Unsaturated fatty acids promote hepatoma proliferation and progression through downregulation of the tumor suppressor PTEN

Journal of Hepatology 50 (2009) 1132–1141 www.elsevier.com/locate/jhep

Unsaturated fatty acids promote hepatoma proliferation and progression through downregulation of the tumor suppressor PTENq Manlio Vinciguerra1, Fabio Carrozzino1, Marion Peyrou1, Sebastiano Carlone2, Roberto Montesano1, Roberto Benelli2, Michelangelo Foti1,* 1

Department of Cellular Physiology and Metabolism, Faculty of Medicine, University of Geneva, CMU, 1 rue Michel-Servet, 1211 Geneva, Switzerland 2 Department of Translational Oncology, National Institute for Cancer Research, Genova, Italy

Background/Aims: The impact of dietary fatty acids on the development of cancers is highly controversial. We recently demonstrated that unsaturated fatty acids trigger the downregulation of the tumor suppressor PTEN through an mTOR/ NF-jB-dependent mechanism in hepatocytes. In this study, we investigated whether unsaturated fatty acids promote hepatoma progression by downregulating PTEN expression. Methods: The effects of fatty acids and PTEN-specific siRNAs on proliferation, invasiveness and gene expression were assessed using HepG2 hepatoma cells. The tumor promoting activity of unsaturated fatty acids was evaluated in vivo using HepG2 xenografts in nude mice. Results: Incubation of HepG2 cells with unsaturated fatty acids, or PTEN-specific siRNAs, increased cell proliferation, cell migration and invasiveness, and altered the expression of genes involved in inflammation, epithelial-to-mesenchymal transition and carcinogenesis. These effects were dependent on PTEN expression levels and were prevented by mTOR and NF-jB inhibitors. Consistent with these data, the development and size of subcutaneous HepG2-derived tumors in nude mice xenografts were dramatically increased when mice were fed with an oleic acid-enriched diet, even in the absence of weight gain. Conclusions: These data demonstrate that dietary unsaturated fatty acids promote hepatoma progression by reducing the expression of the tumor suppressor PTEN. Ó 2009 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved. Keywords: PTEN; Hepatocytes; Cancer; UFAs; mTOR; NF-jBp65

1. Introduction

Received 1 October 2008; received in revised form 15 January 2009; accepted 17 January 2009; available online 1 April 2009 Associate Editor: K. Koike q The authors who have taken part in this study declared that they do not have anything to disclose regarding funding from industry or conflict of interest with respect to this manuscript. * Corresponding author. Tel.: +41 22 3795204; fax: +41 22 3795260. E-mail address: [email protected] (M. Foti). Abbreviations: FFA, free fatty acid; UFA, unsaturated fatty acid; NAFLD, non-alcoholic fatty liver diseases; HCC, hepatocellular carcinoma; HCA, hepatocellular adenoma; OA, oleic acid; PoA, palmitoleic acid; PA, palmitic acid; LA, linoleic acid; SA, stearic acid; EMT, epithelial-to-mesenchymal transition.

Non-alcoholic fatty liver diseases (NAFLD) are commonly associated with obesity and diabetes [1], which are important risk factors for the occurrence of hepatocellular carcinoma (HCC) [2,3]. NAFLD encompass histological features ranging from hepatic steatosis, steatohepatitis, fibrosis and cryptogenic cirrhosis [4]. HCC might occur as a likely end stage of NAFLD. Benign hepatocellular adenoma (HCA) can also display a marked steatosis and undergo malignant transformation [5,6]. Interestingly, telangiectatic adenoma, which can evolve to HCC, occur mainly in overweight/obese patients [7].

0168-8278/$36.00 Ó 2009 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.jhep.2009.01.027

M. Vinciguerra et al. / Journal of Hepatology 50 (2009) 1132–1141

Among the signaling pathways controlling cell proliferation and death, abnormal regulation of the PI3K/ AKT/mTOR pathway plays a key role in tumor development [8]. Indeed, inhibition of PI3K and mTOR markedly impair proliferation of human HCC cells [9,10]. The tumor suppressor PTEN is a phosphoinositide phosphatase, which antagonizes the PI3K activity by dephosphorylating PtdIns(3,4)P2/PtdIns(3,4,5)P3 [11]. PTEN is frequently mutated/deleted in human cancers including HCC [12–14] and liver-specific PTEN knockout mice develop steatosis and steatohepatitis, as well as hepatomegaly and HCC with ageing [15,16]. Further evidence indicates that deregulated PTEN expression/activity in hepatocytes, rather than PTEN mutations/deletions, can mediate the development of NAFLD. We indeed demonstrated that liver steatosis is triggered by PTEN downregulation in hepatocytes exposed to unsaturated fatty acids (UFAs). In this process, the activation of an mTOR/NF-jB complex by UFAs triggers PTEN downregulation [17]. There is a common agreement that nutritional components are important determinants associated with the risk of cancer development. In particular, circulating free fatty acids (FFAs), whose increased levels are a hallmark of the human metabolic syndrome [18], are associated either with prevention or increased risk of cancer development [19,20]. However, whether pathological deregulation of PTEN expression/activity induced by FFAs is a mechanism promoting progression of NAFLD towards the development of HCA/HCC remains to be elucidated. In this study, we investigated whether dietary FFAs promote hepatocyte proliferation and carcinogenesis by downregulating PTEN expression. We report that UFAs trigger a HCC-like gene expression program, proliferation and invasiveness of hepatoma cells via PTENdependent mechanisms.

2. Materials and methods 2.1. Reagents, antibodies and plasmids All reagents, antibodies and plasmids are shown in Table 1.

2.2. Western analyses Cells/tissues were homogenized in ice-cold RIPA containing protease inhibitors. Proteins were resolved by 10% SDS–PAGE, blotted to nitrocellulose membranes and detected with ECL. Quantifications were performed using the ChemiDocTM XRS from Bio-Rad and the Quantity OneTM software.

1133

Transient transfections with the PTEN-GFP construct were performed using FuGene6 reagent. PTEN-GFP-positive cells were isolated by FACS (FACSVantage, Becton–Dickinson) prior to utilization. Lentiviral transduction of PTEN-specific siRNAs was previously described [17].

2.4. Cell proliferation, apoptosis and viability assays Cell proliferation was evaluated using quantitative sulphorhodamine B (SRB) colorimetric assay as previously described [21]. Caspase 3 enzymatic activity was measured with a fluorometric immunosorbent enzyme assay from Roche. Cell viability was evaluated by propidium iodide staining and FACS analysis (FACSscan, Becton–Dickinson).

2.5. Real-time PCR RNA was isolated from tissues/cells using Trizol reagent. Firststrand cDNA synthesis was performed in the presence of 10 ng/L random hexamer primers and the SuperScript-II Reverse Transcriptase. Quantitative PCR was performed using the Quantitect SYBRÒGreen PCR kit in a Light-Cycler (Roche). GAPDH/Po/cyclophilin transcripts were used as internal controls for normalization. Primer sequences are listed in Table 2.

2.6. Chemoinvasion assay Chemoinvasion assay was performed as previously described [22] in 48-microwell chemotaxis chambers (Neuro Probe, Gaithersburg, USA), using 8-lm pore-size polyvinylpyrrolidone-free polycarbonate membranes (Neuro Probe) coated with 100 lg/ml type I collagen [23] followed by 1.2 mg/well of growth factor-reduced Matrigel [24]. Fifty thousands cells in serum-free DMEM (SFM) were added to the upper chamber wells, while the lower chambers were filled with SFM containing 20 ng/ml HGF as a chemoattractant. SFM alone was used as control. Invasion was allowed for 5 h at 37 °C and cells were fixed with 100% ethanol and stained with toluidine blue. Chemoinvasion was measured by densitometric analysis using the Scion Image software (Scion Corporation, Frederick, USA).

2.7. Triglycerides (TG) and non-esterified fatty acids (NEFAs) measurements Total TG and NEFAs in the plasma were measured by enzymatic colorimetric methods using the TG-PAP and Wako-NEFA-C commercial kits, respectively.

2.8. Nude mice xenografts The experimental protocol was approved by the ethical committee of the National Institute for Cancer Research of Genova. Six-week-old nu/nu athymic mice (Charles River, Italy) were fed with either a standard diet or a special diet containing 35% macadamia oil (75% oleic acid and 20% palmitoleic acid [25]). After 48 h, 5  106 HepG2 cells in 100 ll Matrigel were injected subcutaneously in the flank of each mouse; one group of mice on standard diet received cells embedded in Matrigel loaded with 50 lM OA. The test was terminated after 19 days; tumors were collected, weighted and processed for paraffinembedding and hematoxylin/eosin staining or snap-frozen for mRNA and protein analyses. A plasma sample was obtained from mice immediately after sacrifice.

2.3. Cell cultures, transfections and retroviral transductions

2.9. Statistical analysis

HepG2 cells were cultured in DMEM/10% FCS, LNCaP and Intestine 407 cells in RPMI/5% FCS and MCF-7 cells in DMEM/F-12/10% FCS.

Results are expressed as means ± SE. Comparisons were made by using appropriated Student’s t-test. Differences were considered as significant when P < 0.05 (*), P < 0.01 (**) or P < 0.001 (***).

1134

M. Vinciguerra et al. / Journal of Hepatology 50 (2009) 1132–1141

Table 1 Antibodies, reagents and plasmid. Primary antibodies

Host

Clone

Provider

Catalogue number

PTEN SHIP2 phospho(Ser473)-AKT AKT actin

Mouse Goat Rabbit Rabbit Mouse

A2B1 C4

SantaCruz (CA, USA) SantaCruz (CA, USA) Cell Signaling (MA, USA) Cell Signaling (MA, USA) Chemicon (CA, USA)

SC-7974 SC-14504 9271 4685 MAB1501 R

Secondary antibodies

Host

Provider

Catalogue number

HRP-conjugated anti-mouse antibodies HRP-conjugated anti-rabbit antibodies HRP conjugated anti-Goat

Goat Goat Rabbit

Biorad (Basel, Switzerland) Biorad (Basel, Switzerland) Sigma (St Louis, USA)

170-6516 170-6515 A-5420

Reagents

Provider

Catalogue number

Rapamycin PDTC HGF Fatty acids FuGene HD reagent ECL reagent Trizol Reagent random hexamer primers SuperScript II Reverse Transcriptase Quantitect SYBRÒGreen PCR kit sulphorhodamine B Kit for Caspase 3 activity TG PAP kit Wako-NEFA-C kit Growth factor-reduced Matrigel Macadamia oil-enriched diet

Calbiochem (BadSoden, Germany) Sigma (St Louis, USA) gift from the late R. Schwall, Genentech, San Francisco, CA, USA Sigma (St Louis, USA) Roche (Basel, Switzerland) Amersham (Du¨bendorf, Switzerland) Invitrogen (Carlsbad, CA) Invitrogen (Carlsbad, CA) Invitrogen (Carlsbad, CA) Qiagen (Basel, CH) Sigma (St Louis, USA) Roche (Basel, Switzerland) Biomerieux (Lyon, France) Oxoid (Dardilly, France) BD Bioscences (Franklin Lakes, NJ, USA) SSNIFF (Soest, Germany)

553211 P8765 O1208, P9417, P0500, L1376 04 709 705 001 RPN2135 15596-018 48190-011 18064-022 204143 S1402 2012952 61236 999-75406 354230

Plasmid insert

Backbone

Source

References

PTEN-GFP

pCDNA3

A. Ross (Univ. of Massachusetts, USA)

Liu F et al., J Cell Biochem 2005, 96:221-34.

3. Results 3.1. UFAs specifically downregulate PTEN expression in liver-derived cells PTEN expression is significantly downregulated in hepatoma cells (Huh7, HepG2), immortalized and primary human hepatocytes exposed to UFAs [26]. To investigate whether PTEN downregulation is a common outcome in cells derived from different tissues exposed to UFAs, we treated HepG2, LNCaP (prostate), MCF-7 (breast) and intestine 407 cells with 50 lM oleic acid (OA) for 24 h. Although the baseline PTEN expression in these cells was different, PTEN mRNA and protein expression was specifically downregulated by OA only in HepG2 cells (Fig. 1A–C). In contrast, expression of SHIP2, another phosphoinositide phosphatase, was unaltered (Fig. 1B). Consistent with a decreased PTEN expression, basal Akt activity in HepG2 cells was strongly enhanced by OA (Fig. 1C). Of note, AKT phosphorylation in Intestine 407 cells was undetectable. These findings suggest a selective PTEN downregulation and enhanced basal Akt activity induced by OA in liver-derived cells.

3.2. FFAs and PTEN expression affect HepG2 cell proliferation, apoptosis and viability Given the tumor suppressor activity of PTEN [14], OA-mediated PTEN downregulation might affect cell proliferation. HepG2 cell proliferation was thus measured following exposure to 50 lM OA over 96 h. OA induced a significant increase in proliferation and the same effect was obtained by downregulating PTEN with specific siRNAs (Fig. 2A). Conversely, ectopic expression of a functional PTEN-GFP chimera [27] inhibited proliferation and antagonized the effect of OA (Fig. 2B). These data indicate that OA-induced HepG2 cells proliferation is mediated by PTEN downregulation. Since FFAs were previously suggested to trigger hepatocyte apoptosis [28], we investigated whether OA affects HepG2 cells apoptosis and viability. As shown in Fig. 2C–D, OA increases caspase 3 activity and decreases cell viability only at concentrations exceeding 100 lM. Similarly to OA, other UFAs, i.e. palmitoleic acid and linoleic acid, increased proliferation and apoptosis, whereas saturated fatty acids, i.e. palmitic and stearic acids, did not affect proliferation but were highly pro-apoptotic as previously described [28] (Fig. 2E–F).

M. Vinciguerra et al. / Journal of Hepatology 50 (2009) 1132–1141 Table 2 Primers sequences for real-time PCR. Human Forward PTEN SHIP2 GAPDH Po Cyclophilin TGFb aSMA Twist Snail E-cadherin HIF-1a IL-8 TNFa VEGF p53 MAD1 Hsp70 Cyclin D1 MMP2 MMP9 TIMP1 TIMP2 AFP SCD-1

0

5 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50

1135

Reverse 0

GGGTCTGAGTCGCCTGTCA 3 TCGTCACCAGCGACCATTC 30 CATGTTCCAATATGATTCCACC 30 CCTCATATCCGGGGGAATGTG 30 ATGGTCAACCCCACCGTGT 30 GCAACAATTCCTGGCGATACCTC 30 TGATCACCATCGGAAATGAA 30 GGAGTCCGCAGTCTTACGAG 30 ATGAGGAATCTGGCTGCTGT 30 TGAGTGTCCCCCGGTATCTTC 30 CACAGAAGCAAAGAACCCATTT 30 CTGCGCCAACACAGAAATTA 30 CGTCTCCTACCAGACAAGG 30 AGGAGGAGGGCAGAATCATCA 30 TCAACAAGATGTTTTGCCAACTG 30 TCGACCAGCTTCAGCGAGA 30 AGGTGCAGGTGAGCTACAAGG 30 GGCGGAGGAGAACAAACAGA 30 GCTCAGATCCGTGGTGAGAT 30 TTTCGACGATGACGAGTTGT 30 AGACACCAGAGAACCCACCA 30 AAGCGGTCAGTGAGAAGGAA 30 TGCAGCCAAAGTGAAGAGGGAAGA 30 CGAGCCGGAGTTTACAGAAG 30

These findings demonstrate that UFAs have a dual, dose-dependent effect on HepG2 cell proliferation and viability, i.e. they promote cell proliferation at low doses, while inducing cell death at high concentrations. 3.3. OA-mediated PTEN downregulation modulates expression of genes involved in liver carcinogenesis Hepatocyte proliferation and malignant transformation are associated with profound changes in the expression of genes implicated in epithelial-to-mesenchymal transition (EMT), inflammation and angiogenesis, migration/invasion and cell cycle regulation. We assessed by real time-PCR the expression of genes commonly associated with carcinogenesis in HepG2 cells exposed to 50 lM OA for 24 h, or transduced with PTEN siRNAs. As shown in Fig. 3A and B, mRNA levels of genes promoting EMT (i.e. TGFb, Snail, aSMA, Twist), angiogenesis and inflammation (TNFa, IL-8, HIF-1a), cell cycle progression (Hsp70, cyclin D1) and cell invasiveness (MMP-2, MMP-9) were strongly upregulated by either OA or PTEN siRNAs. In contrast, repressors of the cell cycle (e.g. p53 and MAD1), or of cell invasiveness (e.g. TIMP-2), were downregulated in the same conditions (Fig. 3B). PTEN overexpression did not significantly alter the basal expression of the genes examined, except for aSMA, but the effects of OA were completely prevented (Fig. 3C and D). Consistent with previous studies [29], expression of stearoylCoA desaturase-1 (SCD-1), an enzyme generating

50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50

CCGTGTTGGAGGCAGTAGAAG 30 AGCCCTTTCTTGGAGATGAACTG 30 GATGGGATTTCCATTGATGAC 30 GCAGCAGCTGGCACCTTATTG 30 TCTGCTGTCTTTGGGACCTTGTC 30 AGTTCTTCTCCGTGGAGCTGAAG 30 CGGCTTCATCGTATTCCTGT 30 TCTGGAGGACCTGGTAGAGG 30 CAGGAGAAAATGCCTTTGGA 30 CAGTATCAGCCGCTTTCAGATTTT 30 TGACAACTGATCGAAGGAACG 30 ATTGCATCTGGCAACCCTAC 30 CCAAAGTAGACCTGCCCAGA 30 CTCGATTGGATGGCAGTAGCT 30 ATGTGCTGTGACTGCTTGTAGATG 30 GTGGAGCCGATGCTGTCC 30 GGTCAGCACCATGGACGAG 30 TGGCACAAGAGGCAACGA 30 TTGGTTCTCCAGCTTCAGGT 30 TCGCTGGTACAGGTCGAGTA 30 TTTGCAGGGGATGGATAAAC 30 GAAGGGATGTCAGAGCTGGA 30 CATAGCGAGCAGCCCAAAGAAGAA 30 TATTTCCTCAGCCCCCTTTT 30

endogenous OA and potentially involved in carcinogenesis [29–31] was unaltered in HepG2 cells expose to OA, or depleted of PTEN by siRNAs (data not shown). Together, these data indicate that UFAs induce, via PTEN-dependent mechanisms, profound changes in the expression of genes associated with hepatocyte transformation. 3.4. UFAs-mediated PTEN repression enhance HepG2 cells invasiveness PTEN was previously reported to control cell migration and invasion [32,33]. We thus evaluated the effects of UFAs on HepG2 cells invasiveness. As shown in Fig. 4A, invasion of HepG2 cells triggered by HGF was drastically enhanced following 24 h exposure to 50 lM oleic, palmitoleic or linoleic acids. In contrast, the saturated palmitic acid was ineffective. A similar increased invasiveness was induced by PTEN siRNAs in the absence of UFAs (Fig. 4B). Since UFAs trigger PTEN downregulation in HepG2 cells through NF-jB/mTOR-dependent mechanisms [17], we investigated whether the UFAs-mediated increased invasive potential of HepG2 cells was dependent of NF-jB/mTOR activities. As illustrated in Fig. 4C, rapamycin (a mTOR inhibitor) and PDTC (a NF-jB inhibitor) strongly suppressed the OA-dependent increase of cells invasiveness. Importantly, the invasion-enhancing effects of OA were also prevented by ectopic PTEN expression (Fig. 4D).

1136

M. Vinciguerra et al. / Journal of Hepatology 50 (2009) 1132–1141

Fig. 1. Oleic acid (OA) downregulates PTEN expression specifically in liver-derived cells. HepG2, LNCaP (prostate), MCF-7 (breast) and Intestine-407 cells were treated with 50 lM OA for 24 h. (A) Real time-PCR analysis of PTEN mRNA expression. (B) Representative Western blots of PTEN, SHIP2, phospho-AKT(ser473), AKT and actin expression. (C) Quantifications of PTEN protein levels (left) and phospho-AKT(ser473)/total-AKT ratios (right). Results are means ± SE of 3 independent experiments (*,**P versus unstimulated control cells).

These data indicate that UFAs enhance HepG2 cells invasiveness by downregulating PTEN via mTOR/NFjB-dependent mechanisms. 3.5. UFAs accelerate growth of hepatoma in nude mice xenografts The local or systemic effects of UFAs on HepG2 cell proliferation and carcinogenesis were further assessed in vivo by analyzing the growth of HepG2-derived tumors inoculated subcutaneously in athymic nu/nu mice. Three experimental groups were defined: (1) control mice were injected with Matrigel-embedded HepG2 cells (CTL), (2) local exposure to UFAs was performed by injecting HepG2 cells embedded in Matrigel supplemented with 50 lM OA (OA-embedding), and (3) systemic exposure to UFAs was performed by injecting

Matrigel-embedded HepG2 cells and feeding mice with a macadamia oil-enriched diet (Macadamia). Tumor growth was then monitored daily during 19 days. Interestingly, mice fed with the macadamia-enriched diet were slightly underweighed as compared to control mice, possibly as a result of reduced food intake (Fig. 5A and data not shown). Noteworthy, however, plasma levels of NEFAs were significantly more elevated in these mice, whereas the triglycerides levels were unchanged (Fig. 5B and C). HepG2 implants did not show any sign of growth until day 10 after inoculation, when a small (0.2  0.2 cm) tumor became detectable in the macadamia-diet group. At day 19, all macadamia oil-fed mice (7/7, 100%) had developed tumors, 6/7 mice (86%) of the OA-group showed tumors, while solid tumors had grown in only 3/7 control mice (43%). Necropsy indicated that mice of the macadamia oil-group

M. Vinciguerra et al. / Journal of Hepatology 50 (2009) 1132–1141

1137

Fig. 2. Effects of various FFAs and PTEN expression on HepG2 cells proliferation, apoptosis and cell viability. (A) Proliferation of cells treated with 50 lM OA or depleted of PTEN by specific siRNAs. (B) Proliferation of cells treated with 50 lM OA and/or overexpressing a PTEN-GFP construct. (C) Dose-dependent effect of OA (24 h) on caspase 3 activity. (D) Dose-dependent effect of OA (24 h) on cell viability. (E) Effect of 50 lM unsaturated and saturated FFA (OA: oleic acid, PoA: palmitoleic acid, PA: palmitic acid, LA: linoleic acid and SA: stearic acid) on cell proliferation. Results are expressed as the percentage of control untreated cells (CTL) following 72 h and 96 h exposure to FFAs. (F) Dose-dependent effect of 24 h incubation with FFAs on apoptosis. Results are means ± SE of three independent experiments (*,**,***P versus unstimulated control cells).

and of the OA-group had generated larger tumors (means 0.44 ± 0.2 and 0.31 ± 0.2 g, respectively) as compared to controls (0.08 ± 0.1 g) (Fig. 5D). These data indicate that systemic or local UFAs strongly promote growth of HepG2-derived tumors. Histological analysis of tumors did not reveal obvious difference in histopathological features among the three groups (Supplementary Fig. 1). As expected, PTEN expression in tumors locally or systematically exposed to UFAs was significantly decreased, while basal AKT activation was increased (Fig. 5E). Together, these data indicate that either local or systemic exposure of HepG2 xenografts to UFAs drastically increase the development of primary tumors via PTEN-dependent mechanisms.

4. Discussion Epidemiological studies have strongly associated obesity and elevated FFAs plasma levels with a high risk of cancer development in various organs [34,35]. However, the molecular mechanisms by which FFA can pro-

mote carcinogenesis are poorly understood. Herein, we demonstrate that UFAs act as strong promoters of HepG2 carcinogenesis by specifically downregulating the expression of the tumor suppressor PTEN. Reduced PTEN expression promotes hepatoma cells proliferation and invasiveness in addition to striking changes in gene expression resembling those associated with HCC development. More importantly, local or systemic increase of UFAs levels fosters the establishment and growth of HepG2 xenografts in nude mice. These data indicate that, besides inducing cellular responses typically associated with malignant transformation, UFAs accelerate the development of established cancer. Overall, our findings support the notion that UFAs, by downregulating hepatic PTEN expression, promote liver tumor initiation and progression. The molecular mechanisms responsible for the specific effect of UFAs on PTEN expression in hepatocytes are currently unknown. However, our data support the concept that lipogenic tissues, such as the liver, have specific regulatory mechanisms governing the expression of genes involved in the lipid homeostasis and cellular proliferation, as it was previ-

1138

M. Vinciguerra et al. / Journal of Hepatology 50 (2009) 1132–1141

Fig. 3. PTEN downregulation by OA in HepG2 cells modulate the expression of genes involved in liver carcinogenesis. (A and B) Cells were treated with 50 lM OA for 24 h or depleted of PTEN by specific siRNAs prior to real time-PCR analyses. Cells transduced with scrambled siRNAs were used as control. (C and D) Real time-PCR analyses of gene expression in cells treated with 50 lM OA for 24 h and/or overexpressing a PTEN-GFP chimera. Results are means ± SE of 2–5 independent experiments (*, **P versus unstimulated control cells).

ously demonstrated for other genes [29,36]. Consistent with the proliferative effect of UFAs on HepG2 cells, NASH was suggested to represent a premalignant condition promoting hepatocyte hyperproliferation [37]. However, FFA-mediated hepatocytes apoptosis can also occur with NASH [28,38]. These contradictory data may be reconciled by our finding of a dose-dependent effect of UFAs on HepG2 cell viability and apoptosis. At low doses, OA activates the AKT pathway thus promoting cell proliferation and invasiveness, and is then incorporated into intracellular triglycerides [17]. Such a proliferative effect of OA is also observed in non-hepatic cells [39,40]. It is likely however, that above a cell-specific threshold, the lipid storage capacity of cells is exceeded and high doses of UFAs can generate oxidative damage and alterations in membrane fluidity or functions, thus leading to cell death and apoptosis [41,42]. Such a dual effect of UFAs on proliferation/viability was also previously observed in non-hepatic cells [43,44]. Regarding the pro-apoptotic rather than proliferative effects of saturated fatty acids, our data are consistent with previous reports [28,45].

PTEN downregulation or mutation/deletion, as well as upregulation of microRNAs targeting PTEN for degradation, are observed in human HCC [12,13,33] and lead to steatosis, steatohepatitis and HCC in animals [15–17]. However, these events have so far not been associated with the metabolic syndrome. The present data and our previous studies [17,26] indicate that PTEN downregulation in hepatocytes is induced by dietary UFAs, suggesting that alterations of PTEN expression by deregulated metabolic factors contribute importantly to the development of liver injuries. Consistent with our results, deregulated PTEN expression affects cytokine expression [46], induces developmental and oncogenic EMT [47], favors migration and invasiveness of cancer cells [32,33], and perturbs chromosomal stability and DNA repair [48]. Since inflammation, EMT and genomic alterations are typical features of HCC [49,50], impaired PTEN expression/activity induced by excessive circulating UFAs can thus represent an important factor in progression of NAFLD towards HCC. Epidemiological studies assessing the impact of diets enriched in specific FFAs on human cancer

M. Vinciguerra et al. / Journal of Hepatology 50 (2009) 1132–1141

1139

Fig. 4. In vitro enhancement of HepG2 cell invasion by UFAs and repression of PTEN expression. Cells were incubated with 50 lM FFAs for 24 h prior to the chemoinvasion assay and HGF (20 ng/ml) was used as a chemoattractant. Serum-free medium (SFM) was used as a control for random unstimulated invasiveness. (A) Effect of palmitic (PA), palmitoleic (PoA), oleic (OA) or linoleic (LA) acids on cell invasiveness. (B) Cell invasiveness following PTEN depletion by siRNAs (siPTEN). (C) Effect of mTOR inhibitor (rapamycin, 200 nM) and NF-jB inhibitor (PDTC, 1 lM) on cell invasiveness induced by OA. (D) Effect of PTEN overexpression (PTEN-GFP) on cell invasiveness induced by OA. Results are expressed as mean values ± SE from three independent experiments run in sextuplicate (**, ***P versus positive control).

susceptibility are controversial and often validated for a single tumor species and/or type of diet [19]. Similarly, studies using experimental animal models have suggested that dietary FFAs can be beneficial or detrimental for cancer progression depending on the type of cancer and FFA analyzed [19,20]. Interestingly, OA was shown to robustly increase mammary tumor growth and metastasis in vivo [51]. Our HepG2 in vivo model also strongly supports a harmful effect of UFAs on HCC development. Indeed, HepG2 xenografts, exposed to local or systemic OA, showed a striking increase in tumor establishment and growth. Due to the extensive growth of tumors in both OAenriched groups, the experiments were terminated after 19 days for ethical reasons. Within this time window, macroscopic metastases were not observed in livers and lungs. It should be noted that in previous studies, even longer tests were insufficient to observe HepG2 metastasis [52]. HepG2 tumors also showed minimal local invasion, albeit in the macadamia-treated group we observed one anecdotal tumor invading the adjacent muscles. Although different molecular mechanisms have been proposed to mediate the UFAs effects on cancer development, our study is the first one to demonstrate a specific effect of dietary UFAs

on the regulation of a critical tumor suppressor, PTEN, which is at the crossroad of metabolic and proliferative processes promoting HCC. Our study also suggests that UFAs-driven downregulation of PTEN, instead of mutations/deletions, could be a critical step in the development and progression of HCA/HCC. This is in agreement with the recently proposed concept that the partial functional loss of a tumor suppressor, e.g. PTEN downregulation or haplo-insufficiency, is sufficient to promote carcinogenesis, as it was elegantly demonstrated for mouse prostate cancer progression [14]. Further studies are now required to establish whether PTEN downregulation in hepatocytes is an unfavorable prognostic marker for the risk of HCA/HCC development and whether adoption of new dietary guidelines minimizing UFAs consumption may prove beneficial for patients predisposed to develop, or suffering of, HCC. Acknowledgement We thank Simona Minghelli and Christine Maeder for technical help. This work was supported by the Swiss National Science Foundation (Grant 310000-120280/1

1140

M. Vinciguerra et al. / Journal of Hepatology 50 (2009) 1132–1141

Fig. 5. Effect of local or systemic exposure to UFAs on HepG2-derived tumor growth in nude mice xenografts. Nude mice were injected subcutaneously with HepG2 cells embedded in plain Matrigel (CTL), or in Matrigel loaded with 50 lM OA (OA-embedding). A third group of mice were injected subcutaneously with Matrigel-embedded HepG2 cells and put on a high-fat diet enriched in unsaturated FFAs (Macadamia). (A) Mice weights after 3 weeks. (B) Plasma levels of NEFAs. (C) Plasma levels of triglycerides (TG). (D) Weights of HepG2-derived primary subcutaneous tumors after 3 weeks. (E) PTEN mRNA expression in HepG2-derived tumors (left panel). Western blots of PTEN, SHIP2, pAKT(Ser473), AKT and actin expression and quantifications of PTEN protein levels and pAKT/AKT ratios in HepG2-derived tumors (right panel). SHIP2 mRNA and protein expression was assessed as a control for the specificity of the UFAs effects on PTEN. Results are means ± SE of seven different animals for each of the three experimental group (*, **P versus control mice group).

to M.F. and Grant 3100A0-113832/1 to R.M.), the Eagle Foundation to M.F., and the Compagnia di San Paolo to R.B.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/ j.jhep.2009.01.027.

References [1] Adams LA, Angulo P. Recent concepts in non-alcoholic fatty liver disease. Diabet Med 2005;22:1129–1133. [2] Caldwell SH, Crespo DM, Kang HS, Al-Osaimi AM. Obesity and hepatocellular carcinoma. Gastroenterology 2004;127: S97–S103. [3] El-Serag HB, Hampel H, Javadi F. The association between diabetes and hepatocellular carcinoma: a systematic review of epidemiologic evidence. Clin Gastroenterol Hepatol 2006;4:369–380. [4] Contos MJ, Choudhury J, Mills AS, Sanyal AJ. The histologic spectrum of nonalcoholic fatty liver disease. Clin Liver Dis 2004;8:481–500.

[5] Zucman-Rossi J, Jeannot E, Nhieu JT, Scoazec JY, Guettier C, Rebouissou S, et al. Genotype-phenotype correlation in hepatocellular adenoma: new classification and relationship with HCC. Hepatology 2006;43:515–524. [6] Bioulac-Sage P, Balabaud C, Bedossa P, Scoazec JY, Chiche L, Dhillon AP, et al. Pathological diagnosis of liver cell adenoma and focal nodular hyperplasia: Bordeaux update. J Hepatol 2007;46:521–527. [7] Paradis V, Champault A, Ronot M, Deschamps L, Valla DC, Vidaud D, et al. Telangiectatic adenoma: an entity associated with increased body mass index and inflammation. Hepatology 2007;46:140–146. [8] Hay N. The Akt-mTOR tango and its relevance to cancer. Cancer Cell 2005;8:179–183. [9] Nakanishi K, Sakamoto M, Yasuda J, Takamura M, Fujita N, Tsuruo T, et al. Critical involvement of the phosphatidylinositol 3-kinase/Akt pathway in anchorage-independent growth and hematogeneous intrahepatic metastasis of liver cancer. Cancer Res 2002;62:2971–2975. [10] Sahin F, Kannangai R, Adegbola O, Wang J, Su G, Torbenson M. mTOR and P70 S6 kinase expression in primary liver neoplasms. Clin Cancer Res 2004;10:8421–8425. [11] Downes CP, Perera N, Ross S, Leslie NR. Substrate specificity and acute regulation of the tumour suppressor phosphatase, PTEN. Biochem Soc Symp 2007; 69–80. [12] Yao YJ, Ping XL, Zhang H, Chen FF, Lee PK, Ahsan H, et al. PTEN/MMAC1 mutations in hepatocellular carcinomas. Oncogene 1999;18:3181–3185.

M. Vinciguerra et al. / Journal of Hepatology 50 (2009) 1132–1141 [13] Dong-Dong L, Xi-Ran Z, Xiang-Rong C. Expression and significance of new tumor suppressor gene PTEN in primary liver cancer. J Cell Mol Med 2003;7:67–71. [14] Salmena L, Carracedo A, Pandolfi PP. Tenets of PTEN tumor suppression. Cell 2008;133:403–414. [15] Horie Y, Suzuki A, Kataoka E, Sasaki T, Hamada K, Sasaki J, et al. Hepatocyte-specific Pten deficiency results in steatohepatitis and hepatocellular carcinomas. J Clin Invest 2004;113:1774–1783. [16] Stiles B, Wang Y, Stahl A, Bassilian S, Lee WP, Kim YJ, et al. Liver-specific deletion of negative regulator Pten results in fatty liver and insulin hypersensitivity [corrected]. Proc Natl Acad Sci USA 2004;101:2082–2087. [17] Vinciguerra M, Veyrat-Durebex C, Moukil MA, Rubbia-Brandt L, Rohner-Jeanrenaud F, Foti M. PTEN down-regulation by unsaturated fatty acids triggers hepatic steatosis via an NFkappaBp65/mTOR-dependent mechanism. Gastroenterology 2008;134:268–280. [18] Eckel RH, Grundy SM, Zimmet PZ. The metabolic syndrome. Lancet 2005;365:1415–1428. [19] Escrich E, Moral R, Grau L, Costa I, Solanas M. Molecular mechanisms of the effects of olive oil and other dietary lipids on cancer. Mol Nutr Food Res 2007;51:1279–1292. [20] Sauer LA, Blask DE, Dauchy RT. Dietary factors and growth and metabolism in experimental tumors. J Nutr Biochem 2007;18:637–649. [21] Skehan P, Storeng R, Scudiero D, Monks A, McMahon J, Vistica D, et al. New colorimetric cytotoxicity assay for anticancer-drug screening. J Natl Cancer Inst 1990;82:1107–1112. [22] Falk W, Goodwin Jr RH, Leonard Jr EJ. A 48-well micro chemotaxis assembly for rapid and accurate measurement of leukocyte migration. J Immunol Methods 1980;33:239–247. [23] Montesano R, Orci L. Tumor-promoting phorbol esters induce angiogenesis in vitro. Cell 1985;42:469–477. [24] Albini A, Benelli R. The chemoinvasion assay: a method to assess tumor and endothelial cell invasion and its modulation. Nat Protoc 2007;2:504–511. [25] Maguire LS, O’Sullivan SM, Galvin K, O’Connor TP, O’Brien NM. Fatty acid profile, tocopherol, squalene and phytosterol content of walnuts, almonds, peanuts, hazelnuts and the macadamia nut. Int J Food Sci Nutr 2004;55:171–178. [26] Vinciguerra M, Sgroi A, Veyrat-Durebex C, Rubbia-Brandt L, Buhler L, Foti M. Unsaturated fatty acids inhibit the expression of tumor suppressor phosphatase and tensin homolog (PTEN) via microRNA-21 up-regulation in hepatocytes. Hepatology 2008;49:1176–1184. [27] Liu F, Wagner S, Campbell RB, Nickerson JA, Schiffer CA, Ross AH. PTEN enters the nucleus by diffusion. J Cell Biochem 2005;96:221–234. [28] Malhi H, Bronk SF, Werneburg NW, Gores GJ. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. J Biol Chem 2006;281:12093–12101. [29] Ntambi JM, Miyazaki M, Dobrzyn A. Regulation of stearoylCoA desaturase expression. Lipids 2004;39:1061–1065. [30] Falvella FS, Pascale RM, Gariboldi M, Manenti G, De Miglio MR, Simile MM, et al. Stearoyl-CoA desaturase 1 (Scd1) gene overexpression is associated with genetic predisposition to hepatocarcinogenesis in mice and rats. Carcinogenesis 2002;23:1933–1936. [31] Scaglia N, Igal RA. Inhibition of Stearoyl-CoA Desaturase 1 expression in human lung adenocarcinoma cells impairs tumorigenesis. Int J Oncol 2008;33:839–850. [32] Leslie NR, Yang X, Downes CP, Weijer CJ. The regulation of cell migration by PTEN. Biochem Soc Trans 2005;33:1507–1508. [33] Meng F, Henson R, Wehbe-Janek H, Ghoshal K, Jacob ST, Patel T. MicroRNA-21 regulates expression of the PTEN tumor

[34] [35]

[36]

[37]

[38]

[39]

[40]

[41]

[42] [43]

[44]

[45]

[46]

[47]

[48]

[49] [50]

[51]

[52]

1141

suppressor gene in human hepatocellular cancer. Gastroenterology 2007;133:647–658. Hsu IR, Kim SP, Kabir M, Bergman RN. Metabolic syndrome, hyperinsulinemia, and cancer. Am J Clin Nutr 2007;86:s867–s871. Escrich E, Solanas M, Moral R, Costa I, Grau L. Are the olive oil and other dietary lipids related to cancer? Experimental evidence. Clin Transl Oncol 2006;8:868–883. Thewke D, Kramer M, Sinensky MS. Transcriptional homeostatic control of membrane lipid composition. Biochem Biophys Res Commun 2000;273:1–4. Yang S, Lin HZ, Hwang J, Chacko VP, Diehl AM. Hepatic hyperplasia in noncirrhotic fatty livers: is obesity-related hepatic steatosis a premalignant condition? Cancer Res 2001;61:5016–5023. Feldstein AE, Canbay A, Angulo P, Taniai M, Burgart LJ, Lindor KD, et al. Hepatocyte apoptosis and fas expression are prominent features of human nonalcoholic steatohepatitis. Gastroenterology 2003;125:437–443. Zhang Y, Liu C, Zhu L, Jiang X, Chen X, Qi X, et al. PGC-1alpha inhibits oleic acid induced proliferation and migration of rat vascular smooth muscle cells. PLoS ONE 2007;2:e1137. Craven PA, DeRubertis FR. Role of activation of protein kinase C in the stimulation of colonic epithelial proliferation by unsaturated fatty acids. Gastroenterology 1988;95:676–685. de Vries JE, Vork MM, Roemen TH, de Jong YF, Cleutjens JP, van der Vusse GJ, et al. Saturated but not mono-unsaturated fatty acids induce apoptotic cell death in neonatal rat ventricular myocytes. J Lipid Res 1997;38:1384–1394. Malhi H, Gores GJ. Molecular mechanisms of lipotoxicity in nonalcoholic fatty liver disease. Semin Liver Dis 2008;28:360–369. Southgate J, Pitt E, Trejdosiewicz LK. The effects of dietary fatty acids on the proliferation of normal human urothelial cells in vitro. Br J Cancer 1996;74:728–734. Verlengia R, Gorjao R, Kanunfre CC, Bordin S, de Lima TM, Newsholme P, et al. Genes regulated by arachidonic and oleic acids in Raji cells. Lipids 2003;38:1157–1165. Feldstein AE, Werneburg NW, Canbay A, Guicciardi ME, Bronk SF, Rydzewski R, et al. Free fatty acids promote hepatic lipotoxicity by stimulating TNF-alpha expression via a lysosomal pathway. Hepatology 2004;40:185–194. Furumoto Y, Brooks S, Olivera A, Takagi Y, Miyagishi M, Taira K, et al. Cutting edge: Lentiviral short hairpin RNA silencing of PTEN in human mast cells reveals constitutive signals that promote cytokine secretion and cell survival. J Immunol 2006;176:5167–5171. Wang H QS, Dong JM, Manser E, Tang JP, Zeng Q. PRL-3 down-regulates PTEN expression and signals through PI3K to promote epithelial-mesenchymal transition. Cancer Res 2007;67:2922–2926. Shen WH, Balajee AS, Wang J, Wu H, Eng C, Pandolfi PP, et al. Essential role for nuclear PTEN in maintaining chromosomal integrity. Cell 2007;128:157–170. Laurent-Puig P, Zucman-Rossi J. Genetics of hepatocellular tumors. Oncogene 2006;25:3778–3786. Lee TK, Poon RT, Yuen AP, Ling MT, Kwok WK, Wang XH, et al. Twist overexpression correlates with hepatocellular carcinoma metastasis through induction of epithelial–mesenchymal transition. Clin Cancer Res 2006;12:5369–5376. Buckman DK, Chapkin RS, Erickson KL. Modulation of mouse mammary tumor growth and linoleate enhanced metastasis by oleate. J Nutr 1990;120:148–157. Schnater JM, Bruder E, Bertschin S, Woodtli T, de Theije C, Pietsch T, et al. Subcutaneous and intrahepatic growth of human hepatoblastoma in immunodeficient mice. J Hepatol 2006;45:377–386.