Unreduced diploid sperm from diploid hybrids and formation of a new type of tetraploid hybrid

Aquaculture 515 (2020) 734584

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Unreduced diploid sperm from diploid hybrids and formation of a new type of tetraploid hybrid

T

Yude Wanga,b,1, Minghe Zhanga,1, Suifei Taoa,1, Xiang Xiea,1, Huifang Tana, Liu Caoa, Jing Wanga, Qinbo Qina, Chun Zhanga, Min Taoa, Ming Mab, Bo Chenb, Shaojun Liua,∗ a b

State Key Laboratory of Developmental Biology of Freshwater Fish, College of Life Sciences, Hunan Normal University, Changsha, 410081, Hunan, PR China College of Chemistry and Chemical Engineering, Hunan Normal University, Changsha, 410081, Hunan, PR China

A R T I C LE I N FO

A B S T R A C T

Keywords: Distant hybridization FISH 5S rDNA Electron microscopy

The production of unreduced gametes is an important resource for the formation of polyploids. Here, we obtained a second generation of diploid hybrids (2nKCF2) derived from koi carp (KOC; 2n = 100; ♀) × colored crucian carp (CCC; 2n = 100; ♂) with the unusual reproductive trait of producing unreduced diploid sperm. Compared with KOC and CCC, 2nKCF2 had unique morphological characteristics, including a gray and golden head, golden-brown scaly outer edge, and smooth golden-yellow back. FISH and 5S rDNA analysis revealed that 2nKCF2 not only inherited genomic DNA from their parents but also lost some parental DNA fragments. Chromosomal spreads of germ cells provided direct cytological evidence for the production of unreduced diploid sperm by male 2nKCF2. Electron microscopy results showed that the heads of the diploid sperm generated by 2nKCF2 were twice as large as those of the haploid sperm generated by CCC (P < 0.05), confirming that the sperm of 2nKCF2 were diploid. A new type of tetraploid hybrid (4n = 200) was produced by crossing 2nKCF2 males with improved female allotetraploid hybrids of red crucian carp (♀) × common carp (♂). This study provides insights into reproductive biology and aquaculture.

1. Introduction

progeny of RCC(♀) × common carp (CC, 2n = 100, ♂) (Liu et al., 2001), RCC(♀) × BSB(♂) (Qin et al., 2014) and CC(♀) × BSB(♂) (Wang et al., 2017) were shown to produce unreduced gametes. However, previous reports of unreduced sperm production only include hybrid F2 male individuals of RCC(♀) × CC(♂) (Liu et al., 2001; Liu et al., 2006). If two kinds of unreduced gametes are combined, a fertile polyploid hybrid may form: either autopolyploid or allopolyploid (Mason et al., 2011). Unreduced gametes have been detected in hybrid and nonhybrid cultivars as well as in wild species (Ramsey, 2007). These gametes were easily detected because of the difference in size (De Storme et al., 2013) and DNA content between n and 2n pollen grains (Dewitte et al., 2009), and the formation of 2n male gametes has received much more attention than that of 2n eggs. Distant hybridization is defined as interspecific hybridization (Liu, 2010). It combines whole genomes from two distinct taxa, which may lead to changes in offspring phenotype and genotype (Biradar and Lane Rayburn, 2016). Among the vertebrate classes, fishes undergo the most frequent distant hybridization. Distant hybridization has been widely conducted among species, genera, subfamilies, families and orders of fishes (Schwartz, 1981) and it is an important factor leading to

An increasing number of examples have shown that hybridization seems to be beneficial for species formation and adaptive radiation in animals and plants. Distant hybridization can lead to the formation of polyploids (Liu, 2010). For example, along with the fertile allotetraploid hybrids derived from the distant hybridization of red crucian carp (RCC, 2n = 100,♀) × blunt snout bream (BSB, 2n = 48,♂) (Qin et al., 2014), fishes with different ploidy levels were obtained, including diploid fertile natural gynogenetic fish (2n = 100), sterile triploid hybrids (3n = 124) and tetraploid hybrids (4n = 148). In plants, the production of tetraploid populations via bilateral sexual polyploidization and 2n gametes may be useful for other breeding purposes, such as the production of highly heterotic hexaploid populations (Perry et al., 1987) and the manipulation of disease resistance and other certain qualitative traits (Groose et al., 1988). However, only a few species have been reported to produce unreduced sperm through distant hybridization. In nature, the formation of unreduced diploid eggs has been reported in loach, salmon (Chourrout et al., 1986; Morishima et al., 2008) and Oryzias (Matsuo et al., 2002). In our laboratory, the hybrid ∗

Corresponding author. State Key Laboratory of Developmental Biology of Freshwater Fish, Hunan Normal University, Changsha, 410081, Hunan, PR China. E-mail address: [email protected] (S. Liu). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.aquaculture.2019.734584 Received 29 August 2019; Received in revised form 1 October 2019; Accepted 7 October 2019 Available online 08 October 2019 0044-8486/ © 2019 Elsevier B.V. All rights reserved.

Aquaculture 515 (2020) 734584

Y. Wang, et al.

chromosomal doubling in germ cells. The fishes used in this study, namely, koi carp (KOC, 2n = 100, ♀) and colored crucian carp (CCC, 2n = 100, ♂), are classified into different genera. KOC falls into Cyprinidae, while CCC into Carassius auratus. Both KOC and CCC are diploid bisexual species with omnivorous feeding habits. The 4nAT hybrid is first obtained by crossing RCC with CC (Liu et al., 2001; Sun et al., 2003). 4nAT individuals produce diploid eggs and diploid sperm. Using gynogenesis techniques, we established a gynogenetic diploid hybrid clone line (Liu et al., 2004; Liu et al., 2007). Producing diploid eggs is a unique reproductive trait of the gynogenetic diploid hybrids. Fertilizing of the diploid eggs produced by gynogenetic diploid hybrids with diploid sperm from male 4nAT yielded a new tetraploid hy"brid. The new species was cal"led the improved 4nAT(4nIAT, 4n = 200) (Duan et al., 2007). In this study, we successfully obtained second-generation diploid hybrids, generated from the self-mating of first-generation diploid hybrids of KOC(♀, 2n = 100) × CCC(♂, 2n = 100). Hereinafter, we abbreviated the first-generation diploid hybrids of KOC(♀) × CCC(♂) as 2nKCF1, the second-generation diploid hybrids of KOC(♀) × CCC(♂) as 2nKCF2, the triploid hybrids of KOC(♀) × CCC(♂) as 3nKC and the new type of tetraploid hybrids of the 4nIAT(4n = 200, ♀) × 2nKCF2 (2n = 100, ♂) as 4nAK. The 2nKCF2 not only has strong disease resistance and other advantages, but also has some new positive performance traits, such as golden body color, small heads, and short tails. More importantly, 2nKCF2 has the genetic characteristic of producing diploid sperm. Furthermore, the formation of diploid sperm plays an important role in the formation of new tetraploids.

HL/BL, HH/BH, and CPL/CPH. In addition, we recorded the number of lateral line scales, upper lateral scales, below lateral line, dorsal, anal, and abdominal fins. Variance (ANOVA) and multiple comparison tests (LSD method) (Hayter, 1986) were used to test the differences in each trait among the four types of fishes by using SPSS Statistics 19.0 (IBM Corp., NY, United States). The values of the independent variables were expressed as the mean ± SD. We fed 10 KOC, 10 CCC, 10 2nKCF1 and 10 2nKCF2 in an open pond to observe their feeding habits. The pH of the water was between 7.5 and 8.0, the oxygen content in the water was above 5.0 mg/L, and the ammonia nitrogen content was below 0.5 mg/L. By feeding with aquatic plants and feed in the pond, we observed the fishes’ food intake directly and found that both the grass and feed were ingested. 2.3. Examination of chromosome number and karyotype To determine ploidy, chromosome preparation was carried out with the kidney tissues of 10 KOC, 10 CCC, 10 2nKCF1, 10 2nKCF2 and 10 4nAK at one year of age according to the procedures reported by Liu et al. (2001). We photographed 50 metaphase spreads from each sample to determine the chromosome number. Good-quality metaphase spreads were photographed for analysis of karyotypes. The chromosomal metaphase spreads were examined under an oil lens at a magnification of 3330 × . Chromosomes were classified according to the reported standards (Levan et al., 2010). 2.4. Genomic DNA extraction, 5S rDNA PCR amplification, and sequencing Fish treatments were carried out according to the Regulations for Protected Wildlife and the Administration of Affairs Concerning Animal Experimentation and approved by the Science and Technology Bureau of China. The fish were deeply anesthetized with 100 mg/L MS-222 (Sigma-Aldrich, St Louis, MO, USA) before dissection. Total genomic DNA was isolated from peripheral blood cells using the standard phenol-chloroform extraction procedures described by Sambrook et al. (Russell and Sambrook, 2001). One pair of primers (5S rDNA forward primer: GCTATGCCCGATCTCGTCTGA and 5S rDNA reverse primer: CAGGTTGGTATGGCCGTAAGC) was designed and then synthesized to amplify the 5S rDNA repeats directly from 10 KOC, 10 CCC, 10 2nKCF1 and 10 2nKCF2 by PCR. The PCR and sequencing were performed as described by Qin et al. (2010). Sequences were analyzed using BioEdit software (BioEdit version 7.0).

2. Materials and methods 2.1. Animals and crosses KOC and CCC were cultured at the State Key Laboratory of Developmental Biology of Freshwater Fish, Hunan Normal University, China. KOC reached sexual maturity at two years of age, and CCC at one year of age. During the reproductive season (April–July), 15 mature females of KOC and 15 mature males of CCC were selected as the maternal and paternal parents, respectively. The crosses were performed as follows: the mature eggs were fertilized with semen, and the embryos were develop in culture dishes at a water temperature of 20–24 °C. The KOC(♀) × CCC(♂) cross resulted in diploid F1 hybrids. The F1 hybrids reached sexual maturity at two years of age. The sexually mature male and female F1 hybrids were mated to produce the second generation. In the second generation, two types of offspring appeared: diploid hybrids (2nKCF2) and triploid hybrids (3nKC). The male 2nKCF2 could produce diploid sperm at two years of age, but the female 2nKCF2 could not produce mature eggs. The new type of tetraploid hybrid (4nAK, 4n = 200) was produced by crossing the male 2nKCF2 with the improved female allotetraploid hybrids. The entire crossing procedure was shown in Fig. 1. For each cross, 2000 embryos were selected at random to count fertilization (number of embryos at the gastrula stage/number of eggs × 100%), hatching (number of hatched fry/number of eggs × 100%), and survival (number of adulthood/number of eggs × 100%) rates. Simultaneously, the self-mating of CCC was performed as the control group. The hatched fry were transferred to a pond for further culture.

2.5. Fluorescence in situ hybridization The species-specific fragment of CCC was amplified by 5S rDNA primer. Then, fluorescence in situ hybridization (FISH) probe were produced by using Dig-11-dUTP in the Nick Translation Kit (Roche, Germany) to label the purified PCR fragment. Next, according to the method described by Qin et al. (2014), FISH was performed by using the probe in the chromosome metaphase spreads of KOC, CCC, 2nKCF1 and 2nKCF2. For each type of fish, 50 metaphase spreads of the chromosomes were analyzed. 2.6. Gonadal chromosome preparation The testes of 2nKCF2 were removed in a culture dish containing physiological saline (0.8% NaCl), and the tissue was cut with scissors. Then, the samples were moved into a centrifuge tube with pipettes. Cell suspensions were allowed to stand and then centrifuged at 1000 rpm for 5 min, following the supernatant was discarded. The collected cells were suspended in 0.075 mol/L KCl hypotonic solution for 2–5 h and agitated several times. The cells were centrifuged, collected, fixed in a mixture of methanol and glacial acetic acid (3:1) 2–3 times, dripped onto a frozen slide, dried with a flame, and dyed with Giemsa dye. The gonads of each experimental fish were used for histological observation.

2.2. Morphological traits and feeding habits Twenty one-year-old fish from each group (KOC, CCC, 2nKCF1 and 2nKCF2) were selected at random for morphological examination. We measured the whole length (WL), body length (BL), body height (BH), head length (HL), head height (HH), caudal peduncle length (CPL), and caudal peduncle height (CPH) of each fish (accurate to 0.1 cm). These values were then used to calculate the following ratios: BL/WL, BH/BL, 2

Aquaculture 515 (2020) 734584

Y. Wang, et al.

Fig. 1. Formation procedure and appearances of KOC, CCC, 2nKCF1, 2nKCF2, 3nKC and 4nAK. A: KOC; B: CCC; C: 2nKCF1; D: 2nKCF2(♂); E: 2nKCF2(♀); F: 3nKC; G: 4nIAT; H: 4nAK. Bar = 3 cm.

After the gonads were fixed in Bouin's solution for 1–2 days, they were subjected to a gradiently dehydration with ethanol, embedded in paraffin and stained with hematoxylin and eosin (HE). The chromosomes were observed under a microscope and photographed using a Pixera Pro 600 ES digital microphotography system (Santa Clara, CA, USA).

40.23%, respectively.

3.3. Morphological traits and feeding habits The morphological traits of KOC, CCC, 2nKCF1, 2nKCF2, 3nKC and 4nAK were shown in Fig. 1. 2nKCF1, 2nKCF2 and 4nAK had unique morphological characteristics, including a gray and golden head, golden-brown scaly outer edge and smooth golden-yellow back. These 2nKCF2 were generally distinguishable from KOC by their body colors and shapes. One of the most recognizable features of 2nKCF2 was its black-spotted head. Table 1 presented the countable and measurable traits observed in KOC, CCC, 2nKCF1 and 2nKCF2. For the measurable traits, the BH/BL, HH/HL, HH/BH and CPL/CPH in 2nKCF1 and their progeny (2nKCF2) were intermediate to those of KOC and CCC and significantly different

2.7. Gonadal structure and sperm phenotype The male 2nKCF2 and CCC gonads were fixed in Bouin's solution for the preparation of tissue sections. Paraffin-embedded sections were cut and stained with HE solution. The gonadal structure was observed under a light microscope and photographed with a Pixera Pro 600 ES microphotograph system. 2nKCF2 and CCC semen was collected with a clean pipette and transferred into a 2.5% glutaraldehyde solution. The samples were then centrifuged at 2000×g for 1 min and then fixed in a 4% glutaraldehyde solution overnight and a 1% osmic acid solution for 2 h. The samples were dehydrated in alcohol, added dropwise onto slides, desiccated, subjected to atomized gilding and analyzed with a Hitachi X-650 scanning electron microscope (SEM) (Nikon, Japan).

Table 1 Phenotypes, including measurable traits (average ratios of body length to whole length (BL/WL), body height to body length (BH/BL), head length to body length (HL/BL), head height to body height (HH/BH)), and caudal peduncle length to caudal peduncle height (CPL/CPH) and countable traits (number of lateral scales, number of upper lateral scales, number of lower laterals scales, number of dorsal fins, number of abdominal fins, number of anal fins), of KOC, CCC, 2nKCF1 and 2nKCF2.

3. Results 3.1. Experimental design

Phenotype

The crossing procedure was outlined in Fig. 1. In the first generation of KOC(♀) × CCC(♂), 100% 2nKCF1 occurred. The self-mating of 2nKCF1 produced 70% 2nKCF2 and 30% 3nKC. The hybridization of female 4nIAT and male 2nKCF2 produced the new type of tetraploid (4nAK).

Type of fish KOC

BL/WL BH/BL HL/BL HH/BH CPL/CPH No. of lateral scales No. of upper lateral scales No. of lower lateral scales No. of dorsal fins No. of abdominal fins No. of anal fins

3.2. Fertilization, hatching, and survival rates The fertilized eggs of KOC(♀) × CCC(♂) showed moderate fertilization rates (68.70%), hatching rates (62.70%) and survival rates (50.30%). The self-mating of KOC resulted in a 95.60% fertilization rate, 85.30% hatching rate, and 80.70% survival rate, and the selfmating of CCC resulted in a 96.70% fertilization rate, 86.80% hatching rate and 80.25% survival rate. In addition, the fertilization, hatching, and survival rates of 2nKCF1 self-mating were 58.60%, 53.50% and 3

0.86 ± 0.38 ± 0.25 ± 0.63 ± 0.80 ± 36～37 6～7

CCC 0.01 0.01 0.02 0.05 0.09

0.81 ± 0.51 ± 0.27 ± 0.47 ± 1.87 ± 27～28 5～6

2nKCF1 0.02 0.02 0.01 0.02 0.04

0.82 ± 0.40 ± 0.28 ± 0.54 ± 1.01 ± 28～30 5～6

2nKCF2 0.04 0.05 0.03 0.03 0.16

0.81 ± 0.41 ± 0.27 ± 0.55 ± 0.99 ± 29∼30 5∼6

0.03 0.05 0.05 0.03 0.05

6～7

6～7

6～7

6∼7

III+17～19 8～9

III+17～18 8～9

III+17～20 8～9

III+16～18 8∼9

III+5～6

III+6～7

III+5～7

III+5～7

Aquaculture 515 (2020) 734584

Y. Wang, et al.

from those of KOC and CCC (P < 0.05). The BL/WL ratios of 2nKCF1 and 2nKCF2 were equal to that of CCC and significantly lower than that of KOC (P < 0.05). The HH/HL ratio of 2nKCF1 was intermediate between those of KOC and CCC. However, the HH/HL ratio of 2nKCF2 was higher than that of either KOC or CCC (P < 0.05). For the countable traits, the numbers of lateral scales and anal fins in 2nKCF1 and 2nKCF2 were intermediate between those in KOC and CCC. The numbers of upper lateral scales, lower lateral scales and abdominal fins in 2nKCF1 and 2nKCF2 were the same as those in KOC and CCC. The number of abdominal fins in 2nKCF1 was close to that in KOC. However, the number of abdominal fins in 2nKCF2 was close to that in CCC. Through feeding with aquatic plants and feed separately and long-

Table 2 Examination of chromosome number in KOC, CCC, 2nKCF1 and 2nKCF2. Distribution of chromosome number Fish type KOC CCC 2nKCF1 2nKCF2

No. in metaphase 50 50 50 50

< 98 3 2 2 3

98–100 4 4 3 5

100 43 44 45 42

< 148

148–150

150

Fig. 2. Chromosome spreads at metaphase and karyotypes of 2nKCF1, 2nKCF2 and 4nAK. A: there were 100 chromosomes in 2nKCF1; B: there were 100 chromosomes in 2nKCF2; C: there were 200 chromosomes in 4nAK; D: the karyotype of 2nKCF1 was 22 m + 30sm + 24st + 24t; E: the karyotype of 2nKCF2 was 22 m + 30sm + 24t + 24st; F: the karyotype of 4nAK was 44 m + 64sm + 46st + 46t. Bar = 3 μm. 4

Aquaculture 515 (2020) 734584

Absent 10 sequenced clones of 477 bp 5 sequenced clones of 477 bp 5 sequenced clones of 477 bp 20 sequenced clones of 406 bp Absent 10 sequenced clones of 406 bp 10 sequenced clones of 406 bp

Absent 10 sequenced clones of 618 bp 5 sequenced clones of 618 bp 5 sequenced clones of 618 bp

term follow-up observation, it was found that KOC, CCC, 2nKCF1 and 2nKCF2 all ingested two kinds of food. In addition, we put together a feed preparation (feed and aquatic plants) and found that the fish ingested both feeds. Therefore, we concluded that KOC, CCC, 2nKCF1 and 2nKCF2 were omnivorous fish. 3.4. Chromosomes and karyotypes Table 2 presented the distribution of chromosomes numbers in KOC, CCC, 2nKCF1, 2nKCF2 and 4nAK. Among all the observed samples of KOC, 86.0% of the chromosomal metaphases possessed 100 chromosomes, showing that these fish were diploids with 100 chromosomes and the karyotype 22 m + 30sm + 24t + 24st. Among all the observed samples of CCC, 88.0% of the chromosomal metaphases possessed 100 chromosomes, indicating that these fish were diploids with the karyotype 22 m + 30sm + 24st + 24t. In 2nKCF1, 90.0% of the chromosomal metaphases possessed 100 chromosomes with the karyotype 22 m + 30sm + 24t + 24st. In the chromosomes of 2nKCF2, 84.0% of the chromosomal metaphases had 100 chromosomes with the karyotype 22 m + 30sm + 24t + 24st. The 4nAK had 200 chromosomes with the karyotype 44 m + 64sm + 46t + 46st (Fig. 2). 3.5. Analysis of 5S rDNA Several DNA fragments were amplified from KOC, CCC, 2nKCF1 and 2nKCF2 using the 5S rDNA primer pair. These PCR fragments generated distinct agarose gel electrophoresis band patterns. There were two fragments (203 bp and 406 bp) in KOC (MH909573 and MH909574), four fragments (203 bp, 340 bp, 477 bp and 618 bp) in CCC, five fragments (203 bp, 340 bp, 406 bp, 470 bp and 618 bp) in 2nKCF1, and five fragments (203 bp, 340 bp, 406 bp, 477 bp and 618 bp) in 2nKCF2 (Table 3, Supplementary Fig. 1). Based on the BLAST analyses, all fragments from KOC, CCC, 2nKCF1 and 2nKCF2 were confirmed as 5S rDNA repeat units. KOC, CCC, 2nKCF1 and 2nKCF2 exhibited high similarities in the 5S rDNA coding region. The average similarities between 2nKCF2 and KOC and between 2nKCF2 and CCC were 98.98% and 98.98%, respectively. These sequence results showed that the 5S rDNA structural units in CCC and KOC as well as their hybrid progeny (2nKCF1 and 2nKCF2) had highly conserved coding regions and large variable nontranscribed spacer (NTS) regions. Four of the 5S rDNA structural units of 2nKCF1 and 2nKCF2 came from the paternal CCC (class I, class II, class III and class IV) (Supplementary Fig. 2) and one from the maternal CCC (class V). The 406 bp fragment of KOC, 2nKCF1 and 2nKCF2 was a dimer structure composed of two classes (Supplementary Fig. 3). All the sequences have been submitted to GenBank, and the GenBank accession numbers are KC206050KC206053. The sequences of the 5S rDNA units cloned in this study contained a coding region (5′-99 bp and 3′-21 bp) and a middle region consisting of distinct NTS sequences. In KOC, only monomeric 5S rDNA (designated class V: 203 bp) was characterized by one NTS type (NTS-83 bp). In CCC, there were four monomeric 5S rDNA classes (class I: 203 bp, class II: 340 bp, class III: 477 bp and class IV: 618 bp). In 2nKCF1 and 2nKCF2, there were four monomeric 5S rDNA classes (class I: 203 bp, class II: 340 bp, class III: 477 bp and class IV: 618 bp). Four NTS sequences with different lengths (NTS-I: 83 bp, NTS-II: 220 bp, NTS-III: 375 bp and NTS-IV: 498 bp) were detected in CCC, and only one NTS sequence (NTS-V: 83 bp) was detected in KOC. Four NTS sequences with different lengths (NTS-I: 83 bp; NTS-II: 220 bp; NTS-III: 357 bp; and NTS-IV: 498 bp) were detected in 2nKCF1 and 2nKCF2 (NTS-I: 83 bp, NTS-II: 220 bp, NTS-III: 357 bp and NTS-Ⅳ: 498 bp). Comparative analysis of the NTS sequences exhibited high similarities in the 5S rDNA NTS region; the average similarities between 2nKCF2 and 2nKCF1, 2nKCF2 and KOC, and 2nKCF2 and CCC were 87.90%, 73.40% and 87.90%, respectively.

40 40 40 40 KOC CCC 2nKCF1 2nKCF2

20 10 10 10

sequenced sequenced sequenced sequenced

clones clones clones clones

of of of of

203 203 203 203

bp bp bp bp

Absent 10 sequenced clones of 340 bp 10 sequenced clones of 340 bp 10 sequenced clones of 340 bp

∼500 bp ∼200 bp

DNA fragments Total number of sequenced clones Fish type

Table 3 Results for 5S rDNA fragments obtained by PCR and sequenced clone number.

∼340 bp

∼400 bp

∼600 bp

Y. Wang, et al.

5

Aquaculture 515 (2020) 734584

Y. Wang, et al.

Fig. 3. Sequence comparison of 5S rDNA. A: Sequence comparison of the 5S rDNA coding region in KOC, CCC, 2nKCF1 and 2nKCF2. B: Sequence comparison of the 5S rDNA NTS region in KOC, CCC, 2nKCF1 and 2nKCF2.

sperm in CCC was approximately 1.96 μm, while the diameter of the diploid sperm in 2nKCF2 was approximately 2.87 μm. These results provided direct evidence for the production of diploid sperm by 2nKCF2 (Fig. 6).

3.6. Fluorescence in situ hybridization FISH analysis using the 5S rDNA (Class II, 340 bp) of CCC revealed two strong fluorescence signals and two weak fluorescence signals in CCC, no signal in KOC, one strong signal and one weak signal in 2nKCF1 and one strong signal and one weak signal in 2nKCF2. These experimental results showed that one set of the chromosomes of 2nKCF1 and 2nKCF2 was from the female parent, KOC, and one was from the male parent, CCC (Fig. 4).

4. Discussion Long-term biological evolution studies have shown that species hybridization is an important way to increase genetic variation, and hybridization leads to polyploidy, which has played a very important role in the evolution of plants and animals. The result of distant hybridization of RCC(♀) × CC(♂) showed that distant hybridization can lead to doubled chromosome numbers in germ cells and produce diploid gametes without halving the chromosome number, leading to the formation of 4nAT (Liu et al., 2001). In this study, the distant hybridization of KOC (2n = 100, ♀) and CCC (2n = 100, ♂) produced 2nKCF1 (2n = 100) in F1; subsequent self-mating of 2nKCF1 produced 2nKCF2 and 3nKC. The hybridization of 4nIAT (4n = 200, ♀) and 2nKCF2 (2n = 100, ♂) produced a new type of tetraploid (4nAK), providing direct cytological evidence for the production of unreduced diploid sperm in male 2nKCF2 (Fig. 1). Compared with KOC and CCC, 2nKCF2 has unique morphological characteristics, including a gray and golden head, golden-brown scaly

3.7. Gonadal chromosome Observation Observation of testis preparation of 2nKCF2 showed that male germ cells with 100, 200 and 400 chromosomes were observed at the same time. Diploid spermatozoa could be produced after normal meiosis (Fig. 5). 3.8. Fertility status of male 2nKCF2 During the reproductive season, semen could be collected from 2nKCF2 at two years of age. The sperm of 2nKCF2 and CCC were observed with SEM. The results showed that the head size of sperm in CCC was obviously smaller than that in 2nKCF2. The diameter of the haploid 6

Aquaculture 515 (2020) 734584

Y. Wang, et al.

Fig. 4. FISH hybridization signals in the metaphase chromosomes of KOC, CCC, 2nKCF1 and 2nKCF2 with 5S rDNA (classII, 340 bp) as the probe. A: two strong signals (red arrows) and two weak signals (white arrows) were found in CCC; B: no signal was found in KOC; C: one strong signal (red arrow) and one weak signal (white arrow) were found in 2nKCF1; D: one strong signal (red arrow) and one weak signal (white arrow) were found in 2nKCF2. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

2nKCF2 provided important evidence for the production of diploid sperm by 2nKCF2 (Fig. 5). Moreover, electron microscopy and paraffin sectioning experiments showed that diploid 2nKCF2 could produce diploid sperm, which was also the evidence for the good fertility of 2nKCF2 (Fig. 6). Overall, 2nKCF2 was useful for the reproductive bilology and genetic breeding, For the reproductive biology, 2nKCF2 provided an excellent model for investigation of the formation of the unreduced gametes. Regarding the genetic breeding, 2nKCF2 was useful in the production of the polyploid fish including the tetraploid fish and triploid fish. The formation of 4nAK had very important significance in the establishment of the new type of tetraploid fish lineage with special genotypes with four sets of chromosome and the hybrid genomes, and unique phenotypes including gold head, golden-brown scaly outer edge, and smooth golden-yellow back. Especially, one of the most recognizable features of 4nAK was its black-spotted head.The 4nAK are very useful for producing the triploid fish by crossing 4nAK with the diploid fish. On the other hand, the 2nKCF2 can also be used to produce the triploid fish by crossing 2nKCF2 with the diploid fish because 2nKCF2 can produce the unreduced sperm. In this study, both 2nKCF2 and 4nAK enriched the resource of diploid gametes, which was of great significance in fish genetic breeding and biologcial evolution.

outer edge, neat golden-yellow back, and barbells (Fig. 1). 2nKCF2 had obvious hybrid characteristics (Table 1). For example, in terms of phenotypes, the BH/BL, HH/HL, HH/BH and CPL/CPH ratios of 2nKCF2 were intermediate between and significantly different from those of KOC and CCC (P < 0.05). The BL/WL ratio of 2nKCF2 was equal to that of CCC and significantly lower than that of KOC (P < 0.05) (Table 1). The numbers of lateral scales and anal fins in 2nKCF2 were intermediate between those in KOC and CCC. The numbers of upper lateral scales, lower lateral scales and abdominal fins in 2nKCF2 were the same as those in KOC and CCC (Table 1). In terms of chromosome number and karyotype, KOC had 100 chromosomes with the karyotype 22 m + 30sm + 24t+24st, and CCC had 100 chromosomes with the karyotype 22 m + 34sm + 22st+22t. However, 2nKCF2 had 100 chromosomes with the karyotype 22 m + 30sm + 24t+24st. These results showed that 2nKCF2 was diploid (Table 2 and Fig. 2). The results of 5S rDNA amplification and sequencing of KOC, CCC, 2nKCF1 and 2nKCF2 showed that there was only one 5S rDNA structural unit in KOC, four 5S rDNA structural units in CCC, and five 5S rDNA structural units in 2nKCF1 and 2nKCF2. According to the sequence comparison of the common CDS, obvious base changes were found in the internal control regions Box A and Box C of the 5S rDNA coding region, while only individual base changes were found in the internal element (IE), which proved that the 5S rDNA coding region was highly conserved, but there were base differences. By comparing the NTS regions of KOC, CCC, 2nKCF1 and 2nKCF2, it was found that 2nKCF2 was highly similar to both the immediate parent and the original parents, which confirmed their genetic relationship, i.e., that 2nKCF2 was derived from the original parents (KOC and CCC) (Fig. 3). FISH can effectively be used to determine the genetic composition of hybrid diploids and polyploids at the chromosome level. Here, the FISH results indicated that the 2nKCF2 contained one set of chromosome from maternal KOC and one set of chromosome from paternal CCC (Fig. 4). The chromosome duplication in the germ cells of the testis of

Declaration of Competing interest The authors declare no conflict of interest.

Acknowledgments We would like to sincerely appreciate many researchers who helped complete this manuscript. 7

Aquaculture 515 (2020) 734584

Y. Wang, et al.

Fig. 5. Chromosomes of the germ cells in 2nKCF2 testis. A: the number of chromosomes was 100; B: the number of chromosomes was 200; C: the number of chromosomes was 400; bar = 10 μm. Fig. 6. Sperm ultrastructure and microstructure of 2nCCC and 2nKCF2. A: sperm structure of CCC observed in SEM, bar = 1 mm; B: sperm structure of 2nKCF2 observed in SEM, bar = 1 mm; C: sperm structure of CCC observed in light microscope, bar = 20 mm; D: sperm structure of 2nKCF2 observed in light microscope, bar = 20 mm.

Appendix A. Supplementary data

Author contributions

Supplementary data to this article can be found online at https:// doi.org/10.1016/j.aquaculture.2019.734584.

This study was conceived and designed by S.J.L.; Y.D.W., M.H.Z. and S.F.T. contributed experimental work, most of the statistical 8

Aquaculture 515 (2020) 734584

Y. Wang, et al.

analysis and to manuscript writing; L.C., Q.B.Q., J.W., X.X. and H.F.T. contributed to primer design and the bioinformatics analysis; Y.D.W. contributed to the collection of experimental materials; M.T., C.Z., M.M. and B.C. contributed to photograph collection. All authors read and approve the final manuscript.

Difference Test. vol. 81. Publications of the American Statistical Association, pp. 1000–1004. Levan, A., Fredga, K., Sandberg, A., 2010. Nomenclature for centromeric position on chromosomes. Hereditas 52, 201–220. Liu, S., 2010. Distant hybridization leads to different ploidy fishes. Sci. China Life Sci. 53, 416–425. Liu, S., Duan, W., Tao, M., Zhang, C., Sun, Y., Shen, J., Wang, J., Luo, K., Liu, Y., 2007. Establishment of the diploid gynogenetic hybrid clonal line of red crucian carp× common carp. Sci. China Ser. C Life Sci. 50, 186–193. Liu, S., Liu, Y., Zhou, G., Zhang, X., Luo, C., Feng, H., He, X., Zhu, G., Yang, H., 2001. The formation of tetraploid stocks of red crucian carp× common carp hybrids as an effect of interspecific hybridization. Aquaculture 192, 171–186. Liu, S., Sun, Y., Zhang, C., Luo, K., Liu, Y., 2004. Production of gynogenetic progeny from allotetraploid hybrids red crucian carp× common carp. Aquaculture 236, 193–200. Liu, S.J., Sun, Y.D., Luo, K.K., Liu, Y., 2006. Evidence of different ploidy eggs produced by diploid F hybrids of. Acta Genet. Sin. 33, 304–311. Mason, A.S., Nelson, M.N., Yan, G., Cowling, W.A., 2011. Production of viable male unreduced gametes in Brassica interspecific hybrids is genotype specific and stimulated by cold temperatures. BMC Plant Biol. 11, 103. Matsuo, M.Y., Asakawa, S., Shimizu, N., Kimura, H., Nonaka, M., 2002. Nucleotide sequence of the MHC class I genomic region of a teleost, the medaka (Oryzias latipes). Immunogenetics 53, 930–940. Morishima, K., Yoshikawa, H., Arai, K., 2008. Meiotic hybridogenesis in triploid Misgurnus loach derived from a clonal lineage. Heredity 100, 581–586. Perry, M.C., Mcintosh, M.S., Weibold, W.J., Welterlen, M., 1987. Genetic analysis of cold hardiness and dormancy in alfalfa. Genome 29, 144–149. Qinbo, Q., Weiguo, H., Shaojun, L., Jing, W., Jun, X., Yun, L., 2010. Analysis of 5S rDNA organization and variation in polyploid hybrids from crosses of different fish subfamilies. J. Exp. Zool. B Mol. Dev. Evol. 314B, 403–411. Qin, Q., Wang, Y., Wang, J., Dai, J., Xiao, J., Hu, F., Luo, K., Tao, M., Zhang, C., Liu, Y., 2014. The autotetraploid fish derived from hybridization of Carassius auratus red var. (female)× Megalobrama amblycephala (male). Biol. Reprod. 91 (93) 91-11. Ramsey, J., 2007. Unreduced gametes and neopolyploids in natural populations of Achillea borealis (Asteraceae). Heredity 98, 143. Russell, D.W., Sambrook, J., 2001. Molecular Cloning. A Laboratory Manual. Schwartz, F.J., 1981. World Literature to Fish Hybrids with an Analysis by Family, Species, and Hybrid: Supplement 1. Sun, Y.-D., Liu, S.-J., Zhang, C., Li, J.-Z., Huang, W.-R., Zhang, J., Luo, K., Zhou, G.-J., Liu, Y., 2003. The chromosome number and gonadal structure of F9-F11 allotetraploid crucian-carp. Yi chuan xue bao= Acta genetica Sinica 30, 414–418. Wang, S., Ye, X., Wang, Y., Chen, Y., Lin, B., Yi, Z., Mao, Z., Hu, F., Zhao, R., Wang, J., 2017. A new type of homodiploid fish derived from the interspecific hybridization of female common carp× male blunt snout bream. Sci. Rep. 7, 4189.

Funding This work was supported by the National Natural Science Foundation of China (grant no. 31430088, 31730098, 91631305); the earmarked fund for China Agriculture Research System (grant no. CARS-45); the National Natural Science Foundation of Hunan Provincial Natural Science and Technology Major Project (grant no. 2017NK1031); the Cooperative Innovation Center of Engineering, High-level Talent Agglomeration Program of Hunan, China (2019RS1044); the National Key Research and Development Program of China (2018YFD0901202); and New Products for Developmental Biology of Hunan Province (grant no. 20134486). References Biradar, D.P., Lane Rayburn, A., 2016. Heterosis and nuclear DNA content in maize. Heredity 71, 300–304. Chourrout, D.,., Chevassus, B.,., Krieg, F.,., Happe, A.,., Burger, G., Renard, P., 1986. Production of second generation triploid and tetraploid rainbow trout by mating tetraploid males and diploid females - potential of tetraploid fish. Theor. Appl. Genet. 72, 193–206. De Storme, N., Zamariola, L., Mau, M., Sharbel, T.F., Geelen, D., 2013. Volume-based pollen size analysis: an advanced method to assess somatic and gametophytic ploidy in flowering plants. Plant Reprod. 26, 65–81. Dewitte, A., Eeckhaut, T., Van Huylenbroeck, J., Van Bockstaele, E., 2009. Occurrence of viable unreduced pollen in a Begonia collection. Euphytica 168, 81–94. Duan, W., Qin, Q.B., Song, C., Liu, S.J., Jing, W., Zhang, C., Sun, Y.D., Yun, L., 2007. The formation of improved tetraploid population of red crucian carp × common carp hybrids by androgenesis. Science in China 50, 753–761. Groose, R.W., Kojis, W.P., Bingham, E.T., 1988. Combining ability differences between isogenic diploid and tetraploid alfalfa. Cropence 28, 7–10. Hayter, A.J., 1986. The Maximum Familywise Error Rate of Fisher's Least Significant

9