- Email: [email protected]
Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system Shogo Hori, Osamu Saitoh* Department of Animal Bio-Science, Faculty of Bio-Science, Nagahama Institute of Bio-Science and Technology, 1266 Tamura-cho, Nagahama-shi, Shiga, 5260829, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 10 October 2019 Accepted 31 October 2019 Available online xxx
The thermosensation mechanism plays critical roles in various animals living in different thermal environment. We focused on an axolotl, which is a tailed amphibian originally from Lake Xochimilco area in the Vally of Mexico, and examined its behavior response to heat stimulation. Mild heat at 33 C induced noxious locomotive activity to axolotls, but the noxious response of another tailed amphibian, Iberian ribbed newt, was not observed at 33 C. To explore the mechanism for the temperature sensitivity of axolotls, we isolated a cDNA of TRPV1. Using the degenerate primer PCR method, we identified the DNA fragment encoding axolotl TRPV1 (axTRPV1), and then cloned a full-length cDNA. We studied the chemical and thermal sensitivities of axTRPV1 by two-electrode voltage clamp method using Xenopus oocyte expression system. Capsaicin, acid, and 2-aminoethoxydiphenylborane apparently activated axTRPV1 channels in a dose-dependent manner. The analysis of thermal sensitivity showed that axTRPV1 was significantly activated by heat but not by cold. The average temperature threshold for heat-activation was 30.95 ± 0.12 C. This thermal activation threshold of axTRPV1 is unique and significantly low, when compared with the known thresholds of TRPV1s from various animals. Further, this threshold of axTRPV1 is well consistent with the observation of heat-induced behavior of axolotls at 33 C, demonstrating that axolotl shows noxious response to mild heat mediated through axTRPV1. © 2019 Elsevier Inc. All rights reserved.
Keywords: Transient receptor potential Channel Neuron Thermosensing Amphibian
1. Introduction Thermal perception is one of essential sensory systems for animal survival. Subsets of ion channels of transient receptor potential (TRP) family function as thermal sensors and play central roles in the thermosensory system of most animals (thermoTRPs). In mammals, they belong to TRPA (TRPA1), TRPV (TRPV1-TRPV4), and TRPM (TRPM2, TRPM4, TRPM5, TRPM8) subfamilies and different thermoTRPs are known to be specifically activated at distinctive ranges of temperature [1]. Especially, TRPA1 and TRPV1 are mainly expressed in nociceptive sensory neurons and act as sensors for noxious thermal and chemical stimuli [2e4]. Recently, TRPA1 has been cloned from diverse animal species, and its functional analysis showed that there are significant variations in thermal and chemical sensitivities among various TRPA1s.
Abbreviations: TRP, transient receptor potential; axTRPV1, axolotl TRPV1; 2-APB, 2-aminoethoxydiphenyl borate. * Corresponding author. E-mail address: [email protected] (O. Saitoh).
Although chemical sensitivity to AITC (allyl isothiocyanate) and cinnamaldehyde is approximately conserved among various animals, some chemical ligands differently activate rodent and human TRPA1s [5e7]. Further, frog TRPA1 is much less sensitive to methyl anthranilate (MA) than TRPA1s from human, mouse [8], and axolotl, tailed amphibian [9]. Our previous report indicated that autooxidized EGCG (epigallocatechin gallate) activates mammalian TRPA1s, but not chicken TRPA1 [10]. In case of thermal sensitivity, cold temperature activates rodent TRPA1 [11e15], but it does not activate the human and rhesus monkey TRPA1s [15]. For other animals, it has been demonstrated that TRPA1s from several tetrapod vertebrates (frogs, lizards, snakes and chickens) are heatactivated with distinct temperature thresholds [8,16,17]. In case of TRPV1, it is known that the sensitivity to capsaicin varies among animal species. Human and rodent TRPV1s show high sensitivity to capsaicin, but TRPV1s from rabbit, chicken, tropical clawed frog, and zebrafish are much less sensitive to capsaicin [18e21]. In addition, TRPV1 is generally heat-activated through many animal species, whereas heat-sensitivity of TRPV1 has been found to be lost in ground squirrel and camel to withstand high
https://doi.org/10.1016/j.bbrc.2019.10.203 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: S. Hori, O. Saitoh, Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.203
2
S. Hori, O. Saitoh / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
environmental temperature [22]. Further, Saito et al. analyzed functional properties of TRPV1 and TRPA1 of closely related two Xenopus species (Xenopus leavis and Xenopus tropicalis) [23]. X. leavis inhabits cooler region than X. tropicalis in Africa, and the optical temperature range differs between the two species. They reported that the thermal activation threshold of X. leavis TRPA1 was significantly lower than X. tropicalis TRPA1. The heat activation thresholds of TRPV1s of the two species were nearly the same, but the heat activation of X. leavis TRPV1 was much faster than X. tropicalis TRPV1. These functional properties of TRP channels are well consistent with behavioral responses to heat of the two species of frogs. These observations demonstrate that functional changes in thermal sensors contribute to the diversity of thermal sensation among various animal species, suggesting that the appropriate tuning of thermoTRPs must play critical roles in the survival strategy during the course of evolution and environmental adaptation of diverse animals. To approach the mechanism of this evolutional adaptation, we focused on axolotl, a member of the order of Urodela or tailed amphibians. Axolotl is endemic to the Lake Xochimilco area in the Vally of Mexico, and its water temperature is between 16 and 20 C. It is known that the optical temperature for laboratory housing of axolotl is between 16 and 20 C. This animal is neotenic, can breed in adult larval form, and spend its whole life in water [24]. To understand the sensing system for environmental temperature of this unique animal, we first cloned a cDNA encoding TRPA1 from axolotl and examined the functional properties. Axolotl TRPA1 was heat-activated, but the heat-activation threshold was about 40 C [9]. In case of axolotl, it was considered that TRPA1 might not function as a primary noxious sensor for environmental heat. Here, we first examined thermal response of axolotls and found that noxious behavior was induced by mild heat at 33 C. Then, to explore whether another main noxious thermal sensor, TRPV1 might contribute the environmental adaptation of axolotl, we isolated a cDNA of TRPV1 from axolotl. Using the degenerate primer PCR method, we identified the DNA fragment encoding axolotl TRPV1 (axTRPV1), and then cloned a full-length cDNA. We studied the chemical and thermal sensitivities of axTRPV1 by two-electrode voltage clamp method using Xenopus oocyte expression system.
(ThermoFisher Scientific) and sequenced. The expected sequence was obtained, and therefore the sequence information of a fulllength cDNA of axTRPV1 was determined using GeneRacer™ kit (Invitrogen™). We used the following nested primers. Nested Forward: 50 - ATGCAGGTCAACCTTCACACCA -30 Nested Reverse: 50 - CAGTGAGTCTCTGGTTCACACA -30 The axTRPV1 cDNA (3721 bp) encodes a protein of 858 amino acids (accession number: LC505037). For Xenopus oocyte expression, this cDNA was cloned into pGEMHE, which included the 50 and 3’ non-coding sequence of the Xenopus b-globin gene [27]. 2.3. RT-PCR assay Total RNA was isolated from various tissues and developing axolotls using TRIzol reagent (Invitrogen™) and subjected to reverse transcription with random primers. The reversetranscribed cDNA was used as a template for PCR. Total RNA treated under the same conditions without reverse-transcriptase was used as a negative control. The primers used were as follows: for b-actin, Forward 50 -GATGATATTGCCGCACTCGTTGTTG-30 Revers 50 - CTGTGTTGGCATACAAGTCTTTTCG-30 for axTRPV1, Forward 50 -TAAGTGGGACCGATTTGTCAAGCGC-30 Reverse 50 -CAAGTTGTTGTAGGACTCCG-30 PCR products were analyzed on 1% agarose gels. 2.4. Electrophysiology
Total RNA was isolated brain of adult of axolotl, Ambystoma mexicanum and reverse-transcribed cDNA was prepared with random primers. Seebacher and Murray developed degenerate primer sets to amplify TRPV1 cDNA fragment from several animal species [26], we used the following primers to amplify the partial cDNA of axolotl TRPV1 (axTRPV1).
An outline of the methods employed in electrophysiological experiments using Xenopus oocytes was described previously [20]. After injecting 50 nl of TRPV1 cRNA (0.1 mg/ml), oocytes were incubated in frog Ringer solution at 17 C for 3e4 days. Ionic currents were recorded by the two-electrode voltage clamp method. The recording bath solution contained 96 mM NaCl, 2 mM KCl, 3 mM MgCl2, 5 mM HEPES and 2 mM NaOH at pH 7.4. Oocytes were voltage-clamped at 20 mV. Current data was obtained using 400 ms step pulse from 80 mV for 100 ms to þ40 mV for 100 ms applied every 1 s. When experiments for thermal stimulation were performed, to achieve quick cold stimulation, 5 ml of the ice-cooled bath solution was applied for 14 s using an adjustable electronic pipette (Gilson Pipetman Concept C5000) to the bath. For heat stimulation, the bath solution heated by an in-line heater controller (CL-100, Warner Instruments) was applied by perfusion. Temperature thresholds were determined as described previously by Gracheva et al. [16]. Temperature thresholds represent the point of intersection between linear fits to baseline and the steepest component of the Arrhenius profile. Arrhenius curve was obtained by plotting the current at 80 mV on a log-scale against the reciprocal of the absolute temperature.
F 50 CARGACAARTGGGACMGATT 30
2.5. Behavioral experiments
R 50 TAWATGCCCATCWGCTGRA 30
An axolotl or an Iberian ribbed newt (RN) was placed into a metallic tray (15 cm 21 cm) with 500 ml of the chlorine-free tap water pre-warmed at 25 C, 33 C, or 39 C. We monitored the
2. Materials and methods 2.1. Experimental animals All of the animal experiments described below conformed to the institutional guidelines and were approved by the Animal Experiment Committee of Nagahama Institute of Bio-Science and Technology. Xenopus oocyte preparation has been described previously [25]. 2.2. Axolotl TRPV1 cDNA
The PCR product was cloned into pCR™4 Blunt-TOPO vector
Please cite this article as: S. Hori, O. Saitoh, Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.203
S. Hori, O. Saitoh / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
locomotor activity of animal using video camera. After placing into the pre-warmed tap water, heat-induced movements per 2 s (axolotl) or 1 s (NR) were measured during 20e60 s and the mean movement (cm) per 1 min was calculated. 2.6. Statistical analyses The values and error bars shown in the figures indicate mean and standard errors. The Statistical significance for difference of two groups was determined by Student’s unpaired t-test. For multiple groups, we performed the Tukey-Kramer method. To highlight the presence of the statistical significance, we indicated by * (p < 0.05), ** (p < 0.01), and *** (p < 0.001) for the focused groups. 3. Results 3.1. Behavioral responses to heat of axolotl and iberian ribbed newt
3
and zebrafish TRPV1 respectively. We created a phylogenetic tree of TRPV1s including axTRPV1 by the maximum likelihood method. Result demonstrated that the vertebrate TRPV1s are divided into three groups (Supplementary Fig. 1). One group contains mammalian, avian and reptile TRPV1s, another group contains amphibian TRPV1s, and the other group contains fish TRPV1s. It is apparent that axTRPV1 is most close to the frog TRPV1. We next examined the expression levels of axTRPV1 mRNA in various tissues. Total RNA was isolated from various tissues of axolotls and RT-PCR analysis was performed. The expression of axTRPV1 was easily detected in the brain, and but weak expression was observed in the skin and the muscle (Fig. 2A). We also analyzed the expression of axTRPV1 in developing embryos (St.32 (late tailbud), St.40 (pre-hatching)) and hatching larvae (Hatch). The low level of expression of axTRPV1 mRNA was detected at st.32, and the expression level increased at st. 40 and Hatch (Fig. 2B). The axTRPV1 cDNA was cloned into the oocyte expression
It is known that the optimal water temperature of axolotl is 16e20 C, whereas, for Iberian ribbed newt (Pleurodeles waltl, RN), another tailed amphibian, the favorable temperature of the water ranges between 15 and 28 C [28]. We studied noxious effects of mild heat (33 C) on axolotl behavior and compared with effects on behavior of RN. One adult of axolotl or RN was placed into a metallic tray with the tap water at 25 C or 33 C. The heat-induced locomotor activity was examined (Fig. 1). Movements of axolotl were significantly elicited by stimulation with mild heat at 33 C, but movements of RN were not significantly elicited by 33 C. Movements of RN was induced at 39 C. These results suggested that even mild heat evokes nocifensive behavior of axolotl, which is consistent with the relatively cool climate of its original habitat [24]. 3.2. Chemical sensitivity of axolotl TRPV1 We isolated a full-length cDNA of TRPV1 from axolotl, Ambystoma mexicanum. The coding sequence of axolotl TRPV1 (axTRPV1) consisted of 2577 bp, resulting in 858 amino acids (accession number: LC505037). The amino acid sequence of axTRPV1 exhibited, 62.4, 62.5, 67.5, 71, 43.9, and 45.2% identity to human TRPV1, mouse TRPV1, chicken TRPV1, X. tropicalis TRPV1, medaka TRPV1,
Fig. 2. The expression of axolotl TRPV1. (A) Total RNA was isolated from various tissues and subjected to reverse transcription with random primers. The reverse-transcribed cDNA was used as a template for PCR (þ). Total RNA treated under the same conditions without reverse-transcriptase was used as a negative control (). The primers used for b-actin and axolotl TRPV1 were described in the section of Materials and Methods (B) Total RNA was isolated from developing embryos (st.32 (late tailbud), st.40 (prehatching)) and hatching larvae (Hatch) and the expression of b-actin and axTRPV1 was examined as indicated above.
Fig. 1. Behavior response to heat of axolotls. An axolotl or an Iberian ribbed newt (RN) was placed into a metallic tray with pre-warmed (25 C, 33 C, or 39 C) the tap water. Heat-induced movements per 2 s (axolotl: n ¼ 4) or 1 s (NR: n ¼ 3) were measured and the mean movement (cm/min) was calculated. Statistical significance for differences between two groups was determined by Student’s unpaired t-test and was indicated by * (p < 0.05) and ** (p < 0.01).
Please cite this article as: S. Hori, O. Saitoh, Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.203
4
S. Hori, O. Saitoh / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
vector, pGEMHE and the sensitivities to chemical stimuli were examined by electrophysiological analysis of a two-electrode voltage clamp using Xenopus oocytes. Capsaicin (10 mMe100 mM), acid (pH6-pH4), and 2-aminoethoxydiphenylborane (2-APB, 100 mMe1000 mM) apparently activated axTRPV1 channels in a dose-dependent manner (Fig. 3). When compared with X. tropicalis TRPV1 (wcTRPV1), it seems that acid similarly activated both amphibian TRPV1s, but that the sensitivity of axTRPV1 to capsaicin was rather higher than that of wcTRPV1 [20]. EC50 of capsaicin to activate wcTRPV1 was reported to be 85.4 mM, but we estimated that EC50 of capsaicin for activation of axTRPV1was 14.4 mM. We next examined effects of TRPV1 blockers on capsaicin-activation of axTRPV1 (Supplementary Fig. 2). SB366791(SB) and capsazepin were used. SB could not inhibit the axTRPV1 activation.
significant currents were observed in response to heat stimulation. Heat activation of axTRPV1 was observed from relatively low temperature around 30 C. Mean peak currents induced at 30 C were compared (Fig. 4B). In the plot of the elicited inward current amplitudes as a function of temperature (Fig. 4C), we observed response of oocytes expressing axTRPV1 above about 30 C. Based on the Arrhenius plot of axTRPV1 (Fig. 4D), the temperature threshold for activation by heat stimulation was determined to be 31.4 C. The average of the temperature threshold of oocytes expressing axTRPV1 in the same batch was 30.95 ± 0.12 C. Analysis of the current-voltage relationship demonstrated that heat produced currents of axTRPV1 that showed the outward rectification (Fig. 4E). Further, even at 20 C, voltage-dependent activation of axTRPV1 was apparently observed.
3.3. Thermal sensitivity of axolotl TRPV1
4. Discussion
We electrophysiologically examined the thermal sensitivity of axTRPV1 using Xenopus oocytes (Fig. 4A). In oocytes expressing axTRPV1, cold stimulation could not activate axTRPV1, but
In this study, we focused on axolotl, tailed amphibian which breeds in the aquatic and larval form, and the optical temperature is relatively low ranging between 16 and 20 C. We first observed that
Fig. 3. Chemical response of oocytes expressing axolotl TRPV1 (A) Effects of capsaicin on ionic currents in Xenopus oocytes expressing axTRPV1 were examined. 1 mMe100 mM capsaicin were used. Average current at 30 s after capsaicin stimulation was plotted as a function of chemical concentration. Each data point represents the mean ± S. E (n ¼ 5). (B) Effects of acid on ionic currents of axTRPV1 were similarly examined and analyzed (n ¼ 5). (C) Effects of 2-aminoethoxydiphenyl borate (2-APB) on ionic currents of axTRPV1 were similarly examined and analyzed (n ¼ 5).
Please cite this article as: S. Hori, O. Saitoh, Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.203
S. Hori, O. Saitoh / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 4. Thermal sensitivities of axolotl TRPV1 (A) Effects of cold and heat stimulation on ionic currents in Xenopus oocytes expressing axTRPV1 were examined. Experimental conditions were as described in the materials and methods section. (B) Peak average currents for heat stimulation at 30 C were compared. Each data point represents the mean ± S. E (n ¼ 8). Statistical significance for difference was determined by Student’s unpaired t-test and was indicated by *** (p < 0.001). (C) The elicited currents at 80 mV shown in (A) were plotted as a function of temperature. (D) Arrhenius plots of the current of axTRPV1 elicited by heat stimulation. (E) Electrophysiological response of oocytes expressing axTRPV1 to the bath solution at 20 C, 25 C, 30 C, and 35 C. Voltage ramps from 100 mV to þ100 mV were applied every 2 s.
even mild heat (33 C) evokes nocifensive behavior of axolotl, and then isolated its TRPV1 cDNA to study the chemical and thermal sensitivity by electrophysiological method using Xenopus oocytes. The analysis of chemical sensitivity of axTRPV1 showed that capsaicin, acid, and 2-APB can activate axTRPV1. Especially, we noticed that axTRPV1 is more sensitive to capsaicin, when compared to the sensitivity of TRPV1 from western clawed frog
(wc) [20]. It has been reported that two amino acids, Ser (S)-512 and Thr (T)-550, located in the third and fourth putative transmembrane domains in capsaicin-sensitive TRPV1 (human and rhodents) are important for the capsaicin-sensitivity [18,19]. On the other hand, the corresponding two amino acids of wcTRPV1 were changed to tyrosine (Y)-523 and alanine (A)-561, and mutagenesis analysis demonstrated that these two amino acids in wcTRPV1 are
Please cite this article as: S. Hori, O. Saitoh, Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.203
6
S. Hori, O. Saitoh / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
responsible for the low sensitivity to capsaicin [20]. When compared with the amino acid sequence of axTRPV1, we found that S-512 of capsaicin-sensitive TRPV1 is conserved, but T-550 is changed to Valine (V). Although further experiments are required, it is considered that these two amino acids of axTRPV1 (S525, V563) may contribute to the sensitivity of axTRPV1 to capsaicin. We then examined whether capsaicin indeed may induce noxious effects on axolotl behavior. The irritant-induced locomotor activity was observed with 10 mM capsaicin, suggesting involvement of activation of axTRPV1 (data not shown). The electrophysiological analysis of thermal sensitivity indicated that cold stimulation could not activate axTRPV1, but heat stimulation significantly activated it. The Arrhenius plot of axTRPV1-mediated currents demonstrated that the average temperature threshold for heat-activation was 30.95 ± 0.12 C. TRPV1 was cloned from mammals, birds, and frogs, and their thermalactivation properties have been studied. It was reported that rodent TRPV1 was heat-activated with the threshold of 43 C [29], the heat activation threshold of chick TRPV1 was 45 C [18], and the temperature thresholds for heat-activation of TRPV1 from Xenopus leavis and Xenopus tropicalis were similarly about 41 C (40.5 C, 40.8 C, [30]). Compared with these reported thresholds for heatactivation of TRPV1s, it is apparent that the threshold of axTRPV1 is significantly low. It has been demonstrated that vampire bats (vb) express a ganglion-specific splicing variant of TRPV1 in addition to normal TRPV1 molecule. This TRPV1 variant lacks 62 amino acids from carboxy terminus. Although long normal form of vb TRPV1(TRPV1-L) was heat-activated at the threshold of 40 C, it was found that alternative splicing of TRPV1 transcripts lowered its thermal activation threshold to 30 C [31]. Since this splicing variant of TRPV1 was found in other animals, it is possible that axTRPV1 might have the truncated carboxy terminus. Sequence alignment, however, indicated that the corresponding amino acids were present in the carboxy terminus of axTRPV1. Therefore, there may be a different molecular mechanism determining the low temperature threshold for heat-activation of axTRPV1. By study on the noxious effects of mild heat on axolotl behavior, we showed that the heat-induced locomotor activity was induced at 33 C but not at 25 C. This observation is well consistent with the thermal threshold at about 31 C determined by electrophysiological analysis of axTRPV1. It is strongly suggested that axolotl shows noxious response to mild heat mediated through axTRPV1. At next stage, we have to explore how axTRPV1 can recognize apparently lower temperature threshold. Acknowledgements This work was supported by JSPS KAKENHI, Japan (Grant No. 16K07305 to O. S.), as well as a grant from the Cooperative Study Program of National Institute for Physiological Sciences, Japan (to O. S.). Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.10.203 Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.10.203. References [1] S. Saito, M. Tominaga, Functional diversity and evolutionary dynamics of
thermoTRP channels, Cell Calcium 57 (2015) 214e221. [2] A. Patapoutian, A.M. Peier, G.M. Story, V. Viswanath, ThermoTRP channels and beyond: mechanisms of temperature sensation, Nat. Rev. Neurosci. 4 (2003) 529e539. [3] M. Bandell, L.J. Macpherson, A. Patapoutian, From chills to chilis: mechanisms for thermosensation and chemesthesis via thermoTRPs, Curr. Opin. Neurobiol. 17 (2007) 490e497. [4] M. Tominaga, The role of TRP channels in thermosen- sation, in: W.B. Liedtke, S. Heller (Eds.), TRP Ion Channel Function in Sensory Transduction and Cellular Signaling Cascades. Frontiers in Neuroscience, CRC Press, Boca Raton, FL, 2007. [5] K. Nagatomo, Y. Kubo, Caffeine activates mouse TRPA1 channels but suppresses human TRPA1 channels, Proc. Natl. Acad. Sci. U.S.A. 105 (2008) 17373e17378. [6] J. Chen, X.-F. Zhang, M.E. Kort, J.R. Huth, C. Sun, L.J. Miesbauer, S.C. Cassar, T. Neelands, V.E. Scott, R.B. Moreland, R.M. Reilly, P.J. Hajduk, P.R. Kym, C.W. Hutchins, C.R. Faltynek, Molecular determinants of species-specific activation or blockade of TRPA1 channels, J. Neurosci. 28 (2008) 5063e5071. [7] B. Xiao, A.E. Dubin, B. Bursulaya, V. Viswanath, T.J. Jegla, A. Patapoutian, Identification of transmembrane domain 5 as a critical molecular determinant of menthol sensitivity in mammalian TRPA1 channels, J. Neurosci. 28 (2008) 9640e9651. [8] S. Saito, N. Banzawa, N. Fukuta, C.T. Saito, K. Takahashi, T. Imagawa, T. Ohta, M. Tominaga, Heat and noxious chemical sensor, chicken TRPA1, as a target of bird repellents and identification of its structural determinants by multispecies functional comparison, Mol. Biol. Evol. 31 (2014) 708e722. [9] M. Oda, H. Ogino, Y. Kubo, O. Saitoh, Functional properties of axolotl transient receptor potential ankyrin 1 revealed by the heterologous expression system, Neuroreport 30 (2019) 323e330. [10] M. Kurogi, Y. Kawai, K. Nagatomo, M. Tateyama, Y. Kubo, O. Saitoh, Autooxidation products of epigallocatechin gallate activate TRPA1 and TRPV1 in sensory neurons, Chem. Senses 40 (2015) 27e46. [11] M. Bandell, G.M. Story, S.W. Hwang, V. Viswanath, S.R. Eid, M.J. Petrus, T.J. Earley, A. Patapoutian, Noxious cold ion channel TRPA1 is activated by pungent compounds and bradykinin, Neuron 41 (2004) 849e857. [12] G.M. Story, A.M. Peier, A.J. Reeve, S.R. Eid, J. Mosbacher, T.R. Hricik, T.J. Earley, A.C. Hergarden, D.A. Andersson, S.W. Hwang, P. McIntyre, T. Jegla, S. Bevan, A. Patapoutian, ANKTM1, a TRP-like channel expressed in nociceptive neurons, is activated by cold temperatures, Cell 112 (2003) 819e829. [13] K.Y. Kwan, A.J. Allchorne, M.A. Vollrath, A.P. Christensen, D.-S. Zhang, C.J. Woolf, D.P. Corey, TRPA1 contributes to cold, mechanical, and chemical nociception but is not essential for hair-cell transduction, Neuron 50 (2006) 277e289. [14] Y. Karashima, K. Talavera, W. Everaerts, A. Janssens, K.Y. Kwan, R. Vennekens, B. Nilius, T. Voets, TRPA1 acts as a cold sensor in vitro and in vivo, Proc. Natl. Acad. Sci. U.S.A. 106 (2009) 1273e1278. [15] J. Chen, D. Kang, J. Xu, M. Lake, J.O. Hogan, C. Sun, K. Walter, B. Yao, D. Kim, Species differences and molecular determinant of TRPA1 cold sensitivity, Nat. Commun. 4 (2013) 2501. [16] E.O. Gracheva, N.T. Ingolia, Y.M. Kelly, J.F. Cordero-Morales, G. Hollopeter, A.T. Chesler, E.E. Sanchez, J.C. Perez, J.S. Weissman, D. Julius, Molecular basis of infrared detection by snakes, Nature 464 (2010) 1006e1011. [17] S. Saito, K. Nakatsuka, K. Takahashi, N. Fukuta, T. Imagawa, T. Ohta, M. Tominaga, Analysis of transient receptor potential ankyrin 1 (TRPA1) in frogs and lizards illuminates both nociceptive heat and chemical sensitivities and coexpression with TRP vanilloid 1 (TRPV1) in ancestral vertebrates, J. Biol. Chem. 287 (2012) 30743e30754. [18] S.E. Jordt, D. Julius, Molecular basis for species-specific sensitivity to "hot" chili peppers, Cell 108 (2002) 421e430. [19] N.R. Gavva, L. Klionsky, Y. Qu, L. Shi, R. Tamir, S. Edenson, T.J. Zhang, V.N. Viswanadhan, A. Toth, L.V. Pearce, T.W. Vanderah, F. Porreca, P.M. Blumberg, J. Lile, Y. Sun, K. Wild, J.-C. Louis, J.J.S. Treanor, Molecular determinants of vanilloid sensitivity in TRPV1, J. Biol. Chem. 279 (2004) 20283e20295. [20] M. Ohkita, S. Saito, T. Imagawa, K. Takahashi, M. Tominaga, T. Ohta, Molecular cloning and functional characterization of Xenopus tropicalis frog transient receptor potential vanilloid 1 reveal its functional evolution for heat, acid, and capsaicin sensitivities in terrestrial vertebrates, J. Biol. Chem. 287 (2012) 2388e2397. [21] P. Gau, J. Poon, C. Ufret-Vincenty, C.D. Snelson, S.E. Gordon, D.W. Raible, A. Dhaka, The zebrafish ortholog of TRPV1 is required for heat-induced locomotion, J. Neurosci. 33 (2013) 5249e5260. [22] W.J. Laursen, E.R. Schneider, D.K. Merriman, S.N. Bagriantsev, E.O. Gracheva, Low-cost functional plasticity of TRPV1 supports heat tolerance in squirrels and camels, Proc. Natl. Acad. Sci. U.S.A. 113 (2016) 11342e11347. [23] S. Saito, M. Ohkita, C.T. Saito, K. Takahashi, M. Tominaga, T. Ohta, Evolution of heat sensors drove shifts in thermosensation between Xenopus species adapted to different thermal niches, J. Biol. Chem. 291 (2016) 11446e11459. [24] J.E. Farkas, J.R. Monaghan, Housing and maintenance of Ambystoma mexicanum, the Mexican axolotl, Methods Mol. Biol. 1290 (2015) 27e46. [25] M. Oda, K. Saito, S. Hatta, Y. Kubo, O. Saitoh, Chemical and thermal sensitivity of medaka TRPA1 analyzed in heterologous expression system, Biochem. Biophys. Res. Commun. 494 (2017) 194e201. [26] F. Seebacher, S.A. Murray, Transient receptor potential ion channels control thermoregulatory behaviour in reptiles, PLoS One 2 (2007) e281. [27] J. Tytgat, J. Vereecke, E. Carmeliet, Reversal of rectification and alteration of
Please cite this article as: S. Hori, O. Saitoh, Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.203
S. Hori, O. Saitoh / Biochemical and Biophysical Research Communications xxx (xxxx) xxx selectivity and pharmacology in a mammalian Kv1.1 potassium channel by deletion of domains S1 to S4, J. Physiol. 481 (1994) 7e13. [28] A. Joven, M. Kirkham, A. Simon, Husbandry of Spanish ribbed newts, Methods Mol. Biol. 1290 (2015) 47e70. [29] M.J. Caterina, M.A. Schumacher, M. Tominaga, T.A. Rosen, J.D. Levine, D. Julius, The capsaicin receptor: a heat-activated ion channel in the pain pathway, Nature 389 (1997) 816e824.
7
[30] S. Saito, M. Ohkita, C.T. Saito, K. Takahashi, M. Tominaga, T. Ohta, Evolution of heat sensors drove shifts in thermosensation between Xenopus species adapted to different thermal niches, J. Biol. Chem. 291 (2016) 11446e11459. [31] E.O. Gracheva, J.F. Cordero-Morales, J.A. Gonz alez-Carcacía, N.T. Ingolia, C. Manno, C.I. Aranguren, J.S. Weissman, D. Julius, Ganglion-specific splicing of TRPV1 underlies infrared sensation in vampire bats, Nature 476 (2011) 88e91.
Please cite this article as: S. Hori, O. Saitoh, Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.203
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system Shogo Hori, Osamu Saitoh* Department of Animal Bio-Science, Faculty of Bio-Science, Nagahama Institute of Bio-Science and Technology, 1266 Tamura-cho, Nagahama-shi, Shiga, 5260829, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 10 October 2019 Accepted 31 October 2019 Available online xxx
The thermosensation mechanism plays critical roles in various animals living in different thermal environment. We focused on an axolotl, which is a tailed amphibian originally from Lake Xochimilco area in the Vally of Mexico, and examined its behavior response to heat stimulation. Mild heat at 33 C induced noxious locomotive activity to axolotls, but the noxious response of another tailed amphibian, Iberian ribbed newt, was not observed at 33 C. To explore the mechanism for the temperature sensitivity of axolotls, we isolated a cDNA of TRPV1. Using the degenerate primer PCR method, we identified the DNA fragment encoding axolotl TRPV1 (axTRPV1), and then cloned a full-length cDNA. We studied the chemical and thermal sensitivities of axTRPV1 by two-electrode voltage clamp method using Xenopus oocyte expression system. Capsaicin, acid, and 2-aminoethoxydiphenylborane apparently activated axTRPV1 channels in a dose-dependent manner. The analysis of thermal sensitivity showed that axTRPV1 was significantly activated by heat but not by cold. The average temperature threshold for heat-activation was 30.95 ± 0.12 C. This thermal activation threshold of axTRPV1 is unique and significantly low, when compared with the known thresholds of TRPV1s from various animals. Further, this threshold of axTRPV1 is well consistent with the observation of heat-induced behavior of axolotls at 33 C, demonstrating that axolotl shows noxious response to mild heat mediated through axTRPV1. © 2019 Elsevier Inc. All rights reserved.
Keywords: Transient receptor potential Channel Neuron Thermosensing Amphibian
1. Introduction Thermal perception is one of essential sensory systems for animal survival. Subsets of ion channels of transient receptor potential (TRP) family function as thermal sensors and play central roles in the thermosensory system of most animals (thermoTRPs). In mammals, they belong to TRPA (TRPA1), TRPV (TRPV1-TRPV4), and TRPM (TRPM2, TRPM4, TRPM5, TRPM8) subfamilies and different thermoTRPs are known to be specifically activated at distinctive ranges of temperature [1]. Especially, TRPA1 and TRPV1 are mainly expressed in nociceptive sensory neurons and act as sensors for noxious thermal and chemical stimuli [2e4]. Recently, TRPA1 has been cloned from diverse animal species, and its functional analysis showed that there are significant variations in thermal and chemical sensitivities among various TRPA1s.
Abbreviations: TRP, transient receptor potential; axTRPV1, axolotl TRPV1; 2-APB, 2-aminoethoxydiphenyl borate. * Corresponding author. E-mail address: [email protected] (O. Saitoh).
Although chemical sensitivity to AITC (allyl isothiocyanate) and cinnamaldehyde is approximately conserved among various animals, some chemical ligands differently activate rodent and human TRPA1s [5e7]. Further, frog TRPA1 is much less sensitive to methyl anthranilate (MA) than TRPA1s from human, mouse [8], and axolotl, tailed amphibian [9]. Our previous report indicated that autooxidized EGCG (epigallocatechin gallate) activates mammalian TRPA1s, but not chicken TRPA1 [10]. In case of thermal sensitivity, cold temperature activates rodent TRPA1 [11e15], but it does not activate the human and rhesus monkey TRPA1s [15]. For other animals, it has been demonstrated that TRPA1s from several tetrapod vertebrates (frogs, lizards, snakes and chickens) are heatactivated with distinct temperature thresholds [8,16,17]. In case of TRPV1, it is known that the sensitivity to capsaicin varies among animal species. Human and rodent TRPV1s show high sensitivity to capsaicin, but TRPV1s from rabbit, chicken, tropical clawed frog, and zebrafish are much less sensitive to capsaicin [18e21]. In addition, TRPV1 is generally heat-activated through many animal species, whereas heat-sensitivity of TRPV1 has been found to be lost in ground squirrel and camel to withstand high
https://doi.org/10.1016/j.bbrc.2019.10.203 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: S. Hori, O. Saitoh, Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.203
2
S. Hori, O. Saitoh / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
environmental temperature [22]. Further, Saito et al. analyzed functional properties of TRPV1 and TRPA1 of closely related two Xenopus species (Xenopus leavis and Xenopus tropicalis) [23]. X. leavis inhabits cooler region than X. tropicalis in Africa, and the optical temperature range differs between the two species. They reported that the thermal activation threshold of X. leavis TRPA1 was significantly lower than X. tropicalis TRPA1. The heat activation thresholds of TRPV1s of the two species were nearly the same, but the heat activation of X. leavis TRPV1 was much faster than X. tropicalis TRPV1. These functional properties of TRP channels are well consistent with behavioral responses to heat of the two species of frogs. These observations demonstrate that functional changes in thermal sensors contribute to the diversity of thermal sensation among various animal species, suggesting that the appropriate tuning of thermoTRPs must play critical roles in the survival strategy during the course of evolution and environmental adaptation of diverse animals. To approach the mechanism of this evolutional adaptation, we focused on axolotl, a member of the order of Urodela or tailed amphibians. Axolotl is endemic to the Lake Xochimilco area in the Vally of Mexico, and its water temperature is between 16 and 20 C. It is known that the optical temperature for laboratory housing of axolotl is between 16 and 20 C. This animal is neotenic, can breed in adult larval form, and spend its whole life in water [24]. To understand the sensing system for environmental temperature of this unique animal, we first cloned a cDNA encoding TRPA1 from axolotl and examined the functional properties. Axolotl TRPA1 was heat-activated, but the heat-activation threshold was about 40 C [9]. In case of axolotl, it was considered that TRPA1 might not function as a primary noxious sensor for environmental heat. Here, we first examined thermal response of axolotls and found that noxious behavior was induced by mild heat at 33 C. Then, to explore whether another main noxious thermal sensor, TRPV1 might contribute the environmental adaptation of axolotl, we isolated a cDNA of TRPV1 from axolotl. Using the degenerate primer PCR method, we identified the DNA fragment encoding axolotl TRPV1 (axTRPV1), and then cloned a full-length cDNA. We studied the chemical and thermal sensitivities of axTRPV1 by two-electrode voltage clamp method using Xenopus oocyte expression system.
(ThermoFisher Scientific) and sequenced. The expected sequence was obtained, and therefore the sequence information of a fulllength cDNA of axTRPV1 was determined using GeneRacer™ kit (Invitrogen™). We used the following nested primers. Nested Forward: 50 - ATGCAGGTCAACCTTCACACCA -30 Nested Reverse: 50 - CAGTGAGTCTCTGGTTCACACA -30 The axTRPV1 cDNA (3721 bp) encodes a protein of 858 amino acids (accession number: LC505037). For Xenopus oocyte expression, this cDNA was cloned into pGEMHE, which included the 50 and 3’ non-coding sequence of the Xenopus b-globin gene [27]. 2.3. RT-PCR assay Total RNA was isolated from various tissues and developing axolotls using TRIzol reagent (Invitrogen™) and subjected to reverse transcription with random primers. The reversetranscribed cDNA was used as a template for PCR. Total RNA treated under the same conditions without reverse-transcriptase was used as a negative control. The primers used were as follows: for b-actin, Forward 50 -GATGATATTGCCGCACTCGTTGTTG-30 Revers 50 - CTGTGTTGGCATACAAGTCTTTTCG-30 for axTRPV1, Forward 50 -TAAGTGGGACCGATTTGTCAAGCGC-30 Reverse 50 -CAAGTTGTTGTAGGACTCCG-30 PCR products were analyzed on 1% agarose gels. 2.4. Electrophysiology
Total RNA was isolated brain of adult of axolotl, Ambystoma mexicanum and reverse-transcribed cDNA was prepared with random primers. Seebacher and Murray developed degenerate primer sets to amplify TRPV1 cDNA fragment from several animal species [26], we used the following primers to amplify the partial cDNA of axolotl TRPV1 (axTRPV1).
An outline of the methods employed in electrophysiological experiments using Xenopus oocytes was described previously [20]. After injecting 50 nl of TRPV1 cRNA (0.1 mg/ml), oocytes were incubated in frog Ringer solution at 17 C for 3e4 days. Ionic currents were recorded by the two-electrode voltage clamp method. The recording bath solution contained 96 mM NaCl, 2 mM KCl, 3 mM MgCl2, 5 mM HEPES and 2 mM NaOH at pH 7.4. Oocytes were voltage-clamped at 20 mV. Current data was obtained using 400 ms step pulse from 80 mV for 100 ms to þ40 mV for 100 ms applied every 1 s. When experiments for thermal stimulation were performed, to achieve quick cold stimulation, 5 ml of the ice-cooled bath solution was applied for 14 s using an adjustable electronic pipette (Gilson Pipetman Concept C5000) to the bath. For heat stimulation, the bath solution heated by an in-line heater controller (CL-100, Warner Instruments) was applied by perfusion. Temperature thresholds were determined as described previously by Gracheva et al. [16]. Temperature thresholds represent the point of intersection between linear fits to baseline and the steepest component of the Arrhenius profile. Arrhenius curve was obtained by plotting the current at 80 mV on a log-scale against the reciprocal of the absolute temperature.
F 50 CARGACAARTGGGACMGATT 30
2.5. Behavioral experiments
R 50 TAWATGCCCATCWGCTGRA 30
An axolotl or an Iberian ribbed newt (RN) was placed into a metallic tray (15 cm 21 cm) with 500 ml of the chlorine-free tap water pre-warmed at 25 C, 33 C, or 39 C. We monitored the
2. Materials and methods 2.1. Experimental animals All of the animal experiments described below conformed to the institutional guidelines and were approved by the Animal Experiment Committee of Nagahama Institute of Bio-Science and Technology. Xenopus oocyte preparation has been described previously [25]. 2.2. Axolotl TRPV1 cDNA
The PCR product was cloned into pCR™4 Blunt-TOPO vector
Please cite this article as: S. Hori, O. Saitoh, Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.203
S. Hori, O. Saitoh / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
locomotor activity of animal using video camera. After placing into the pre-warmed tap water, heat-induced movements per 2 s (axolotl) or 1 s (NR) were measured during 20e60 s and the mean movement (cm) per 1 min was calculated. 2.6. Statistical analyses The values and error bars shown in the figures indicate mean and standard errors. The Statistical significance for difference of two groups was determined by Student’s unpaired t-test. For multiple groups, we performed the Tukey-Kramer method. To highlight the presence of the statistical significance, we indicated by * (p < 0.05), ** (p < 0.01), and *** (p < 0.001) for the focused groups. 3. Results 3.1. Behavioral responses to heat of axolotl and iberian ribbed newt
3
and zebrafish TRPV1 respectively. We created a phylogenetic tree of TRPV1s including axTRPV1 by the maximum likelihood method. Result demonstrated that the vertebrate TRPV1s are divided into three groups (Supplementary Fig. 1). One group contains mammalian, avian and reptile TRPV1s, another group contains amphibian TRPV1s, and the other group contains fish TRPV1s. It is apparent that axTRPV1 is most close to the frog TRPV1. We next examined the expression levels of axTRPV1 mRNA in various tissues. Total RNA was isolated from various tissues of axolotls and RT-PCR analysis was performed. The expression of axTRPV1 was easily detected in the brain, and but weak expression was observed in the skin and the muscle (Fig. 2A). We also analyzed the expression of axTRPV1 in developing embryos (St.32 (late tailbud), St.40 (pre-hatching)) and hatching larvae (Hatch). The low level of expression of axTRPV1 mRNA was detected at st.32, and the expression level increased at st. 40 and Hatch (Fig. 2B). The axTRPV1 cDNA was cloned into the oocyte expression
It is known that the optimal water temperature of axolotl is 16e20 C, whereas, for Iberian ribbed newt (Pleurodeles waltl, RN), another tailed amphibian, the favorable temperature of the water ranges between 15 and 28 C [28]. We studied noxious effects of mild heat (33 C) on axolotl behavior and compared with effects on behavior of RN. One adult of axolotl or RN was placed into a metallic tray with the tap water at 25 C or 33 C. The heat-induced locomotor activity was examined (Fig. 1). Movements of axolotl were significantly elicited by stimulation with mild heat at 33 C, but movements of RN were not significantly elicited by 33 C. Movements of RN was induced at 39 C. These results suggested that even mild heat evokes nocifensive behavior of axolotl, which is consistent with the relatively cool climate of its original habitat [24]. 3.2. Chemical sensitivity of axolotl TRPV1 We isolated a full-length cDNA of TRPV1 from axolotl, Ambystoma mexicanum. The coding sequence of axolotl TRPV1 (axTRPV1) consisted of 2577 bp, resulting in 858 amino acids (accession number: LC505037). The amino acid sequence of axTRPV1 exhibited, 62.4, 62.5, 67.5, 71, 43.9, and 45.2% identity to human TRPV1, mouse TRPV1, chicken TRPV1, X. tropicalis TRPV1, medaka TRPV1,
Fig. 2. The expression of axolotl TRPV1. (A) Total RNA was isolated from various tissues and subjected to reverse transcription with random primers. The reverse-transcribed cDNA was used as a template for PCR (þ). Total RNA treated under the same conditions without reverse-transcriptase was used as a negative control (). The primers used for b-actin and axolotl TRPV1 were described in the section of Materials and Methods (B) Total RNA was isolated from developing embryos (st.32 (late tailbud), st.40 (prehatching)) and hatching larvae (Hatch) and the expression of b-actin and axTRPV1 was examined as indicated above.
Fig. 1. Behavior response to heat of axolotls. An axolotl or an Iberian ribbed newt (RN) was placed into a metallic tray with pre-warmed (25 C, 33 C, or 39 C) the tap water. Heat-induced movements per 2 s (axolotl: n ¼ 4) or 1 s (NR: n ¼ 3) were measured and the mean movement (cm/min) was calculated. Statistical significance for differences between two groups was determined by Student’s unpaired t-test and was indicated by * (p < 0.05) and ** (p < 0.01).
Please cite this article as: S. Hori, O. Saitoh, Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.203
4
S. Hori, O. Saitoh / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
vector, pGEMHE and the sensitivities to chemical stimuli were examined by electrophysiological analysis of a two-electrode voltage clamp using Xenopus oocytes. Capsaicin (10 mMe100 mM), acid (pH6-pH4), and 2-aminoethoxydiphenylborane (2-APB, 100 mMe1000 mM) apparently activated axTRPV1 channels in a dose-dependent manner (Fig. 3). When compared with X. tropicalis TRPV1 (wcTRPV1), it seems that acid similarly activated both amphibian TRPV1s, but that the sensitivity of axTRPV1 to capsaicin was rather higher than that of wcTRPV1 [20]. EC50 of capsaicin to activate wcTRPV1 was reported to be 85.4 mM, but we estimated that EC50 of capsaicin for activation of axTRPV1was 14.4 mM. We next examined effects of TRPV1 blockers on capsaicin-activation of axTRPV1 (Supplementary Fig. 2). SB366791(SB) and capsazepin were used. SB could not inhibit the axTRPV1 activation.
significant currents were observed in response to heat stimulation. Heat activation of axTRPV1 was observed from relatively low temperature around 30 C. Mean peak currents induced at 30 C were compared (Fig. 4B). In the plot of the elicited inward current amplitudes as a function of temperature (Fig. 4C), we observed response of oocytes expressing axTRPV1 above about 30 C. Based on the Arrhenius plot of axTRPV1 (Fig. 4D), the temperature threshold for activation by heat stimulation was determined to be 31.4 C. The average of the temperature threshold of oocytes expressing axTRPV1 in the same batch was 30.95 ± 0.12 C. Analysis of the current-voltage relationship demonstrated that heat produced currents of axTRPV1 that showed the outward rectification (Fig. 4E). Further, even at 20 C, voltage-dependent activation of axTRPV1 was apparently observed.
3.3. Thermal sensitivity of axolotl TRPV1
4. Discussion
We electrophysiologically examined the thermal sensitivity of axTRPV1 using Xenopus oocytes (Fig. 4A). In oocytes expressing axTRPV1, cold stimulation could not activate axTRPV1, but
In this study, we focused on axolotl, tailed amphibian which breeds in the aquatic and larval form, and the optical temperature is relatively low ranging between 16 and 20 C. We first observed that
Fig. 3. Chemical response of oocytes expressing axolotl TRPV1 (A) Effects of capsaicin on ionic currents in Xenopus oocytes expressing axTRPV1 were examined. 1 mMe100 mM capsaicin were used. Average current at 30 s after capsaicin stimulation was plotted as a function of chemical concentration. Each data point represents the mean ± S. E (n ¼ 5). (B) Effects of acid on ionic currents of axTRPV1 were similarly examined and analyzed (n ¼ 5). (C) Effects of 2-aminoethoxydiphenyl borate (2-APB) on ionic currents of axTRPV1 were similarly examined and analyzed (n ¼ 5).
Please cite this article as: S. Hori, O. Saitoh, Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.203
S. Hori, O. Saitoh / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 4. Thermal sensitivities of axolotl TRPV1 (A) Effects of cold and heat stimulation on ionic currents in Xenopus oocytes expressing axTRPV1 were examined. Experimental conditions were as described in the materials and methods section. (B) Peak average currents for heat stimulation at 30 C were compared. Each data point represents the mean ± S. E (n ¼ 8). Statistical significance for difference was determined by Student’s unpaired t-test and was indicated by *** (p < 0.001). (C) The elicited currents at 80 mV shown in (A) were plotted as a function of temperature. (D) Arrhenius plots of the current of axTRPV1 elicited by heat stimulation. (E) Electrophysiological response of oocytes expressing axTRPV1 to the bath solution at 20 C, 25 C, 30 C, and 35 C. Voltage ramps from 100 mV to þ100 mV were applied every 2 s.
even mild heat (33 C) evokes nocifensive behavior of axolotl, and then isolated its TRPV1 cDNA to study the chemical and thermal sensitivity by electrophysiological method using Xenopus oocytes. The analysis of chemical sensitivity of axTRPV1 showed that capsaicin, acid, and 2-APB can activate axTRPV1. Especially, we noticed that axTRPV1 is more sensitive to capsaicin, when compared to the sensitivity of TRPV1 from western clawed frog
(wc) [20]. It has been reported that two amino acids, Ser (S)-512 and Thr (T)-550, located in the third and fourth putative transmembrane domains in capsaicin-sensitive TRPV1 (human and rhodents) are important for the capsaicin-sensitivity [18,19]. On the other hand, the corresponding two amino acids of wcTRPV1 were changed to tyrosine (Y)-523 and alanine (A)-561, and mutagenesis analysis demonstrated that these two amino acids in wcTRPV1 are
Please cite this article as: S. Hori, O. Saitoh, Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.203
6
S. Hori, O. Saitoh / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
responsible for the low sensitivity to capsaicin [20]. When compared with the amino acid sequence of axTRPV1, we found that S-512 of capsaicin-sensitive TRPV1 is conserved, but T-550 is changed to Valine (V). Although further experiments are required, it is considered that these two amino acids of axTRPV1 (S525, V563) may contribute to the sensitivity of axTRPV1 to capsaicin. We then examined whether capsaicin indeed may induce noxious effects on axolotl behavior. The irritant-induced locomotor activity was observed with 10 mM capsaicin, suggesting involvement of activation of axTRPV1 (data not shown). The electrophysiological analysis of thermal sensitivity indicated that cold stimulation could not activate axTRPV1, but heat stimulation significantly activated it. The Arrhenius plot of axTRPV1-mediated currents demonstrated that the average temperature threshold for heat-activation was 30.95 ± 0.12 C. TRPV1 was cloned from mammals, birds, and frogs, and their thermalactivation properties have been studied. It was reported that rodent TRPV1 was heat-activated with the threshold of 43 C [29], the heat activation threshold of chick TRPV1 was 45 C [18], and the temperature thresholds for heat-activation of TRPV1 from Xenopus leavis and Xenopus tropicalis were similarly about 41 C (40.5 C, 40.8 C, [30]). Compared with these reported thresholds for heatactivation of TRPV1s, it is apparent that the threshold of axTRPV1 is significantly low. It has been demonstrated that vampire bats (vb) express a ganglion-specific splicing variant of TRPV1 in addition to normal TRPV1 molecule. This TRPV1 variant lacks 62 amino acids from carboxy terminus. Although long normal form of vb TRPV1(TRPV1-L) was heat-activated at the threshold of 40 C, it was found that alternative splicing of TRPV1 transcripts lowered its thermal activation threshold to 30 C [31]. Since this splicing variant of TRPV1 was found in other animals, it is possible that axTRPV1 might have the truncated carboxy terminus. Sequence alignment, however, indicated that the corresponding amino acids were present in the carboxy terminus of axTRPV1. Therefore, there may be a different molecular mechanism determining the low temperature threshold for heat-activation of axTRPV1. By study on the noxious effects of mild heat on axolotl behavior, we showed that the heat-induced locomotor activity was induced at 33 C but not at 25 C. This observation is well consistent with the thermal threshold at about 31 C determined by electrophysiological analysis of axTRPV1. It is strongly suggested that axolotl shows noxious response to mild heat mediated through axTRPV1. At next stage, we have to explore how axTRPV1 can recognize apparently lower temperature threshold. Acknowledgements This work was supported by JSPS KAKENHI, Japan (Grant No. 16K07305 to O. S.), as well as a grant from the Cooperative Study Program of National Institute for Physiological Sciences, Japan (to O. S.). Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.10.203 Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.10.203. References [1] S. Saito, M. Tominaga, Functional diversity and evolutionary dynamics of
thermoTRP channels, Cell Calcium 57 (2015) 214e221. [2] A. Patapoutian, A.M. Peier, G.M. Story, V. Viswanath, ThermoTRP channels and beyond: mechanisms of temperature sensation, Nat. Rev. Neurosci. 4 (2003) 529e539. [3] M. Bandell, L.J. Macpherson, A. Patapoutian, From chills to chilis: mechanisms for thermosensation and chemesthesis via thermoTRPs, Curr. Opin. Neurobiol. 17 (2007) 490e497. [4] M. Tominaga, The role of TRP channels in thermosen- sation, in: W.B. Liedtke, S. Heller (Eds.), TRP Ion Channel Function in Sensory Transduction and Cellular Signaling Cascades. Frontiers in Neuroscience, CRC Press, Boca Raton, FL, 2007. [5] K. Nagatomo, Y. Kubo, Caffeine activates mouse TRPA1 channels but suppresses human TRPA1 channels, Proc. Natl. Acad. Sci. U.S.A. 105 (2008) 17373e17378. [6] J. Chen, X.-F. Zhang, M.E. Kort, J.R. Huth, C. Sun, L.J. Miesbauer, S.C. Cassar, T. Neelands, V.E. Scott, R.B. Moreland, R.M. Reilly, P.J. Hajduk, P.R. Kym, C.W. Hutchins, C.R. Faltynek, Molecular determinants of species-specific activation or blockade of TRPA1 channels, J. Neurosci. 28 (2008) 5063e5071. [7] B. Xiao, A.E. Dubin, B. Bursulaya, V. Viswanath, T.J. Jegla, A. Patapoutian, Identification of transmembrane domain 5 as a critical molecular determinant of menthol sensitivity in mammalian TRPA1 channels, J. Neurosci. 28 (2008) 9640e9651. [8] S. Saito, N. Banzawa, N. Fukuta, C.T. Saito, K. Takahashi, T. Imagawa, T. Ohta, M. Tominaga, Heat and noxious chemical sensor, chicken TRPA1, as a target of bird repellents and identification of its structural determinants by multispecies functional comparison, Mol. Biol. Evol. 31 (2014) 708e722. [9] M. Oda, H. Ogino, Y. Kubo, O. Saitoh, Functional properties of axolotl transient receptor potential ankyrin 1 revealed by the heterologous expression system, Neuroreport 30 (2019) 323e330. [10] M. Kurogi, Y. Kawai, K. Nagatomo, M. Tateyama, Y. Kubo, O. Saitoh, Autooxidation products of epigallocatechin gallate activate TRPA1 and TRPV1 in sensory neurons, Chem. Senses 40 (2015) 27e46. [11] M. Bandell, G.M. Story, S.W. Hwang, V. Viswanath, S.R. Eid, M.J. Petrus, T.J. Earley, A. Patapoutian, Noxious cold ion channel TRPA1 is activated by pungent compounds and bradykinin, Neuron 41 (2004) 849e857. [12] G.M. Story, A.M. Peier, A.J. Reeve, S.R. Eid, J. Mosbacher, T.R. Hricik, T.J. Earley, A.C. Hergarden, D.A. Andersson, S.W. Hwang, P. McIntyre, T. Jegla, S. Bevan, A. Patapoutian, ANKTM1, a TRP-like channel expressed in nociceptive neurons, is activated by cold temperatures, Cell 112 (2003) 819e829. [13] K.Y. Kwan, A.J. Allchorne, M.A. Vollrath, A.P. Christensen, D.-S. Zhang, C.J. Woolf, D.P. Corey, TRPA1 contributes to cold, mechanical, and chemical nociception but is not essential for hair-cell transduction, Neuron 50 (2006) 277e289. [14] Y. Karashima, K. Talavera, W. Everaerts, A. Janssens, K.Y. Kwan, R. Vennekens, B. Nilius, T. Voets, TRPA1 acts as a cold sensor in vitro and in vivo, Proc. Natl. Acad. Sci. U.S.A. 106 (2009) 1273e1278. [15] J. Chen, D. Kang, J. Xu, M. Lake, J.O. Hogan, C. Sun, K. Walter, B. Yao, D. Kim, Species differences and molecular determinant of TRPA1 cold sensitivity, Nat. Commun. 4 (2013) 2501. [16] E.O. Gracheva, N.T. Ingolia, Y.M. Kelly, J.F. Cordero-Morales, G. Hollopeter, A.T. Chesler, E.E. Sanchez, J.C. Perez, J.S. Weissman, D. Julius, Molecular basis of infrared detection by snakes, Nature 464 (2010) 1006e1011. [17] S. Saito, K. Nakatsuka, K. Takahashi, N. Fukuta, T. Imagawa, T. Ohta, M. Tominaga, Analysis of transient receptor potential ankyrin 1 (TRPA1) in frogs and lizards illuminates both nociceptive heat and chemical sensitivities and coexpression with TRP vanilloid 1 (TRPV1) in ancestral vertebrates, J. Biol. Chem. 287 (2012) 30743e30754. [18] S.E. Jordt, D. Julius, Molecular basis for species-specific sensitivity to "hot" chili peppers, Cell 108 (2002) 421e430. [19] N.R. Gavva, L. Klionsky, Y. Qu, L. Shi, R. Tamir, S. Edenson, T.J. Zhang, V.N. Viswanadhan, A. Toth, L.V. Pearce, T.W. Vanderah, F. Porreca, P.M. Blumberg, J. Lile, Y. Sun, K. Wild, J.-C. Louis, J.J.S. Treanor, Molecular determinants of vanilloid sensitivity in TRPV1, J. Biol. Chem. 279 (2004) 20283e20295. [20] M. Ohkita, S. Saito, T. Imagawa, K. Takahashi, M. Tominaga, T. Ohta, Molecular cloning and functional characterization of Xenopus tropicalis frog transient receptor potential vanilloid 1 reveal its functional evolution for heat, acid, and capsaicin sensitivities in terrestrial vertebrates, J. Biol. Chem. 287 (2012) 2388e2397. [21] P. Gau, J. Poon, C. Ufret-Vincenty, C.D. Snelson, S.E. Gordon, D.W. Raible, A. Dhaka, The zebrafish ortholog of TRPV1 is required for heat-induced locomotion, J. Neurosci. 33 (2013) 5249e5260. [22] W.J. Laursen, E.R. Schneider, D.K. Merriman, S.N. Bagriantsev, E.O. Gracheva, Low-cost functional plasticity of TRPV1 supports heat tolerance in squirrels and camels, Proc. Natl. Acad. Sci. U.S.A. 113 (2016) 11342e11347. [23] S. Saito, M. Ohkita, C.T. Saito, K. Takahashi, M. Tominaga, T. Ohta, Evolution of heat sensors drove shifts in thermosensation between Xenopus species adapted to different thermal niches, J. Biol. Chem. 291 (2016) 11446e11459. [24] J.E. Farkas, J.R. Monaghan, Housing and maintenance of Ambystoma mexicanum, the Mexican axolotl, Methods Mol. Biol. 1290 (2015) 27e46. [25] M. Oda, K. Saito, S. Hatta, Y. Kubo, O. Saitoh, Chemical and thermal sensitivity of medaka TRPA1 analyzed in heterologous expression system, Biochem. Biophys. Res. Commun. 494 (2017) 194e201. [26] F. Seebacher, S.A. Murray, Transient receptor potential ion channels control thermoregulatory behaviour in reptiles, PLoS One 2 (2007) e281. [27] J. Tytgat, J. Vereecke, E. Carmeliet, Reversal of rectification and alteration of
Please cite this article as: S. Hori, O. Saitoh, Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.203
S. Hori, O. Saitoh / Biochemical and Biophysical Research Communications xxx (xxxx) xxx selectivity and pharmacology in a mammalian Kv1.1 potassium channel by deletion of domains S1 to S4, J. Physiol. 481 (1994) 7e13. [28] A. Joven, M. Kirkham, A. Simon, Husbandry of Spanish ribbed newts, Methods Mol. Biol. 1290 (2015) 47e70. [29] M.J. Caterina, M.A. Schumacher, M. Tominaga, T.A. Rosen, J.D. Levine, D. Julius, The capsaicin receptor: a heat-activated ion channel in the pain pathway, Nature 389 (1997) 816e824.
7
[30] S. Saito, M. Ohkita, C.T. Saito, K. Takahashi, M. Tominaga, T. Ohta, Evolution of heat sensors drove shifts in thermosensation between Xenopus species adapted to different thermal niches, J. Biol. Chem. 291 (2016) 11446e11459. [31] E.O. Gracheva, J.F. Cordero-Morales, J.A. Gonz alez-Carcacía, N.T. Ingolia, C. Manno, C.I. Aranguren, J.S. Weissman, D. Julius, Ganglion-specific splicing of TRPV1 underlies infrared sensation in vampire bats, Nature 476 (2011) 88e91.
Please cite this article as: S. Hori, O. Saitoh, Unique high sensitivity to heat of axolotl TRPV1 revealed by the heterologous expression system, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.10.203