human tissues other than skin, we were able to detect the presence of CYP 1B1 in frozen biopsies of normal human skin by immunohistochemistry and RT-PCR, and also its induction by UVB exposure of human skin. Immunostaining of CYP 1B1 also indicates that normal human skin contains a very low level of CYP 1B1 (Fig 1). The presence of CYP 1B1 in many types of cancer suggests that this P450 isozyme may have a crucial endogenous function in tumor cells and that CYP 1B1 might also contribute to the drug resistance that is observed in many types of cancer (Murray et al, 1997). Additionally, CYP 1B1 may also be important in tumor development and progression, because human CYP 1B1 expressed in yeast has been shown to be capable of metabolizing a variety of putative human carcinogens (Shimada et al, 1996). These studies provide ample evidence that induction of CYP 1A1 and CYP 1B1
VOL. 114, NO. 2 FEBRUARY 2000
is involved in cancer incidence. Humans are chronically exposed to solar UV irradiation, which induces CYP-dependent monooxygenase reactions in human skin. Thus, the UVB-caused induction of CYP 1A1 and CYP 1B1 should result in increased bioactivation of environmental pollutants, including cigarette smoke, different allergens, and PAH from automobile exhausts, which will ultimately increase the risk of various skin disorders and skin cancers in humans. Therefore, it is warranted to explore the development of inhibitors of UV-induced CYP expression, which may protect the human skin against the adverse effects of UV irradiation. In our study, we utilized the immunohistochemistry technique to localize the distribution of CYP 1A1 and CYP 1B1 in human skin. This technique ensures the identi®cation of speci®c cell types containing and expressing CYP 1A1 and CYP 1B1 P450 isozymes. This property can be used to detect differential expression of CYP isozymes in malignant versus normal cells within skin tumors, because tumors are composed of a variable proportion of tumor cells and nontumor cells. The presence and expression of CYP 1A1 and CYP 1B1 in different types of malignant tumors have important consequences for both the diagnosis and treatment of cancer. New diagnostic procedures based upon the presence of CYP 1A1 and CYP 1B1 in malignant tumor/cancer cells can be developed, and the expression of these P450 isozymes in tumor cells can provide a molecular target for the development of new anticancer drugs, which would be capable of blocking the UVB induction/activation of CYP 1A1 or CYP 1B1 in UVB-exposed human skin. This work was supported by funds from the Estee Lauder Companies Inc., and Skin Diseases Research Center Core Grant p-30-AR-39750.
REFERENCES Ahmad N, Agarwal R, Mukhtar H: Cytochrome P-450 and drug development for skin diseases. Skin Pharmacol 9:231±241, 1996 Alexander DL, Eltom SE, Jefcoate CR: Ah receptor regulation of CYP 1B1 expression in primary mouse embryo-derived cells. Cancer Res 57:4498±4506, 1997 Baron JM, Zwadlo-Klarwasser G, Jugert F, Hamann W, Rubben A, Mukhtar H, Merk HF: Cytochrome P450 1B1: a major P450 isoenzyme in human blood monocytes and macrophage subsets. Biochem Pharmacol 56:1105±1110, 1998 Bickers DR, Kappas A: Human skin aryl hydrocarbon hydroxylase induction by coal tar. J Clin Invest 62:1061±1068, 1978 Bickers DR, Dutta-Choudhury T, Mukhtar H: Epidermis: a site of drug metabolism in neonatal rat skin. Studies on cytochrome P-450 content and mixed-function oxidase and epoxide hydrolase activity. Mol Pharmacol 1:239±247, 1982 Boring CC, Squires TS, Tong T: Cancer statistics, 1991. CA Cancer J Clin 41:19±36, 1991 Boulenc X, Bourrie M, Fabre I, Roque C, Joyeux H, Berger Y, Fabre G: Regulation of cytochrome P4501A1 gene expression in a human intestinal cell line, Caco-2. J Pharmacol Exp Ther 263:1471±1478, 1992 Bradford M: A rapid and sensitive method for the quanti®cation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 227:248±254, 1976 Brash DE, Rudolph JA, Simon JA, et al: A role for sunlight in skin cancer: UVinduced p53 mutations in squamous cell carcinoma. Proc Natl Acad Sci USA 88:10124±10128, 1991 Conney AH: Induction of microsomal enzymes by foreign chemicals and carcinogenesis by polycyclic aromatic hydrocarbons. GHA Clowes Memorial Lecture. Cancer Res 42:4875±4917, 1982 Donawho CK, Kripke ML: Evidence that the local effect of ultraviolet radiation on the growth of murine melanomas is immunologically mediated. Cancer Res 51:4176±4181, 1991 Falk HL, Kotin P, Mehler A: Polycyclic hydrocarbons as carcinogens for man. Arch Environ Health 8:721±731, 1964 Fuchs E: Epidermal differentiation: The bare essentials. J Cell Biol 111:2807±2814, 1990 Glass AG, Hoover RN: The emerging epidemic of melanoma and squamous cell skin cancer. J Am Med Assoc 262:2097±2100, 1989 Gonzalez FJ: The molecular biology of the cytochrome P 450s. Pharmacol Rev 40:243±288, 1989
UVB INDUCTION OF CYP 1A1 AND 1B1
333
Guo JF, Brown R, Rothwell CE, Bernstein IA: Levels of cytochrome P-450mediated aryl hydrocarbon hydroxylase (AHH) are higher in differentiated than germinative cutaneous keratinocytes. J Invest Dermatol 94:86±93, 1990 Hammerberg C, Duraiswamy N, Cooper KD: Reversal of immunosuppression inducible through ultraviolet-exposed skin by in vivo anti-CD11b treatment. J Immunol 157:5254±5261, 1996 Hankinson O: The aryl hydrocarbon receptor complex. Annu Rev Pharmacol Toxicol 35:307±340, 1995 Ioannides C, Parke DV: The cytochrome P450, 1 gene family of microsomal hemoproteins and their role in the metabolic activation of chemicals. Drug Metab Rev 22:1±85, 1990 Jones CL, Reiners JJ Jr: Differentiation status of cultured murine keratinocytes modulates induction of genes responsive to 2,3,7,8-tetrachlorodibenzo-pdioxin. Arch Biochem Biophys 347:163±173, 1997 Kang K, Kubin M, Cooper KD, Lessin SR, Trinchieri G, Rook AH: IL-12 synthesis by human Langerhans cells. J Immunol 156:1402±1407, 1996 Katiyar SK, Agarwal R, Mukhtar H: Introduction: sources, occurrence, nomenclature, and carcinogenicity of polycyclic aromatic hydrocarbons. In: Rathore HS ed. Handbook of Chromatography. Boca Raton, FL, CRC Press, 1993, pp 1±17 Katiyar SK, Korman NJ, Mukhtar H, Agarwal R: Protective effects of silymarin against photocarcinogenesis in a mouse skin model. J Natl Cancer Inst 89:556± 566, 1997 Kinoshita N, Gelboin HV: The role of aryl hydrocarbon hydroxylase in 7,12dimethylbenz (a) anthracene skin tumorigenesis: on the mechanism of 7,8benza¯avone inhibition of tumorigenesis. Cancer Res 32:1329±1339, 1972 Kligman LH, Akin FJ, Kligman AM: Sunscreens prevent ultraviolet photocarcinogenesis. J Am Acad Dermatol 3:30±35, 1980 Kress S, Greenlee WF: Cell-speci®c regulation of human CYP1A1 and CYP1B1 genes. Cancer Res 57:1264±1269, 1997 Marikar Y, Wang ZQ, Duell EA, Petkovich M, Voorhees JJ, Fisher GJ: Retinoic acid receptors regulate expression of retinoic acid 4-hydroxylase that speci®cally inactivates all-trans retinoic acid in human keratinocyte HaCaT cells. J Invest Dermatol 111:434±439, 1998 Mukhtar H, Link CM, Cherniack E, Kushiner DM, Bickers DR: Effect of topical application of de®ned constituents of coal tar on skin and liver aryl hydrocarbon hydroxylase and 7-ethoxycoumarin deethylase activities. Toxicol Appl Pharmacol 64:541±549, 1982 Mukhtar H, Das M, Bickers DR: Skin tumor initiating activity of therapeutic crude coal tar as compared to other polycyclic aromatic hydrocarbons in SENCAR mice. Cancer Lett 31:147±151, 1986a Mukhtar H, DelTito BJ Jr, Matgouranis PM, Das M, Asokan P, Bickers DR: Additive effects of ultraviolet B and crude coal tar on cutaneous carcinogen metabolism: possible relevance to the tumorigenicity of the Goeckerman regimen. J Invest Dermatol 87:348±353, 1986b Murray GI, Taylor MC, McFadyen MC, McKay JA, Greenlee WF, Burke MD, Melvin WT: Tumor-speci®c expression of cytochrome P450 CYP1B1. Cancer Res 57:3026±3031, 1997 Nebert DW: Drug-metabolizing enzymes in ligand-modulated transcription. Biochem Pharmacol 47:25±37, 1994 Nelson DR, Koymans L, Kamataki T, et al: P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 6:1±42, 1996 Nerurkar PV, Park SS, Thomas PE, Nims RW, Lubet RA: Methoxyresoru®n and benzyloxyresoru®n: substrates preferentially metabolized by cytochromes P4501A2 and 2B, respectively, in the rat and mouse. Biochem Pharmacol 46:933±943, 1993 Raza H, Agarwal R, Bickers DR, Mukhtar H: Puri®cation and molecular characterization of b-naphtho¯avone inducible cytochrome P450 from rat epidermis. J Invest Dermatol 98:233±240, 1992 Reiners JJ Jr, Cantu AR, Thai G, Scholler A: Differential expression of basal and hydrocarbon-induced cytochrome P450 monooxygenase and quinone reductase activities in subpopulations of murine epidermal cells differing in their stages of differentiation. Drug Metab Dispos 20:360±366, 1992 Shimada T, Hayes CL, Yamazaki H, Amin S, Hecht SS, Guengerich FP, Sutter TR: Activation of a chemically diverse procarcinogens by human cytochrome P450 1B1. Cancer Res 56:2979±2984, 1996 Stauber KL, Laskin JD, Yurkow EJ, Thomas PE, Laskin DL, Conney AH: Flow cytometry reveals subpopulations of murine epidermal cells that are refractory to induction of cytochrome P-450 1A1 by b±naphtho¯avone. J Pharmacol Exp Ther 273:967±976, 1995 Taylor MC, McKay JA, Murray GI, Greenlee WF, Marcus CB, Burke MD, Melvin WT: Cytochrome P450 1B1 expression in human malignant tumours. Biochem Soc Trans 24:328S±333S, 1996 Wallcave L, Garcia H, Feldman R, Lijinsky W, Shubik P: Skin tumorigenesis in mice by petroleum asphalts and coal-tar pitches of known polynuclear aromatic hydrocarbon content. Toxicol Appl Pharmacol 18:41±52, 1971 Whitlock JP Jr: Mechanistic aspects of dioxin action. Chem Res Toxicol 6:754±763, 1993 Ziegler A, Jonason AS, Leffell DJ: Sunburn p53 in the onset of skin cancer. Nature 372:773±776, 1994
Department of Dermatology, Case Western Reserve University, and University Hospitals of Cleveland, Cleveland, Ohio, U.S.A.; *Biological Research Division, Estee Lauder Companies Inc., Research Park, Melville, New York, U.S.A.
The cytochromes P450 belong to a multigene superfamily and are responsible for the metabolic activation of both xenobiotics and endobiotics. The expression of cytochrome P450 genes in target cells is an important determinant of human susceptibility to cancers and other chemically initiated diseases. In this study using immunohistochemistry, reverse transcription polymerase chain reaction, and western blot analysis, we investigated the cellular distribution and localization of cytochrome P450 1A1 and cytochrome P450 1B1 in human skin, and their induction by ultraviolet-B. Through the use of immunohistochemistry, cytochrome P450 1A1 was found to be primarily localized in the basal cell layer of the epidermis in non-ultraviolet-B exposed skin, whereas cytochrome P450 1B1 was localized in the epidermal cells other than the basal cell layer. Thus, localizations of cytochrome P450 1A1 and cytochrome P450 1B1 in human skin are different and may be related to keratinocyte differentiation. Ultraviolet-B exposure to solar-ultraviolet-protected skin (buttock
site) resulted in an ultraviolet-B dose-dependent (0-4 minimal erythema doses) and time-dependent (048 h) induction of both cytochrome P450 1A1 and cytochrome P450 1B1 in the epidermis. Reverse transcription polymerase chain reaction and western blot analyses revealed that exposure of human skin to ultraviolet-B (4 minimal erythema doses) resulted in enhanced expression of mRNA and protein of both cytochrome P450 1A1 and cytochrome P450 1B1 in the epidermis. Ultraviolet-B induction of both cytochrome P450 1A1 and cytochrome P450 1B1 in human skin will probably result in enhanced bioactivation of polycyclic aromatic hydrocarbons and other environmental pollutants to which humans are exposed, which in turn could make the human skin more susceptible to ultraviolet-B-induced skin cancers or allergic and irritant contact dermatitis. Key words: cytochromes P450/ultraviolet/immunohistochemistry/reverse transcription polymerase chain reaction/ human skin. J Invest Dermatol 114:328±333, 2000
T
he cytochromes P450 (CYP) belong to a multigene superfamily of genes that code for an array of enzymes catalyzing the mixed function oxidation of a wide variety of endogenous compounds and xenobiotics including environmental pollutants, proximate mutagens, and carcinogens (Gonzalez, 1989; Ioannides and Parke, 1990; Nelson et al, 1996). By increasing the polarity of their substrates, CYP in general facilitate elimination of xenobiotics and for this reason are often referred to as detoxi®cation enzymes. In many instances, however, CYP-catalyzed metabolic products are more toxic than the parent compounds (Ahmad et al, 1996). Chemical carcinogens are generally biologically inert and require metabolic activation by CYP enzymes to exert their detrimental effects. The most notable example of this activation pathway relevant for skin is the ubiquitous environmental pollutant benzo(a)pyrene, which through successive reactions catalyzed in order by CYP, epoxide hydrolase, and again by CYP, is metabolized to its
ultimate carcinogenic form benzo(a)pyrene-7,8-diol-9,10-epoxide (Conney, 1982; Katiyar et al, 1993). CYP 1A1 and 1B1 code for inducible CYP isozymes responsible for the bioactivation of numerous carcinogenic polycyclic aromatic hydrocarbons (PAH) and aromatic amines to mutagenic metabolites (Alexander et al, 1997). Moreover, CYP 1B1, which is dioxin inducible, was also found to be expressed at a high frequency in a wide range of human cancers of different histogenic types, including cancers of the breast, colon, lung, esophagus, and skin (Murray et al, 1997). Several studies have suggested that the rodent epidermis expresses both constitutive and inducible CYP-1A1-dependent monooxygenase activities (Bickers et al, 1982; Guo et al, 1990; Reiners et al, 1992; Stauber et al, 1995). The inducible expression of CYP 1A1 in the epidermis has been shown to be in¯uenced by keratinocyte differentiation. Keratinocytes of the interfollicular epidermis undergo a well-de®ned program of differentiation in which proliferation is limited to the basal layer. Keratinocytes that commit to differentiation cease dividing and migrate towards the spinous layer (Fuchs, 1990). These studies also demonstrated that preferential increase in CYP 1A1 protein or activity in differentiated keratinocytes is found after exposure of rodent skin to PAH (Mukhtar et al, 1982; Guo et al, 1990; Raza et al, 1992; Reiners et al, 1992; Stauber et al, 1995). In addition to CYP 1A1, several other genes encoding proteins involved in phase I and phase II metabolism are transcriptionally activated after exposure to
Manuscript received March 1, 1999; revised October 14, 1999; accepted for publication October 18, 1999. Reprint requests to: Dr. Hasan Mukhtar, Department of Dermatology, Case Western Reserve University, 11100 Euclid Avenue, Cleveland, OH 44106. Email: [email protected] Abbreviations: CYP, cytochrome P450; PAH, polycyclic aromatic hydrocarbon; RT-PCR, reverse transcription polymerase chain reaction. 0022-202X/00/$15.00
´ Copyright # 2000 by The Society for Investigative Dermatology, Inc. 328
VOL. 114, NO. 2 FEBRUARY 2000
2,3,7,8-tetrachlorodibenzo-p-dioxin by a mechanism involving the aryl hydrocarbon receptor (Nebert, 1994; Hankinson, 1995). This transcriptional activation occurred preferentially in differentiating keratinocytes (Jones and Reiners, 1997) and is mediated by the binding of 2,3,7,8-tetrachlorodibenzo-p-dioxin or a PAH to the cytosolic aryl hydrocarbon receptor and the subsequent interaction of the activated receptor complex with enhancer sequences proximal to the promoter of the CYP 1A1 gene (Whitlock, 1993; Nebert, 1994; Hankinson, 1995). Because CYP 1A1 and 1B1 are involved in the metabolic activation of many environmental pollutants such as PAH to which the skin is constantly exposed, they are implicated in the development of various forms of cancers, including skin cancers. Most of the studies examining the role of CYP in skin have used rodent models and were limited to chemically induced expression of CYP 1A1, and to a limited extent 1B1. Very little is known about the effect of ultraviolet-B (UVB) exposure on these CYP in mammalian skin. UVB exposure to neonatal rats has been shown to result in induction of CYP-1A1-dependent ethoxyresoru®n deethylase activities (Mukhtar et al, 1986b). Solar UV radiation induces a number of pathologic conditions in mammalian skin including in¯ammatory responses, photoaging, and cancer. With respect to skin cancer, solar UV radiation acts as a tumor initiator (Kligman et al, 1980), tumor promoter (Katiyar et al, 1997), and a complete carcinogen (Brash et al, 1991; Donawho and Kripke, 1991; Ziegler et al, 1994). The frequency of skin cancers induced by solar UV in the U.S.A. approaches that of all other cancers combined and is doubling each decade (Glass and Hoover, 1989). Ninety-®ve percent of these are nonmelanoma skin cancers, resulting in one-third as many deaths as melanoma (Boring et al, 1991). In this study, we were interested in exploring the interaction of these factors related to carcinogenesis by determining the effect of UV radiation exposure of humans on CYP 1A1 and CYP 1B1 in the skin. In this study, we demonstrate for the ®rst time the constitutive cellular distribution of CYP 1A1 and CYP 1B1 and their induction by UVB exposure in human skin. MATERIALS AND METHODS Human subjects and skin keratome biopsies Experiments were performed in accordance with the approved institutional protocol. All individuals gave written informed consent to be included in this study/ protocol, which was approved by the Institutional Review Board of Case Western Reserve University, Cleveland, and University Hospitals of Cleveland, Cleveland. Nonsmoker human subjects of different age groups and from both genders were enrolled. Five female and four male individuals aged 29±55 y consented to undergo the entire protocol, which included removal of skin punch biopsies and keratomes. First, the minimal erythema dose (MED) was determined in each recruited individual. For this purpose, individuals were UV exposed at speci®c skin sites with graded low doses of UVB, and 24 h after UVB exposure development of erythema was determined. In all the experiments of this study solar-UV-protected buttock skin sites were used because it was much simpler to obtain the skin biopsies and keratomes from the covered area of the body of the human subjects. Many subjects were hesitant to provide skin samples from the other parts of the body. In the follow-up visit the buttock skin area was exposed to the desired doses of UVB irradiation. Keratome biopsies (1.5 3 5.0 cm, and 0.6 mm deep) were taken from the area of non-UVBexposed or UVB-exposed sites from each individual for preparation of epidermal cell suspension. Skin punch biopsies (4 mm diameter, 0.8 mm deep) for immunostaining were taken and snap frozen in OCT medium under liquid nitrogen immediately after removal, and stored at ±80°C until use. Punch or keratome biopsies were taken from normal buttock skin, and after 1, 2, or 4 MED of UVB irradiation from Westinghouse FS20 bulbs at the indicated time points. Because of the possibility for confounding variables, this report is limited to Caucasian individuals. Preparation of epidermal cell suspension Epidermal sheets were separated from whole skin following treatment of the skin with dispase (20 min, 37°C) (Collaborative Biomedical Products, Bedford, MA) as described earlier (Hammerberg et al, 1996). To obtain single-cell suspensions, epidermis was treated with enzyme-free Hank's-based cell dissociation buffer (Gibco Laboratories, Grand Island, NY) containing 0.1% DNase (Sigma, St. Louis, MO) (55±60 min, 37°C). Epidermal cell
UVB INDUCTION OF CYP 1A1 AND 1B1
329
suspension thus obtained was ®ltered through a 100 mm and 50 mm nylon mesh (BioDesign, Camel, NY). Cells were washed in Hank's balanced salt solution (Gibco) containing 1% heat-inactivated fetal bovine serum (HyClone Laboratories, Logan, UT). Viability of the cells was determined by trypan blue exclusion. The whole procedure for preparation of epidermal cell suspension from the skin keratomes takes approximately 80±90 min. The possibility of alteration in CYP content and their speci®cities during this procedure and time period is minimal. The time period, however, as well as the whole process of epidermal cell suspension preparation remained common in the control and the UV-exposed group. Immunostaining of CYP 1A1 and CYP 1B1 Six micron sections of frozen skin biopsies were stained with either rabbit antihuman CYP 1A1 antibody or its isotype control rabbit IgG (Research Diagnostic, Flanders, NJ), and either rabbit antihuman CYP 1B1 or its isotype control rabbit IgG (Gentest, Woburn, MA) after incubation with goat serum. Endogenous peroxidase in skin sections was blocked by 0.5% H2O2 in phosphatebuffered saline buffer. The presence of bound antihuman CYP 1A1 or CYP 1B1 was determined with secondary antibody sheep antirabbit IgG (Binding Site, Birmingham, U.K.) labeled with horseradish peroxidase. Sections were then incubated with diaminobenzidine substrate (Kirkgaard & Perry, Gaithersburg, MA) and counterstained with methylgreen. Pictures from immunostaining were obtained using an Axiophot microscope and Kodak Ektachrome 160T ®lm. These pictures were scanned using Sprint Scan 35 program and formatted as tiff images in Adobe Photoshop 3.0 and Microsoft Powerpoint in order to make the composite ®gures. Image analysis was performed using tiff ®les of immunostaining to compare the intensity of CYP 1A1 or CYP 1B1 immunostaining in control and UV-exposed groups using the OPTIMAS 6.1 software program (Bothell, Washington). Reverse transcription polymerase chain reaction (RT-PCR) For RT-PCR analysis, total RNA from epidermal cells was extracted using the Qiagen RNA minikit (Qiagen, Valencia, CA) according to the manufacturer's protocol. Following extraction, mRNAs were reverse transcribed using M-MLV reverse transcriptase (Gibco BRL, Gaithersburg, MD) and an oligo (dt) primer (Promega, Madison, WI). RNase-free water and RNasin, a ribonuclease inhibitor (Promega), were used in all steps involving RNA. For semiquantitative determination of ampli®cation of target genes, a series of experiments was performed. In these experiments, we tested different numbers of PCR cycles, such as 22, 25, 28, 32, and 35, and serial dilutions of cDNA concentrations, such as 2, 3, 4, 5, and 6 ml of cDNA (1 ml of cDNA was equivalent to 50 ng of total RNA) for PCR ampli®cation. On the basis of these trial experiments, PCR was performed using nonsaturated input RNA (»250 ng of total RNA) for 32 cycles (94°C, 1 min; 55°C, 1 min; 72°C, 2 min) in a Perkin Elmer GeneAmp PCR System model 9600. b-Actin was used as a housekeeping gene and was coampli®ed along with the CYP 1A1 and CYP 1B1 target genes to control for the amount of cDNA included in the reaction. Primers used in PCR for hCYP 1A1 correspond to nucleotides 928±947 of the forward strand (TCACAGACAGCCTGATTGAGA) and nucleotides 1341±1360 of the reverse strand (GATGGGTTGACCCATAGCTT), and hCYP 1B1 corresponds to nucleotides 2423±2442 of the forward strand (GTATATTGTTGAAGAGACAG) and nucleotides 2719±2738 of the reverse strand (AAAGAGGTACAACATCACCT) (Baron et al, 1998). For b-actin, the forward strand and the reverse strand were GTGGGGCGCCCCAGGCACCA and CTCCTTAATGTCACGCACGATTTC (Kang et al, 1996), respectively. Preparation of microsomal fraction and western blot analysis Single-cell epidermal cell suspensions from non-UVB-exposed (control) and UVB-exposed keratome biopsies were prepared (Hammerberg et al, 1996) and used for preparing microsomal fractions (Marikar et al, 1998) to detect both basal levels and UVB induction of CYP 1A1 and CYP 1B1 in the skin. Brie¯y, cells were suspended in ice-cold homogenization medium containing 10 mM Tris(hydroxymethyl)aminomethane-HCl (Tris-HCl) (pH 7.4), 1 mM ethylenediamine tetraacetic acid, 0.1 M sucrose, 1 mM phenylmethylsulfonyl ¯uoride, 0.1 mg leupeptin per ml, and 0.04 units aprotinin per ml and were subjected to homogenization, followed by sonication (30 pulses using a microprobe sonicator) at 4°C. The homogenate was centrifuged at 10,000 3 g for 10 min and the resulting supernatant was centrifuged at 100,000 3 g for 1 h. The microsomal pellet thus obtained was suspended in Tris-HCl buffer, snap frozen in liquid nitrogen, and stored at ±80°C. Protein was measured by the Bradford method (Bradford, 1976) with bovine serum albumin as standard.
330
KATIYAR ET AL
THE JOURNAL OF INVESTIGATIVE DERMATOLOGY
For semiquantitative determination of UV-induced CYP 1A1 and CYP 1B1 expression, microsomal proteins (25 mg) were separated on a 12% Trisglycine gel (Novex, San Diego, CA) for 2 h at 125 V; thereafter, proteins were transferred to a nitrocellulose membrane using the blot module of the electrophoresis equipment at 25 V for 2 h. After blocking nonspeci®c binding sites by using 5% nonfat dried milk in Tris-glycine buffer (pH 7.5), membranes were incubated separately with antihuman CYP 1A1, CYP 1B1, or b-actin antibodies in blocking buffer at room temperature for 2 h. Membranes were washed in washing buffer and then incubated with secondary antibody, peroxidase labeled rabbit immunoglobulins, at room temperature for 2 h. CYP 1A1 and CYP 1B1 speci®c proteins were detected by an enhanced chemiluminescence system from Amersham as described by the manufacturer. Human CYP 1A1 and CYP 1B1 positive microsomes were also used as a control in the western blotting analysis. The rabbit antihuman CYP 1A1 antibody was purchased from Research Diagnostic, and the rabbit antihuman CYP 1B1 western blotting kit and positive controls for CYP 1A1 and CYP 1B1 were purchased from Gentest. Anti-human CYP 1A1 and CYP 1B1 speci®cally detect human CYP 1A1 and CYP 1B1, respectively, on western blots, as recommended by the manufacturer. The semiquantitative densitometry of bands obtained either from PCR products or western blots was performed by employing computerized image analysis. Brie¯y, the bands from PCR products or western blots were photographed and acquired via GelDoc (BioRad, Hercules, CA). The bands were then analyzed by image analysis using OPTIMAS 6.1 software and the results were expressed as the relative density for either CYP 1A1 or CYP 1B1 following normalization for RNA or protein loading amounts based on the b-actin band. Quantitative estimation of CYP 1A1 in epidermal microsomal fraction Quantitative determination of CYP 1A1 in the microsomal fraction of epidermal cells was performed using a CYP 1A1 ¯uorescence detection kit (Sigma) following the manufacturer's protocol. The method is based on the fact that CYP 1A1 selectively hydrolyzes the non¯uorescent 7-ethoxyresoru®n substrate to the ¯uorescent product resoru®n (Nerurkar et al, 1993), which can be detected using a spectro¯uorometer (Boulenc et al, 1992). Although 7-ethoxyresoru®n is a substrate for both CYP 1A1 and CYP 1B1 this ¯uorescence detection kit is speci®cally useful for the assay of CYP 1A1 activity as mentioned by the manufacturer. Brie¯y, in this method 20 ml of 7-ethoxyresoru®n (1 mM) was added to 1.8 ml of CYP 1A1 assay buffer (Na/K phosphate buffer, pH 7.6, containing 2.5 mM MgCl2) at 37°C. Thereafter, 30±100 mg of the microsomal protein was added to the cuvette. The reaction was started by adding 100 ml of nicotinamide adenine dinucleotide (NADPH) solution (5 mM). The ¯uorescence intensity of the solution was measured at excitation wavelength to 530 nm and emission wavelength to 585 nm. Resoru®n was used as a standard. The sensitivity of this assay is between 30 and 120 pmol per mg protein according to the manufacturer.
RESULTS Immunohistochemical detection and cellular distribution of CYP 1A1 and CYP 1B1 in human skin Immunostaining was performed to determine the distribution and cell-speci®c localization of CYP 1A1 and CYP 1B1 in human skin. Data from a typical Caucasian individual are presented in Fig 1. Control (non-UVB-exposed) human skin demonstrates the presence of both CYP isozymes constitutively, but the cellular distributions of CYP 1A1 and CYP 1B1 are quite different. As shown in Fig 1 (Control panel), CYP 1A1 was found to be localized mainly in the basal cell layer of the epidermal keratinocytes, whereas CYP 1B1 was con®ned to the epidermal keratinocytes excluding the basal layer of the epidermis. In addition to the presence of CYP 1A1 and CYP 1B1 in the epidermis, a few dermal cells also showed positive staining of CYP 1A1 and CYP 1B1, but a uniform pattern of staining was not observed. Additionally, CYP 1A1 and CYP 1B1 cellular staining was found in the epidermal epithelium of the hair follicle (data not shown) within the dermis. UVB dose-dependent induction of CYP 1A1 and CYP 1B1 in human skin After establishing the presence of CYP 1A1 and CYP 1B1 in control non-UVB-exposed human skin, we then determined the effect of UVB exposure of human skin on CYP 1A1 and CYP 1B1. We used one to four times the MED of UVB to expose human skin. We found that 48 h after UVB exposure, UVB enhanced the expression of CYP 1A1 and CYP 1B1 and this
enhancement was dose dependent (Fig 1). Maximum induction of CYP 1A1 and CYP 1B1 was found to be at 4 MED of UVB exposure. At 6 MED of UVB exposure, we did not ®nd additional enhancement of the UVB induction of the two CYP compared with exposure of 4 MED of UVB (data not shown). UVB dosedependent induction of CYP 1A1 and 1B1 was not observed in dermal cells, but a few cells were observed to be CYP 1A1 and 1B1 positive, as marked by arrowheads in Figs 1 and 2. Time-dependent induction of CYP 1A1 and CYP 1B1 in human skin by UVB exposure From the UVB dosedependent induction of CYP 1A1 and CYP 1B1 experiments we concluded that 4 MED of UVB exposure resulted in maximum enhancement of CYP 1A1 and CYP 1B1. Therefore, in all further experiments, 4 MED of UVB exposure was employed. Figure 2 demonstrates that UVB exposure (4 MED) of humans resulted in a time-dependent induction of both CYP 1A1 and CYP 1B1 in skin. The maximum increase in both CYP isozymes occurred in the epidermis at 48 h after UVB exposure. As CYP 1A1 and CYP 1B1 were found to be primarily localized to the epidermis, all further studies were conducted with the epidermal cells of the skin. UVB exposure of human skin induces CYP 1A1 and CYP 1B1 mRNA expression To corroborate the results obtained from the UVB dose and time-course experiments, a 4 MED UVB dose and a 48 h time point after UVB exposure were used as the optimum conditions for further studies to demonstrate the effect of UVB exposure on the gene expression of CYP 1A1 and CYP 1B1. The results shown in Fig 3 illustrate the CYP 1A1 and CYP 1B1 PCR products in UVB-exposed and non-UVB-exposed skin. Higher levels of PCR products were evident in UVB-exposed skin than in non-UVB-exposed control skin. Based on computer image analysis, approximately 3.0-fold induction and 2.5-fold induction, respectively, was observed in CYP 1A1 and CYP 1B1 PCR products in UVB-exposed skin compared with PCR products from non-UVB-exposed skin. Similar results were obtained from four different Caucasian individuals examined. The data obtained by RT-PCR also con®rms the observation that UVB exposure of the skin increased the intensity of CYP 1A1 and CYP 1B1 positive cells detected by immunohistochemical analysis. UVB exposure of human skin induces CYP 1A1 and CYP 1B1 protein expression After showing that exposure of human skin to UVB induces the expression of CYP 1A1 and 1B1 in epidermal cells using immunostaining and RT-PCR, we were interested to see whether skin exposure to UVB also induces CYP 1A1 and CYP 1B1 protein expression in the skin. Western blot analysis of microsomal protein from the epidermal cells of nonUVB-exposed skin showed that both CYP 1A1 and CYP 1B1 proteins were readily detectable in the skin, whereas higher levels of CYP 1A1 and CYP 1B1 proteins were detected in the UVBexposed epidermal microsomal protein fraction, as shown in Fig 4. Similar results were obtained when microsomal protein samples from four additional individuals were examined. Further, we also quantitatively analyzed the activity of CYP 1A1 in control and UVB-exposed skin employing the ¯uorescence method (Boulenc et al, 1992). We found that exposure of human skin to 4 MED of UVB signi®cantly induced the enzyme activity of CYP 1A1 in the microsomal fraction of epidermal cells compared with the epidermal cells from non-UVB-exposed skin (Fig 5, p < 0.005). These data are also in accordance with our immunostaining and RT-PCR data, where we have shown that UVB exposure of skin increased the expression of both CYP isozymes compared with non-UVB-exposed control human skin. DISCUSSION Our data clearly demonstrate that CYP 1A1 and CYP 1B1 are expressed in normal human skin, with marked differences in their
VOL. 114, NO. 2 FEBRUARY 2000
UVB INDUCTION OF CYP 1A1 AND 1B1
331
Figure 1. UVB dose-dependent induction of CYP 1A1 and CYP 1B1 in human skin. Immunoperoxidase staining was performed to localize the cellular distribution of CYP 1A1 and CYP 1B1 positive cells in the skin. Six micron sections of control skin or skin exposed to different doses of UVB were stained with either rabbit antihuman CYP 1A1 and rabbit antihuman CYP 1B1 antibodies or the isotype control rabbit IgG. CYP 1A1 localization and UVmediated induction was mainly con®ned to the basal membrane of the epidermis, whereas CYP 1B1 was distributed among the keratinocytes other than the basal cell layer. The immunostaining of CYP 1A1 and CYP 1B1 positive cells is shown in brown. A few CYP 1A1 and CYP 1B1 positive cells were also observed in the dermis, and are marked by arrowheads. The data from immunostaining shown here are representative of four independent experiments conducted on four different individuals. Scale bar: 100 mm.
Figure 2. Time-dependent induction of CYP 1A1 and CYP 1B1 by exposure of human skin to UVB. Immunoperoxidase staining was performed to localize the cellular distribution of CYP 1A1 and CYP 1B1 positive cells in the skin. Six micron sections of control skin or skin after 4 MED of UVB exposure at different time points were stained with either rabbit antihuman CYP 1A1 and rabbit antihuman CYP 1B1 antibodies or the isotype control rabbit IgG. Induction of CYP 1A1 and CYP 1B1 was found to be maximum 48 h after UVB exposure. The immunostaining of CYP 1A1 and CYP 1B1 positive cells is shown in brown. A few CYP 1A1 and CYP 1B1 positive cells were also observed in the dermis, and are marked by arrowheads. The data from immunostaining shown here are representative of four independent experiments conducted on four different individuals. Scale bar: 100 mm.
332
KATIYAR ET AL
Figure 3. UVB exposure of human skin induces CYP 1A1 and CYP 1B1 mRNA expression in epidermal cells. Total RNA was extracted from the epidermal cells from non-UVB-exposed and UVB-exposed skin. mRNA was ampli®ed by RT-PCR as detailed in Materials and Methods. Quantitation of the PCR product signal from UVB-exposed cDNA relative to non-UVB-exposed cDNA was found to be approximately 3-fold in the case of CYP 1A1 and 2.5-fold in CYP 1B1. Representative data with similar results from three similar experiments on different human individuals are presented here.
Figure 4. UVB exposure of human skin induces CYP 1A1 and CYP 1B1 protein expression in epidermal cells. Microsomal protein fraction was isolated from the epidermal cell suspension as described in Materials and Methods. Twenty-®ve micrograms of protein was loaded from each sample for western blot analysis. Polyclonal rabbit antihuman CYP 1A1 and CYP 1B1 antibodies were used as primary antibodies, and peroxidase labeled sheep antirabbit (CYP 1A1) or goat antirabbit (CYP 1B1) antibodies were used as secondary antibodies. Quantitation of the protein bands indicates that an approximate 3-fold induction in CYP 1A1 and CYP 1B1 proteins was observed in UVB-exposed skin (epidermis) compared with non-UVBexposed skin. Representative data with similar results from four similar experiments on different human individuals are presented here.
localization and distribution (Figs 1, 2). We also showed that human skin exposure to UVB induces the expression of CYP 1A1 and CYP 1B1 at the mRNA level (Fig 3) as well as the protein level (Fig 4). It is well known that UV radiation acts as a tumor initiator (Kligman et al, 1980), tumor promoter (Katiyar et al, 1997), and complete carcinogen (Donawho et al, 1991; Ziegler et al,
THE JOURNAL OF INVESTIGATIVE DERMATOLOGY
Figure 5. UVB exposure of human skin induces CYP 1A1 activity in epidermal cells. Epidermal microsomal protein was employed to determine CYP 1A1 activity using the ¯uorescence detection method as described in Materials and Methods. Quantitative analysis of CYP 1A1 indicates that 48 h after UVB exposure of human skin CYP 1A1 activity was increased more than 2-fold in epidermal cells compared to epidermal cells from non-UVB-exposed skin (p < 0.005). Data represent the mean 6 SEM from four similar experiments on different human individuals.
1994). Several investigators have demonstrated that the regulation of CYP 1A1 expression plays a critical role in carcinogenesis, as many chemicals that induce skin CYP 1A1 expression are also initiators of skin tumors in man (Falk et al, 1964). In addition, CYP-1A1-dependent metabolic activation of procarcinogens into reactive carcinogenic metabolites in skin has been reported (Kinoshita and Gelboin, 1972). CYP 1A1 induction occurs in human skin after application of coal tar, which contains many PAH including the potent chemical carcinogen benzo(a)pyrene (Bickers and Kappas, 1978). Benzo(a)pyrene, a ubiquitous environmental pollutant also present in coal tar, possesses skin tumor initiating activity in mice (Mukhtar et al, 1986a) and can cause skin cancer in mice (Wallcave et al, 1971) and man (Falk et al, 1964). Thus a relationship between CYP 1A1 induction and tumorigenesis exists in mice and possibly in humans (Falk et al, 1964; Wallcave et al, 1971). Further, nonmelanoma skin cancer, comprising basal cell and squamous cell carcinomas derived from keratinocytes of the epidermis, are the most frequently diagnosed cancers in Caucasians. These skin cancers are caused by excessive exposure to solar UV radiation, thus making it more plausible that the UV radiation caused an induction of these CYP 1A1 and CYP 1B1 isozymes, which may be responsible for the induction of skin cancers or photocarcinogenesis. CYP 1B1 has been shown to be expressed in a wide variety of malignant tumors of different histogenic types, indicating that this CYP isozyme may be a tumor-speci®c form of P450 (Taylor et al, 1996; Kress and Greenlee, 1997; Murray et al, 1997). Although Murray et al (1997) could not detect the presence of CYP 1B1 in formalin ®xed wax embedded sections of normal human tissues other than skin, we were able to detect the presence of CYP 1B1 in frozen biopsies of normal human skin by immunohistochemistry and RT-PCR, and also its induction by UVB exposure of human skin. Immunostaining of CYP 1B1 also indicates that normal human skin contains a very low level of CYP 1B1 (Fig 1). The presence of CYP 1B1 in many types of cancer suggests that this P450 isozyme may have a crucial endogenous function in tumor cells and that CYP 1B1 might also contribute to the drug resistance that is observed in many types of cancer (Murray et al, 1997). Additionally, CYP 1B1 may also be important in tumor development and progression, because human CYP 1B1 expressed in yeast has been shown to be capable of metabolizing a variety of putative human carcinogens (Shimada et al, 1996). These studies provide ample evidence that induction of CYP 1A1 and CYP 1B1
VOL. 114, NO. 2 FEBRUARY 2000
is involved in cancer incidence. Humans are chronically exposed to solar UV irradiation, which induces CYP-dependent monooxygenase reactions in human skin. Thus, the UVB-caused induction of CYP 1A1 and CYP 1B1 should result in increased bioactivation of environmental pollutants, including cigarette smoke, different allergens, and PAH from automobile exhausts, which will ultimately increase the risk of various skin disorders and skin cancers in humans. Therefore, it is warranted to explore the development of inhibitors of UV-induced CYP expression, which may protect the human skin against the adverse effects of UV irradiation. In our study, we utilized the immunohistochemistry technique to localize the distribution of CYP 1A1 and CYP 1B1 in human skin. This technique ensures the identi®cation of speci®c cell types containing and expressing CYP 1A1 and CYP 1B1 P450 isozymes. This property can be used to detect differential expression of CYP isozymes in malignant versus normal cells within skin tumors, because tumors are composed of a variable proportion of tumor cells and nontumor cells. The presence and expression of CYP 1A1 and CYP 1B1 in different types of malignant tumors have important consequences for both the diagnosis and treatment of cancer. New diagnostic procedures based upon the presence of CYP 1A1 and CYP 1B1 in malignant tumor/cancer cells can be developed, and the expression of these P450 isozymes in tumor cells can provide a molecular target for the development of new anticancer drugs, which would be capable of blocking the UVB induction/activation of CYP 1A1 or CYP 1B1 in UVB-exposed human skin. This work was supported by funds from the Estee Lauder Companies Inc., and Skin Diseases Research Center Core Grant p-30-AR-39750.
REFERENCES Ahmad N, Agarwal R, Mukhtar H: Cytochrome P-450 and drug development for skin diseases. Skin Pharmacol 9:231±241, 1996 Alexander DL, Eltom SE, Jefcoate CR: Ah receptor regulation of CYP 1B1 expression in primary mouse embryo-derived cells. Cancer Res 57:4498±4506, 1997 Baron JM, Zwadlo-Klarwasser G, Jugert F, Hamann W, Rubben A, Mukhtar H, Merk HF: Cytochrome P450 1B1: a major P450 isoenzyme in human blood monocytes and macrophage subsets. Biochem Pharmacol 56:1105±1110, 1998 Bickers DR, Kappas A: Human skin aryl hydrocarbon hydroxylase induction by coal tar. J Clin Invest 62:1061±1068, 1978 Bickers DR, Dutta-Choudhury T, Mukhtar H: Epidermis: a site of drug metabolism in neonatal rat skin. Studies on cytochrome P-450 content and mixed-function oxidase and epoxide hydrolase activity. Mol Pharmacol 1:239±247, 1982 Boring CC, Squires TS, Tong T: Cancer statistics, 1991. CA Cancer J Clin 41:19±36, 1991 Boulenc X, Bourrie M, Fabre I, Roque C, Joyeux H, Berger Y, Fabre G: Regulation of cytochrome P4501A1 gene expression in a human intestinal cell line, Caco-2. J Pharmacol Exp Ther 263:1471±1478, 1992 Bradford M: A rapid and sensitive method for the quanti®cation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 227:248±254, 1976 Brash DE, Rudolph JA, Simon JA, et al: A role for sunlight in skin cancer: UVinduced p53 mutations in squamous cell carcinoma. Proc Natl Acad Sci USA 88:10124±10128, 1991 Conney AH: Induction of microsomal enzymes by foreign chemicals and carcinogenesis by polycyclic aromatic hydrocarbons. GHA Clowes Memorial Lecture. Cancer Res 42:4875±4917, 1982 Donawho CK, Kripke ML: Evidence that the local effect of ultraviolet radiation on the growth of murine melanomas is immunologically mediated. Cancer Res 51:4176±4181, 1991 Falk HL, Kotin P, Mehler A: Polycyclic hydrocarbons as carcinogens for man. Arch Environ Health 8:721±731, 1964 Fuchs E: Epidermal differentiation: The bare essentials. J Cell Biol 111:2807±2814, 1990 Glass AG, Hoover RN: The emerging epidemic of melanoma and squamous cell skin cancer. J Am Med Assoc 262:2097±2100, 1989 Gonzalez FJ: The molecular biology of the cytochrome P 450s. Pharmacol Rev 40:243±288, 1989
UVB INDUCTION OF CYP 1A1 AND 1B1
333
Guo JF, Brown R, Rothwell CE, Bernstein IA: Levels of cytochrome P-450mediated aryl hydrocarbon hydroxylase (AHH) are higher in differentiated than germinative cutaneous keratinocytes. J Invest Dermatol 94:86±93, 1990 Hammerberg C, Duraiswamy N, Cooper KD: Reversal of immunosuppression inducible through ultraviolet-exposed skin by in vivo anti-CD11b treatment. J Immunol 157:5254±5261, 1996 Hankinson O: The aryl hydrocarbon receptor complex. Annu Rev Pharmacol Toxicol 35:307±340, 1995 Ioannides C, Parke DV: The cytochrome P450, 1 gene family of microsomal hemoproteins and their role in the metabolic activation of chemicals. Drug Metab Rev 22:1±85, 1990 Jones CL, Reiners JJ Jr: Differentiation status of cultured murine keratinocytes modulates induction of genes responsive to 2,3,7,8-tetrachlorodibenzo-pdioxin. Arch Biochem Biophys 347:163±173, 1997 Kang K, Kubin M, Cooper KD, Lessin SR, Trinchieri G, Rook AH: IL-12 synthesis by human Langerhans cells. J Immunol 156:1402±1407, 1996 Katiyar SK, Agarwal R, Mukhtar H: Introduction: sources, occurrence, nomenclature, and carcinogenicity of polycyclic aromatic hydrocarbons. In: Rathore HS ed. Handbook of Chromatography. Boca Raton, FL, CRC Press, 1993, pp 1±17 Katiyar SK, Korman NJ, Mukhtar H, Agarwal R: Protective effects of silymarin against photocarcinogenesis in a mouse skin model. J Natl Cancer Inst 89:556± 566, 1997 Kinoshita N, Gelboin HV: The role of aryl hydrocarbon hydroxylase in 7,12dimethylbenz (a) anthracene skin tumorigenesis: on the mechanism of 7,8benza¯avone inhibition of tumorigenesis. Cancer Res 32:1329±1339, 1972 Kligman LH, Akin FJ, Kligman AM: Sunscreens prevent ultraviolet photocarcinogenesis. J Am Acad Dermatol 3:30±35, 1980 Kress S, Greenlee WF: Cell-speci®c regulation of human CYP1A1 and CYP1B1 genes. Cancer Res 57:1264±1269, 1997 Marikar Y, Wang ZQ, Duell EA, Petkovich M, Voorhees JJ, Fisher GJ: Retinoic acid receptors regulate expression of retinoic acid 4-hydroxylase that speci®cally inactivates all-trans retinoic acid in human keratinocyte HaCaT cells. J Invest Dermatol 111:434±439, 1998 Mukhtar H, Link CM, Cherniack E, Kushiner DM, Bickers DR: Effect of topical application of de®ned constituents of coal tar on skin and liver aryl hydrocarbon hydroxylase and 7-ethoxycoumarin deethylase activities. Toxicol Appl Pharmacol 64:541±549, 1982 Mukhtar H, Das M, Bickers DR: Skin tumor initiating activity of therapeutic crude coal tar as compared to other polycyclic aromatic hydrocarbons in SENCAR mice. Cancer Lett 31:147±151, 1986a Mukhtar H, DelTito BJ Jr, Matgouranis PM, Das M, Asokan P, Bickers DR: Additive effects of ultraviolet B and crude coal tar on cutaneous carcinogen metabolism: possible relevance to the tumorigenicity of the Goeckerman regimen. J Invest Dermatol 87:348±353, 1986b Murray GI, Taylor MC, McFadyen MC, McKay JA, Greenlee WF, Burke MD, Melvin WT: Tumor-speci®c expression of cytochrome P450 CYP1B1. Cancer Res 57:3026±3031, 1997 Nebert DW: Drug-metabolizing enzymes in ligand-modulated transcription. Biochem Pharmacol 47:25±37, 1994 Nelson DR, Koymans L, Kamataki T, et al: P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 6:1±42, 1996 Nerurkar PV, Park SS, Thomas PE, Nims RW, Lubet RA: Methoxyresoru®n and benzyloxyresoru®n: substrates preferentially metabolized by cytochromes P4501A2 and 2B, respectively, in the rat and mouse. Biochem Pharmacol 46:933±943, 1993 Raza H, Agarwal R, Bickers DR, Mukhtar H: Puri®cation and molecular characterization of b-naphtho¯avone inducible cytochrome P450 from rat epidermis. J Invest Dermatol 98:233±240, 1992 Reiners JJ Jr, Cantu AR, Thai G, Scholler A: Differential expression of basal and hydrocarbon-induced cytochrome P450 monooxygenase and quinone reductase activities in subpopulations of murine epidermal cells differing in their stages of differentiation. Drug Metab Dispos 20:360±366, 1992 Shimada T, Hayes CL, Yamazaki H, Amin S, Hecht SS, Guengerich FP, Sutter TR: Activation of a chemically diverse procarcinogens by human cytochrome P450 1B1. Cancer Res 56:2979±2984, 1996 Stauber KL, Laskin JD, Yurkow EJ, Thomas PE, Laskin DL, Conney AH: Flow cytometry reveals subpopulations of murine epidermal cells that are refractory to induction of cytochrome P-450 1A1 by b±naphtho¯avone. J Pharmacol Exp Ther 273:967±976, 1995 Taylor MC, McKay JA, Murray GI, Greenlee WF, Marcus CB, Burke MD, Melvin WT: Cytochrome P450 1B1 expression in human malignant tumours. Biochem Soc Trans 24:328S±333S, 1996 Wallcave L, Garcia H, Feldman R, Lijinsky W, Shubik P: Skin tumorigenesis in mice by petroleum asphalts and coal-tar pitches of known polynuclear aromatic hydrocarbon content. Toxicol Appl Pharmacol 18:41±52, 1971 Whitlock JP Jr: Mechanistic aspects of dioxin action. Chem Res Toxicol 6:754±763, 1993 Ziegler A, Jonason AS, Leffell DJ: Sunburn p53 in the onset of skin cancer. Nature 372:773±776, 1994