- Email: [email protected]
Up and Down-Regulation of Phosphodiesterase-5 as Related to Tachyphylaxis and Priapism
0022-5347/03/1702-0015/0 THE JOURNAL OF UROLOGY® Copyright © 2003 by AMERICAN UROLOGICAL ASSOCIATION
Vol. 170, S15–S19, August 2003 Printed in U.S.A.
DOI: 10.1097/01.ju.0000075500.11519.e8
UP AND DOWN-REGULATION OF PHOSPHODIESTERASE-5 AS RELATED TO TACHYPHYLAXIS AND PRIAPISM GUITING LIN, ZHONG-CHENG XIN, TOM F. LUE
AND
CHING-SHWUN LIN*
From the Knuppe Molecular Urology Laboratory, Department of Urology, School of Medicine, University of California, San Francisco, California (GL, TFL, C-SL), and Department of Urology, Peking University, China (Z-CX)
ABSTRACT
Purpose: We identify whether tachyphylaxis and priapism effects of sildenafil are related to regulation of phosphodiesterase-5 (PDE-5) expression. Materials and Methods: Cavernous smooth muscle cells (CSMCs) were isolated from young rats and treated with 0, 1, 10 and 25 M sildenafil with or without 100 M of sodium nitroprusside for 3 and 7 days. The cells were subjected to reverse transcriptase-polymerase chain reaction and Western blot analysis for PDE-5 expression. Plasmid constructs carrying PDE-5A1 and PDE-5A2 promoters were transfected into COS-7 cells, treated with 25 M sildenafil and analyzed for promoter activities. To simulate priapism, CSMCs were cultured under anoxia or hypoxia and then analyzed for PDE-5 expression. Furthermore, rats underwent bilateral pudendal arterial ligation for 1 day to 14 weeks, and corpus cavernous tissues were subjected to reverse transcriptase-polymerase chain reaction analysis for PDE-5 expression. Results: Up-regulation of PDE-5 was noted in CSMCs treated with 25 M sildenafil for 7 days. PDE-5 messenger RNA and protein levels were significantly increased in the 7-day sildenafil treated cultures. Sodium nitroprusside appeared to down-regulate PDE-5 expression. Sildenafil significantly increased the activities of PDE-5A1 promoter. PDE-5 expression was significantly reduced under anoxia and hypoxia. The corpus cavernous tissue showed a gradual decrease in PDE-5 expression under ischemia. Conclusions: Repeated treatment with sildenafil at high concentrations was needed to simulate tachyphylaxis in our cell culture system. Adequate oxygenation was important for PDE-5 expression. Thus, sicklemic patients may express PDE-5 at abnormally low levels, predisposing them at risk of stuttering priapism. KEY WORDS: up-regulation, down-regulation, phosphodiesterase inhibitors, tachyphylaxis priapism
Although sildenafil has proven to be effective in treating erectile dysfunction (ED), a recent report suggests that its prolonged use may produce tachyphylaxis since 20% of the patients who were followed for 2 years required increased dosages and 17% discontinued use due to loss of efficacy.1 An early review article had cautioned that prolonged inhibition of phosphodiesterase-5 (PDE-5) by sildenafil might upregulate PDE-5 expression.2 More recently, we have shown that increasing concentrations of cyclic guanosine monophosphate (cGMP) produced higher PDE-5 promoter activities.3 Therefore, it is possible that the observed tachyphylaxis effect of sildenafil could be a result of persistent activation of PDE-5 promoters by the sildenafil mediated accumulation of cGMP. In contrast to ED, priapism occurs infrequently but requires immediate medical attention. As an orally administered agent, sildenafil has not been found to cause priapism in clinical trials. However, priapism was reported in a 53year-old man 3 days after taking 200 mg sildenafil without prescription,4 in a 28-year-old man who took 100 mg sildenafil without prescription,5 and in a 55-year-old man after injecting into the corpus cavernosum a 25 ml solution consisting of a ground 100 mg sildenafil pill and 2% lidocaine.6 Although these cases of priapism are all associated with unsupervised use of sildenafil, they collectively suggest that
PDE-5 over inhibition by overdose or improper use of sildenafil might cause priapism. They also point out the possibility that certain types of priapism might be associated with abnormally low levels of PDE-5 expression. Specifically, patients with sickle cell disease are prone to recurrent priapism. It is known that during prolonged normal erection the static blood within the corporal sinuses gradually loses oxygen tension and pH.7 In this relative hypoxic and acidotic environment erythrocytes of sicklemic patients become more sickled, further sludge the outflowing veins, and thus worsen the hypoxic condition. As this vicious cycle of tissue hypoxia and erythrocyte sickling ensues, ischemic priapism develops.8 Indeed, it is generally agreed that most cases of stuttering priapism, characterized as repeated self-resolving periods lasting from 20 minutes to 3 hours, occur after 1 episode of ischemic priapism. Previous reports have demonstrated the dependence of corporal contractile activity on oxygenation9, 10 and, therefore, it is conceivable that certain components of the contractile pathway are dysfunctional or under expressed under anoxia. Since PDE-5 has critical roles in returning the relaxed cavernous smooth muscle to the contracted state, we wondered whether its expression could be affected by anoxia and thus linked to ischemic and stuttering priapism. We investigated possible upregulation and down-regulation of PDE-5 in association with prolonged overdose of sildenafil and anoxia, respectively.
Supported by grants from the California Urology Foundation, Mr. Arthur Rock and the Rock Foundation, and National Institutes of Health Grant 2R01-DK-45370. * Corresponding author: Department of Urology, Knuppe MolecuMATERIALS AND METHODS lar Urology Laboratory, University of California School of Medicine, Animal model. The animal model has been described preSan Francisco, CA 94143-1695, telephone: 415-353-7205, FAX: 415viously.11 Briefly, 6-month-old male Sprague-Dawley rats 353-9586, e-mail: [email protected] S15
S16
REGULATION OF PHOSPHODIESTERASE-5
were used in all experiments. Longitudinal incisions were made on the gluteal area on both sides of the tail of the rats. The internal pudendal arteries were ligated with 7-zero nylon. Treatment with sildenafil and sodium nitroprusside (SNP). Cultures of rat cavernous smooth muscle cells (CSMCs) as described previously12 were seeded at 4 ⫻ 105 cells in 3 ml. Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum per well in 6-well culture plates. The medium was changed 72 hours later with 1% bovine serum albumin. After 16 hours of further incubation the cells were treated with sildenafil citrate (Pfizer Inc., New York, New York) at the indicated concentrations with or without 100 M sodium nitroprusside (Sigma Chemical Co., St. Louis, Missouri). Sildenafil and SNP of the indicated concentrations were added daily for 3 and 7 days. For the 7-day cultures the medium was changed with fresh medium once at 3 days. The cells were then analyzed for PDE-5 expression. Anoxic and hypoxic cell culture. To achieve anoxia glass Petri dishes containing CSMCs were placed into glass-tight aluminum gassing jigs.13 The jigs were subjected to 5 rounds of evacuation and flushing with either 95% air and 5% CO2 (oxic condition) or 95% N2 and 5% CO2 (anoxic condition) on a shaking platform at room temperature. After the last round of evacuation and flushing, the jigs were placed in a 37C incubator for 16 hours. The cells were then harvested for analysis. To achieve hypoxia CSMCs were grown in the presence of 300 M CoCl2 for 24 and 48 hours.14 Reverse transcription (RT)-polymerase chain reaction (PCR) analysis. RT-PCR was performed as described previously with oligonucleotide primers shown in the Appendix.12 The cycling program was set for 35 cycles of 94C for 10 seconds, 55C for 10 seconds and 72C for 10 seconds, followed by 1 cycle of 72C for 5 minutes. The PCR products were electrophoresed in 1.5% agarose gels, visualized by ultraviolet fluorescence and recorded by a digital camera. The data were then analyzed by the ChemiImager-4000 program (Alpha Innotech Corporation, San Leandro, California). Western blot analysis. The CSMCs were subjected to Western blot analysis as previously described.12 Briefly, cell lysates each containing 30 g protein were electrophoresed in 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidine difluoride membrane (Millipore Corp., Bedford, Massachusetts). After washing and blocking, the membrane was incubated with an antiPDE-5 monoclonal antibody (BD Bioscience, San Jose, California), washed 3 times, incubated with horseradish peroxidase-conjugated secondary antibody and subjected to the enhanced chemiluminescent detection. The resulting images were scanned into computer and analyzed by the ChemiImager-4000 program. Promoter activity assay. Plasmids containing full length promoters of PDE-5A and PDE-5A2 were transfected into COS-7 cells as previously described.3 To normalize the data for transfection efficiency, the pRL-SV40 plasmid (Promega Inc., Madison, Wisconsin) was cotransfected with each test plasmid. The cells to be transfected were seeded at approximately 2 ⫻ 105 per well in a 6-well plate. The next day 2 g of each test plasmid DNA and 0.5 ng of pRL-SV40 were transfected into the cultured cells in each well. Cells were treated 24 hours later with 25 M sildenafil or phosphate buffered saline (PBS). The cells were further maintained for 24 hours before being washed and lysed in 100 l of lysis buffer (Promega Inc.). The activities of firefly luciferase and Renilla luciferase were measured in 20 l aliquots of each cell lysate using the Dual-Luciferase reporter assay system (Promega Inc.) and the TD-20/20 luminometer (Turner Designs Inc., Sunnyvale, California). Each test plasmid was transfected and assayed for luciferase activity at least 3 times. We used computer software for statistical analysis of the densitometry data.15
RESULTS
Up-regulation of PDE-5 by sildenafil. To test whether sildenafil could up-regulate PDE-5 expression, CSMCs were treated with different dosages of sildenafil every day for 3 and 7 days. RT-PCR analysis showed that at 3 days there was no significant difference in PDE-5 expression between treated and untreated cells (fig. 1). At 7 days PDE-5 expression was significantly lower than at 3 days regardless of treatment. Among these 7-day samples the one treated with 25 M sildenafil expressed PDE-5 at a significantly higher level than the others. Effects of SNP on PDE-5 protein expression. To test the effect of SNP on PDE-5 expression, the same CSMCs were treated daily with 100 M SNP with and without 25 M sildenafil for 3 and 7 days. RT-PCR analysis showed that PDE-5 expression was down-regulated by SNP in 3 and 7-day treated cells (fig. 2, A). Furthermore, SNP did not further up-regulate PDE-5 expression in sildenafil treated cells. Upregulation and down-regulation of PDE-5 by sildenafil and SNP were further verified by Western blot analysis for protein expression (fig. 2, B). Effects of sildenafil on PDE-5 promoters. We had used CSMCs for promoter activity assays with limited success,3 most likely due to poor transfection efficiency. In this study we initially tested the effect of sildenafil on PDE-5 promoter activities in CSMCs but observed low activities with or without treatment with sildenafil (data not shown). When the experiments were performed with COS-7 cells, we observed significantly higher promoter activity with sildenafil treated than with PBS treated PDE-5A promoter (fig. 3). However, the intronic PDE-5A2 promoter did not respond to sildenafil (fig. 3). Effects of anoxia and hypoxia on PDE-5 expression. By using a system in which oxygen was completely replaced with nitrogen,13 PDE-5 expression was significantly reduced in CSMCs under anoxia (fig. 4). Because cobalt is known to mimic hypoxia,16 we used it to test the effect of hypoxia on PDE-5 expression, and found that PDE-5 expression was reduced under hypoxia (fig. 4). Effects of ischemia on PDE-5 expression. We had previously shown that bilateral pudendal arterial ligation produced cavernous tissue ischemia accompanying arteriogenic impotence.11 We collected cavernous tissues of these rats from which we prepared complementary DNA libraries. PCR analysis on PDE-5 expression in these libraries showed that control, sham operated, 1-day ligated rats and 3-day ligated rats had similar levels of PDE-5 expression (fig. 5). In the
FIG. 1. Effect of sildenafil on PDE-5 expression. CSMCs were treated with 0, 1, 10 and 25 M sildenafil for 3 and 7 days. Cells were harvested and analyzed for PDE-5 expression by RT-PCR. Beta-actin expression was used as control.
REGULATION OF PHOSPHODIESTERASE-5
S17
FIG. 4. Effects of anoxia and hypoxia on PDE-5 expression. Rat CSMCs were cultured in presence of 95% O2 or 95% N2 in absence (O) or presence (CO) of 300 M cobalt chloride. Cells were harvested and analyzed for PDE-5 expression by RT-PCR. Beta-actin expression was used as control.
FIG. 2. Effect of sildenafil and SNP on PDE-5 expression. A, CSMCs were untreated (C) or treated with 100 M SNP (N), 25 M sildenafil (S) or both (NS) for 3 and 7 days. Cells were harvested and analyzed for PDE-5 expression by RT-PCR. Beta-actin expression was used as control. B, CSMCs were treated similarly as described in part A except only for 7 days. Cells were harvested and analyzed for PDE-5 expression by Western blotting.
FIG. 5. Effect of ischemia on PDE-5 expression. Internal pudendal arteries of rats were ligated for indicated times. Control rats (C) were never operated on and sham operated rats (S) were operated on without the ligation. Corpus cavernous tissues were harvested and analyzed for PDE-5 expression by RT-PCR. Beta-actin expression was used as control.
FIG. 3. Effect of sildenafil on PDE-5A promoters. Plasmid carrying no insert (vector), or PDE-5A1 (A1) or PDE-5A2 (A2) promoter was transfected into COS-7 cells. Internal control plasmid, pRLSV40, was also transfected. Cells were then treated with 25 M sildenafil or PBS. Promoter activities are expressed as ratios between firefly luciferase (FFL) and Renilla luciferase (RL) that were produced by test and control plasmids, respectively.
1-week ligated rats PDE-5 expression started to decrease, and this trend continued to the 3 and 6-week ligated rats. By 12 weeks PDE-5 expression was no longer detectable. DISCUSSION
We first tested whether sildenafil could up-regulate the expression of PDE-5. Because of the limitation on the number of days primary cell cultures can be healthily and continuously maintained, we chose 7 days as the experiment end
point. Indeed, PDE-5 expression was significantly lower in the 7-day than in the 3-day culture, reflecting the decrease of phenotypes pertaining to smooth muscle or other unknown factors. As for the choice of sildenafil dosages, we referred to the information provided by the manufacturer on its web site, which describes the peak plasma concentration as approximately 750 nM. Therefore, we chose dosages of 1 M and up for our cell culture system. Treatment with 25 M sildenafil for 7 days was necessary to produce an appreciable upregulation of PDE-5. Requirement of this large dosage could perhaps reflect the need to compensate for the much shorter treatment time (7 days) in comparison with the time (more than a year) it takes to produce the observed tachyphylaxis.1 It also points to the much agreed on observation that sildenafil is safe at its normal clinical dosage with perhaps only a mild tendency of producing tachyphylaxis. It was somewhat surprising that SNP not only did not aid sildenafil in up-regulating PDE-5 expression, but also seemed to have a negative effect on PDE-5 expression. At present, the significance of this observation is not clear. However, it should be noted that prolonged treatment of vascular smooth muscle cells with SNP is known to decrease PKG-I expression.17 Although Kim et al have shown that under short-term treatments (20 minutes) SNP and sildenafil were required to increase cellular cGMP levels,18 researchers from the same laboratory also showed that at high dosages sildenafil was able to increase cGMP levels, relax
S18
REGULATION OF PHOSPHODIESTERASE-5
cavernous strips and produce erection (when injected intracavernously) in the absence of a nitric oxide donor.19 As such, it is intriguing to consider that up-regulation of PDE-5 by sildenafil could also operate in a nitric oxide independent manner. Due to the low transfection efficiency with primary CSMCs, our promoter assays were conducted with COS-7 cells instead. In addition, due to the need to allow for optimal expression of the transfected luciferase constructs, treatment with sildenafil lasted only 24 hours. Although this was a much shorter time than the 7-day treatment in the previous experiments, the possible reasons why we were nevertheless able to observe the effect of sildenafil are the high copy number of the transfected PDE-5 promoter and the high sensitivity of the luciferase assay. As we have shown previously,3 the PDE-5A2 promoter was much weaker than the PDE-5A promoter, which could perhaps explain why no effect of sildenafil was observed with the PDE-5A2 promoter. Because detumescence apparently requires the cGMP hydrolytic activity of PDE-5, we speculated on the possible connection between priapism and PDE-5 under expression. In addition, because priapism occurs frequently in sicklemic patients and anoxia has been shown to eliminate the normal contractility of corporal smooth muscle,9 we postulated that anoxia and ischemia might negatively affect the expression of PDE-5. Indeed, we observed down-regulation of PDE-5 in CSMCs under anoxia and hypoxia, and we also observed down-regulation of PDE-5 in ischemic cavernous tissues of rats, in which the pudendal arteries were ligated. Based on these results, we suggest that under expression of PDE-5 may prolong smooth muscle relaxation and thus aggravate ischemic priapism, enhance post-ischemic hyperemia (and partial priapism) often seen after therapy for severe ischemic priapism and contribute to stuttering priapism. Cellular response to hypoxia is mediated by hypoxia inducible factor 1 that binds to the hypoxia responsive element of hypoxia responsive genes such as EPO and VEGF. Although most of these genes respond to hypoxia in a positive manner, there have been 2 instances of down-regulation.20, 21 With the existence of HRE-like sequences in the flanking region of the PDE-5A gene,3 it is possible that down-regulation of PDE-5 by hypoxia could also be mediated by hypoxia inducible factor 1. We are currently testing these hypoxia responsive element like sequences for their roles in PDE-5 promoter activities under hypoxia. CONCLUSIONS
Up-regulation of PDE-5 expression by sildenafil at a large dosage provides a molecular basis for the observed tachyphylaxis effect of sildenafil. However, it also points out the high degree of safety of sildenafil when used at normal dosages. Hypoxia induced PDE-5 under expression may be related to priapism. APPENDIX: OLIGONUCLEOTIDE PRIMERS
Gene Beta-actin PDE-5
Primer Name
Sequence
Beta-actin-s Beta-actin-a PDE-5-s PDE-5-a
TCTACAATGAGCTGCGTGTG AATGTCACGCACGATTTCCC CCTTGTGCAGAACTTCCAGA TCCGTTGTTGAATAGGCCAG
Size of PCR Product 368 bp 584 bp
REFERENCES
1. El-Galley, R., Rutland, H., Talic, R., Keane, T. and Clark, H.: Long-term efficacy of sildenafil and tachyphylaxis effect. J Urol, 166: 927, 2001
2. Moreland, R. B., Goldstein, I. I., Kim, N. N. and Traish, A.: Sildenafil citrate, a selective phosphodiesterase type 5 inhibitor. Trends Endocrinol Metab, 10: 97, 1999 3. Lin, C. S., Chow, S., Lau, A., Tu, R. and Lue, T. F.: Human PDE5A gene encodes three PDE5 isoforms from two alternate promoters. Int J Impot Res, 14: 15, 2002 4. Aoyagi, T., Hayakawa, K., Miyaji, K., Ishikawa, H. and Hata, M.: Sildenafil induced priapism. Bull Tokyo Dent Coll, 40: 215, 1999 5. Sur, R. L. and Kane, C. J.: Sildenafil citrate-associated priapism. Urology, 55: 950, 2000 6. Yoon, H., Kim, D. S., Lim, J. S., Chung, W. S. and Park, Y. Y.: Intracavernosal injection of sildenafil citrate: misapplication of the drug. J Urol, 165: 1218, 2001 7. Aboseif, S. R. and Lue, T. F.: Hemodynamics of penile erection. Urol Clin North Am, 15: 1, 1988 8. Siegel, J. F., Rich, M. A. and Brock, W. A.: Association of sickle cell disease, priapism, exchange transfusion and neurological events: ASPEN syndrome. J Urol, 150: 1480, 1993 9. Broderick, G. A., Gordon, D., Hypolite, J. and Levin, R. M.: Anoxia and corporal smooth muscle dysfunction: a model for ischemic priapism. J Urol, 151: 259, 1994 10. Kim, N. N., Kim, J. J., Hypolite, J., Garcia-Diaz, J. F., Broderick, G. A., Tornheim, K. et al: Altered contractility of rabbit penile corpus cavernosum smooth muscle by hypoxia. J Urol, 155: 772, 1996 11. Lin, C. S., Ho, H. C., Gholami, S., Chen, K. C., Jad, A. and Lue, T. F.: Gene expression profiling of an arteriogenic impotence model. Biochem Biophys Res Commun, 285: 565, 2001 12. Liu, X., Lin, C. S., Graziottin, T., Resplande, J. and Lue, T. F.: Vascular endothelial growth factor promotes proliferation and migration of cavernous smooth muscle cells. J Urol, 166: 354, 2001 13. Ruan, H., Wang, J., Hu, L., Lin, C.-S., Lamborn, K. R. and Deen, D. F.: Killing of brain tumor cells by hypoxia-responsive element mediated expression of BAX. Neoplasia, 1: 431, 1999 14. Liu, X. H., Kirschenbaum, A., Yao, S., Stearns, M. E., Holland, J. F., Claffey, K. et al: Upregulation of vascular endothelial growth factor by cobalt chloride-simulated hypoxia is mediated by persistent induction of cyclooxygenase-2 in a metastatic human prostate cancer cell line. Clin Exp Metastasis, 17: 687, 1999 15. Glantz, S. A.: Primer of Biostatistics, 3rd ed. New York: McGraw Hill, 1992 16. Lee, S. G., Lee, H. and Rho, H. M.: Transcriptional repression of the human p53 gene by cobalt chloride mimicking hypoxia. FEBS Lett, 507: 259, 2001 17. Soff, G. A., Cornwell, T. L., Cundiff, D. L., Gately, S. and Lincoln, T. M.: Smooth muscle cell expression of type I cyclic GMPdependent protein kinase is suppressed by continuous exposure to nitrovasodilators, theophylline, cyclic GMP, and cyclic AMP. J Clin Invest, 100: 2580, 1997 18. Kim, N. N., Huang, Y., Moreland, R. B., Kwak, S. S., Goldstein, I. and Traish, A.: Cross-regulation of intracellular cGMP and cAMP in cultured human corpus cavernosum smooth muscle cells. Mol Cell Biol Res Commun, 4: 10, 2000 19. McAuley, I. W., Kim, N. N., Min, K., Goldstein, I. and Traish, A. M.: Intracavernosal sildenafil facilitates penile erection independent of the nitric oxide pathway. J Androl, 22: 623, 2001 20. Narravula, S. and Colgan, S. P.: Hypoxia-inducible factor 1-mediated inhibition of peroxisome proliferator-activated receptor alpha expression during hypoxia. J Immunol, 166: 7543, 2001 21. Mazure, N. M., Chauvet, C., Bois-Joyeux, B., Bernard, M. A., Nacer-Cherif, H. and Danan, J. L.: Repression of alphafetoprotein gene expression under hypoxic conditions in human hepatoma cells: characterization of a negative hypoxia response element that mediates opposite effects of hypoxia inducible factor-1 and c-Myc. Cancer Res, 62: 1158, 2002
REGULATION OF PHOSPHODIESTERASE-5
S19
DISCUSSION Dr. Irwin Goldstein. Do we have evidence that diabetes, vascular disease, hypertension or high cholesterol up-regulate the PDE, which causes the impotence? In other words, is there so much PDE that you cannot sustain the erection? If we could show that, wouldn’t medical management with androgens have an interesting context because they would have the ability to affect the regulation? Is there any evidence that disease up-regulates PDE? Dr. Tom Lue. The PDE field is so new that not many people are working on that. In our laboratory we are now starting to look at all the possibilities and all the different disease entities. Dr. Ajay Nehra. Have you looked at PDE-5 in impotent patients yet? Doctor Lue. We have just begun to do that. Dr. William Steers. It would be very unlikely that you would up or down-regulate PDE-5 without affecting another PDE. Have you looked at the other PDEs in those cells as well? Doctor Lue. No. This is just the beginning. Dr. Karl-Erik Andersson. Your data showed that high concentrations of sildenafil added to cell culture up-regulated PDE. If there is no activity in the system, there should be very low concentrations of cGMP, and the activity of PDE must be dependent on the substrate. That means that you cannot say that you need very high concentrations of sildenafil to be able to get an up-regulation because in vivo you have activity in the system. You have a lot of substrate. There could also be possibilities of getting up-regulation, even at much lower concentrations. Doctor Lue. Basically, what we are showing is just pure cell culture data. We did not consider the downstream mechanisms. Now obviously, protein kinase G can also work on the up or down-regulation of PDE-5, and so it is much more complicated in an in vivo system. Protein kinase G also down-regulates in terms of activity. Dr. Ridwan Shabsigh. I fully agree that up-regulation of PDE-5 is not expected in the infrequent and low dose use of PDE-5 inhibitors in the context of erectile dysfunction. The average use is about 4 to 6 times a month. However, PDE-5 inhibitors are being considered treatment for other conditions, including pulmonary hypertension in newborns and infants. In that context, I think up-regulation may be an issue. Doctor Lue. Our study was only on the smooth muscle cells from potent men. We have not studied the impotent men yet.
Vol. 170, S15–S19, August 2003 Printed in U.S.A.
DOI: 10.1097/01.ju.0000075500.11519.e8
UP AND DOWN-REGULATION OF PHOSPHODIESTERASE-5 AS RELATED TO TACHYPHYLAXIS AND PRIAPISM GUITING LIN, ZHONG-CHENG XIN, TOM F. LUE
AND
CHING-SHWUN LIN*
From the Knuppe Molecular Urology Laboratory, Department of Urology, School of Medicine, University of California, San Francisco, California (GL, TFL, C-SL), and Department of Urology, Peking University, China (Z-CX)
ABSTRACT
Purpose: We identify whether tachyphylaxis and priapism effects of sildenafil are related to regulation of phosphodiesterase-5 (PDE-5) expression. Materials and Methods: Cavernous smooth muscle cells (CSMCs) were isolated from young rats and treated with 0, 1, 10 and 25 M sildenafil with or without 100 M of sodium nitroprusside for 3 and 7 days. The cells were subjected to reverse transcriptase-polymerase chain reaction and Western blot analysis for PDE-5 expression. Plasmid constructs carrying PDE-5A1 and PDE-5A2 promoters were transfected into COS-7 cells, treated with 25 M sildenafil and analyzed for promoter activities. To simulate priapism, CSMCs were cultured under anoxia or hypoxia and then analyzed for PDE-5 expression. Furthermore, rats underwent bilateral pudendal arterial ligation for 1 day to 14 weeks, and corpus cavernous tissues were subjected to reverse transcriptase-polymerase chain reaction analysis for PDE-5 expression. Results: Up-regulation of PDE-5 was noted in CSMCs treated with 25 M sildenafil for 7 days. PDE-5 messenger RNA and protein levels were significantly increased in the 7-day sildenafil treated cultures. Sodium nitroprusside appeared to down-regulate PDE-5 expression. Sildenafil significantly increased the activities of PDE-5A1 promoter. PDE-5 expression was significantly reduced under anoxia and hypoxia. The corpus cavernous tissue showed a gradual decrease in PDE-5 expression under ischemia. Conclusions: Repeated treatment with sildenafil at high concentrations was needed to simulate tachyphylaxis in our cell culture system. Adequate oxygenation was important for PDE-5 expression. Thus, sicklemic patients may express PDE-5 at abnormally low levels, predisposing them at risk of stuttering priapism. KEY WORDS: up-regulation, down-regulation, phosphodiesterase inhibitors, tachyphylaxis priapism
Although sildenafil has proven to be effective in treating erectile dysfunction (ED), a recent report suggests that its prolonged use may produce tachyphylaxis since 20% of the patients who were followed for 2 years required increased dosages and 17% discontinued use due to loss of efficacy.1 An early review article had cautioned that prolonged inhibition of phosphodiesterase-5 (PDE-5) by sildenafil might upregulate PDE-5 expression.2 More recently, we have shown that increasing concentrations of cyclic guanosine monophosphate (cGMP) produced higher PDE-5 promoter activities.3 Therefore, it is possible that the observed tachyphylaxis effect of sildenafil could be a result of persistent activation of PDE-5 promoters by the sildenafil mediated accumulation of cGMP. In contrast to ED, priapism occurs infrequently but requires immediate medical attention. As an orally administered agent, sildenafil has not been found to cause priapism in clinical trials. However, priapism was reported in a 53year-old man 3 days after taking 200 mg sildenafil without prescription,4 in a 28-year-old man who took 100 mg sildenafil without prescription,5 and in a 55-year-old man after injecting into the corpus cavernosum a 25 ml solution consisting of a ground 100 mg sildenafil pill and 2% lidocaine.6 Although these cases of priapism are all associated with unsupervised use of sildenafil, they collectively suggest that
PDE-5 over inhibition by overdose or improper use of sildenafil might cause priapism. They also point out the possibility that certain types of priapism might be associated with abnormally low levels of PDE-5 expression. Specifically, patients with sickle cell disease are prone to recurrent priapism. It is known that during prolonged normal erection the static blood within the corporal sinuses gradually loses oxygen tension and pH.7 In this relative hypoxic and acidotic environment erythrocytes of sicklemic patients become more sickled, further sludge the outflowing veins, and thus worsen the hypoxic condition. As this vicious cycle of tissue hypoxia and erythrocyte sickling ensues, ischemic priapism develops.8 Indeed, it is generally agreed that most cases of stuttering priapism, characterized as repeated self-resolving periods lasting from 20 minutes to 3 hours, occur after 1 episode of ischemic priapism. Previous reports have demonstrated the dependence of corporal contractile activity on oxygenation9, 10 and, therefore, it is conceivable that certain components of the contractile pathway are dysfunctional or under expressed under anoxia. Since PDE-5 has critical roles in returning the relaxed cavernous smooth muscle to the contracted state, we wondered whether its expression could be affected by anoxia and thus linked to ischemic and stuttering priapism. We investigated possible upregulation and down-regulation of PDE-5 in association with prolonged overdose of sildenafil and anoxia, respectively.
Supported by grants from the California Urology Foundation, Mr. Arthur Rock and the Rock Foundation, and National Institutes of Health Grant 2R01-DK-45370. * Corresponding author: Department of Urology, Knuppe MolecuMATERIALS AND METHODS lar Urology Laboratory, University of California School of Medicine, Animal model. The animal model has been described preSan Francisco, CA 94143-1695, telephone: 415-353-7205, FAX: 415viously.11 Briefly, 6-month-old male Sprague-Dawley rats 353-9586, e-mail: [email protected] S15
S16
REGULATION OF PHOSPHODIESTERASE-5
were used in all experiments. Longitudinal incisions were made on the gluteal area on both sides of the tail of the rats. The internal pudendal arteries were ligated with 7-zero nylon. Treatment with sildenafil and sodium nitroprusside (SNP). Cultures of rat cavernous smooth muscle cells (CSMCs) as described previously12 were seeded at 4 ⫻ 105 cells in 3 ml. Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum per well in 6-well culture plates. The medium was changed 72 hours later with 1% bovine serum albumin. After 16 hours of further incubation the cells were treated with sildenafil citrate (Pfizer Inc., New York, New York) at the indicated concentrations with or without 100 M sodium nitroprusside (Sigma Chemical Co., St. Louis, Missouri). Sildenafil and SNP of the indicated concentrations were added daily for 3 and 7 days. For the 7-day cultures the medium was changed with fresh medium once at 3 days. The cells were then analyzed for PDE-5 expression. Anoxic and hypoxic cell culture. To achieve anoxia glass Petri dishes containing CSMCs were placed into glass-tight aluminum gassing jigs.13 The jigs were subjected to 5 rounds of evacuation and flushing with either 95% air and 5% CO2 (oxic condition) or 95% N2 and 5% CO2 (anoxic condition) on a shaking platform at room temperature. After the last round of evacuation and flushing, the jigs were placed in a 37C incubator for 16 hours. The cells were then harvested for analysis. To achieve hypoxia CSMCs were grown in the presence of 300 M CoCl2 for 24 and 48 hours.14 Reverse transcription (RT)-polymerase chain reaction (PCR) analysis. RT-PCR was performed as described previously with oligonucleotide primers shown in the Appendix.12 The cycling program was set for 35 cycles of 94C for 10 seconds, 55C for 10 seconds and 72C for 10 seconds, followed by 1 cycle of 72C for 5 minutes. The PCR products were electrophoresed in 1.5% agarose gels, visualized by ultraviolet fluorescence and recorded by a digital camera. The data were then analyzed by the ChemiImager-4000 program (Alpha Innotech Corporation, San Leandro, California). Western blot analysis. The CSMCs were subjected to Western blot analysis as previously described.12 Briefly, cell lysates each containing 30 g protein were electrophoresed in 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidine difluoride membrane (Millipore Corp., Bedford, Massachusetts). After washing and blocking, the membrane was incubated with an antiPDE-5 monoclonal antibody (BD Bioscience, San Jose, California), washed 3 times, incubated with horseradish peroxidase-conjugated secondary antibody and subjected to the enhanced chemiluminescent detection. The resulting images were scanned into computer and analyzed by the ChemiImager-4000 program. Promoter activity assay. Plasmids containing full length promoters of PDE-5A and PDE-5A2 were transfected into COS-7 cells as previously described.3 To normalize the data for transfection efficiency, the pRL-SV40 plasmid (Promega Inc., Madison, Wisconsin) was cotransfected with each test plasmid. The cells to be transfected were seeded at approximately 2 ⫻ 105 per well in a 6-well plate. The next day 2 g of each test plasmid DNA and 0.5 ng of pRL-SV40 were transfected into the cultured cells in each well. Cells were treated 24 hours later with 25 M sildenafil or phosphate buffered saline (PBS). The cells were further maintained for 24 hours before being washed and lysed in 100 l of lysis buffer (Promega Inc.). The activities of firefly luciferase and Renilla luciferase were measured in 20 l aliquots of each cell lysate using the Dual-Luciferase reporter assay system (Promega Inc.) and the TD-20/20 luminometer (Turner Designs Inc., Sunnyvale, California). Each test plasmid was transfected and assayed for luciferase activity at least 3 times. We used computer software for statistical analysis of the densitometry data.15
RESULTS
Up-regulation of PDE-5 by sildenafil. To test whether sildenafil could up-regulate PDE-5 expression, CSMCs were treated with different dosages of sildenafil every day for 3 and 7 days. RT-PCR analysis showed that at 3 days there was no significant difference in PDE-5 expression between treated and untreated cells (fig. 1). At 7 days PDE-5 expression was significantly lower than at 3 days regardless of treatment. Among these 7-day samples the one treated with 25 M sildenafil expressed PDE-5 at a significantly higher level than the others. Effects of SNP on PDE-5 protein expression. To test the effect of SNP on PDE-5 expression, the same CSMCs were treated daily with 100 M SNP with and without 25 M sildenafil for 3 and 7 days. RT-PCR analysis showed that PDE-5 expression was down-regulated by SNP in 3 and 7-day treated cells (fig. 2, A). Furthermore, SNP did not further up-regulate PDE-5 expression in sildenafil treated cells. Upregulation and down-regulation of PDE-5 by sildenafil and SNP were further verified by Western blot analysis for protein expression (fig. 2, B). Effects of sildenafil on PDE-5 promoters. We had used CSMCs for promoter activity assays with limited success,3 most likely due to poor transfection efficiency. In this study we initially tested the effect of sildenafil on PDE-5 promoter activities in CSMCs but observed low activities with or without treatment with sildenafil (data not shown). When the experiments were performed with COS-7 cells, we observed significantly higher promoter activity with sildenafil treated than with PBS treated PDE-5A promoter (fig. 3). However, the intronic PDE-5A2 promoter did not respond to sildenafil (fig. 3). Effects of anoxia and hypoxia on PDE-5 expression. By using a system in which oxygen was completely replaced with nitrogen,13 PDE-5 expression was significantly reduced in CSMCs under anoxia (fig. 4). Because cobalt is known to mimic hypoxia,16 we used it to test the effect of hypoxia on PDE-5 expression, and found that PDE-5 expression was reduced under hypoxia (fig. 4). Effects of ischemia on PDE-5 expression. We had previously shown that bilateral pudendal arterial ligation produced cavernous tissue ischemia accompanying arteriogenic impotence.11 We collected cavernous tissues of these rats from which we prepared complementary DNA libraries. PCR analysis on PDE-5 expression in these libraries showed that control, sham operated, 1-day ligated rats and 3-day ligated rats had similar levels of PDE-5 expression (fig. 5). In the
FIG. 1. Effect of sildenafil on PDE-5 expression. CSMCs were treated with 0, 1, 10 and 25 M sildenafil for 3 and 7 days. Cells were harvested and analyzed for PDE-5 expression by RT-PCR. Beta-actin expression was used as control.
REGULATION OF PHOSPHODIESTERASE-5
S17
FIG. 4. Effects of anoxia and hypoxia on PDE-5 expression. Rat CSMCs were cultured in presence of 95% O2 or 95% N2 in absence (O) or presence (CO) of 300 M cobalt chloride. Cells were harvested and analyzed for PDE-5 expression by RT-PCR. Beta-actin expression was used as control.
FIG. 2. Effect of sildenafil and SNP on PDE-5 expression. A, CSMCs were untreated (C) or treated with 100 M SNP (N), 25 M sildenafil (S) or both (NS) for 3 and 7 days. Cells were harvested and analyzed for PDE-5 expression by RT-PCR. Beta-actin expression was used as control. B, CSMCs were treated similarly as described in part A except only for 7 days. Cells were harvested and analyzed for PDE-5 expression by Western blotting.
FIG. 5. Effect of ischemia on PDE-5 expression. Internal pudendal arteries of rats were ligated for indicated times. Control rats (C) were never operated on and sham operated rats (S) were operated on without the ligation. Corpus cavernous tissues were harvested and analyzed for PDE-5 expression by RT-PCR. Beta-actin expression was used as control.
FIG. 3. Effect of sildenafil on PDE-5A promoters. Plasmid carrying no insert (vector), or PDE-5A1 (A1) or PDE-5A2 (A2) promoter was transfected into COS-7 cells. Internal control plasmid, pRLSV40, was also transfected. Cells were then treated with 25 M sildenafil or PBS. Promoter activities are expressed as ratios between firefly luciferase (FFL) and Renilla luciferase (RL) that were produced by test and control plasmids, respectively.
1-week ligated rats PDE-5 expression started to decrease, and this trend continued to the 3 and 6-week ligated rats. By 12 weeks PDE-5 expression was no longer detectable. DISCUSSION
We first tested whether sildenafil could up-regulate the expression of PDE-5. Because of the limitation on the number of days primary cell cultures can be healthily and continuously maintained, we chose 7 days as the experiment end
point. Indeed, PDE-5 expression was significantly lower in the 7-day than in the 3-day culture, reflecting the decrease of phenotypes pertaining to smooth muscle or other unknown factors. As for the choice of sildenafil dosages, we referred to the information provided by the manufacturer on its web site, which describes the peak plasma concentration as approximately 750 nM. Therefore, we chose dosages of 1 M and up for our cell culture system. Treatment with 25 M sildenafil for 7 days was necessary to produce an appreciable upregulation of PDE-5. Requirement of this large dosage could perhaps reflect the need to compensate for the much shorter treatment time (7 days) in comparison with the time (more than a year) it takes to produce the observed tachyphylaxis.1 It also points to the much agreed on observation that sildenafil is safe at its normal clinical dosage with perhaps only a mild tendency of producing tachyphylaxis. It was somewhat surprising that SNP not only did not aid sildenafil in up-regulating PDE-5 expression, but also seemed to have a negative effect on PDE-5 expression. At present, the significance of this observation is not clear. However, it should be noted that prolonged treatment of vascular smooth muscle cells with SNP is known to decrease PKG-I expression.17 Although Kim et al have shown that under short-term treatments (20 minutes) SNP and sildenafil were required to increase cellular cGMP levels,18 researchers from the same laboratory also showed that at high dosages sildenafil was able to increase cGMP levels, relax
S18
REGULATION OF PHOSPHODIESTERASE-5
cavernous strips and produce erection (when injected intracavernously) in the absence of a nitric oxide donor.19 As such, it is intriguing to consider that up-regulation of PDE-5 by sildenafil could also operate in a nitric oxide independent manner. Due to the low transfection efficiency with primary CSMCs, our promoter assays were conducted with COS-7 cells instead. In addition, due to the need to allow for optimal expression of the transfected luciferase constructs, treatment with sildenafil lasted only 24 hours. Although this was a much shorter time than the 7-day treatment in the previous experiments, the possible reasons why we were nevertheless able to observe the effect of sildenafil are the high copy number of the transfected PDE-5 promoter and the high sensitivity of the luciferase assay. As we have shown previously,3 the PDE-5A2 promoter was much weaker than the PDE-5A promoter, which could perhaps explain why no effect of sildenafil was observed with the PDE-5A2 promoter. Because detumescence apparently requires the cGMP hydrolytic activity of PDE-5, we speculated on the possible connection between priapism and PDE-5 under expression. In addition, because priapism occurs frequently in sicklemic patients and anoxia has been shown to eliminate the normal contractility of corporal smooth muscle,9 we postulated that anoxia and ischemia might negatively affect the expression of PDE-5. Indeed, we observed down-regulation of PDE-5 in CSMCs under anoxia and hypoxia, and we also observed down-regulation of PDE-5 in ischemic cavernous tissues of rats, in which the pudendal arteries were ligated. Based on these results, we suggest that under expression of PDE-5 may prolong smooth muscle relaxation and thus aggravate ischemic priapism, enhance post-ischemic hyperemia (and partial priapism) often seen after therapy for severe ischemic priapism and contribute to stuttering priapism. Cellular response to hypoxia is mediated by hypoxia inducible factor 1 that binds to the hypoxia responsive element of hypoxia responsive genes such as EPO and VEGF. Although most of these genes respond to hypoxia in a positive manner, there have been 2 instances of down-regulation.20, 21 With the existence of HRE-like sequences in the flanking region of the PDE-5A gene,3 it is possible that down-regulation of PDE-5 by hypoxia could also be mediated by hypoxia inducible factor 1. We are currently testing these hypoxia responsive element like sequences for their roles in PDE-5 promoter activities under hypoxia. CONCLUSIONS
Up-regulation of PDE-5 expression by sildenafil at a large dosage provides a molecular basis for the observed tachyphylaxis effect of sildenafil. However, it also points out the high degree of safety of sildenafil when used at normal dosages. Hypoxia induced PDE-5 under expression may be related to priapism. APPENDIX: OLIGONUCLEOTIDE PRIMERS
Gene Beta-actin PDE-5
Primer Name
Sequence
Beta-actin-s Beta-actin-a PDE-5-s PDE-5-a
TCTACAATGAGCTGCGTGTG AATGTCACGCACGATTTCCC CCTTGTGCAGAACTTCCAGA TCCGTTGTTGAATAGGCCAG
Size of PCR Product 368 bp 584 bp
REFERENCES
1. El-Galley, R., Rutland, H., Talic, R., Keane, T. and Clark, H.: Long-term efficacy of sildenafil and tachyphylaxis effect. J Urol, 166: 927, 2001
2. Moreland, R. B., Goldstein, I. I., Kim, N. N. and Traish, A.: Sildenafil citrate, a selective phosphodiesterase type 5 inhibitor. Trends Endocrinol Metab, 10: 97, 1999 3. Lin, C. S., Chow, S., Lau, A., Tu, R. and Lue, T. F.: Human PDE5A gene encodes three PDE5 isoforms from two alternate promoters. Int J Impot Res, 14: 15, 2002 4. Aoyagi, T., Hayakawa, K., Miyaji, K., Ishikawa, H. and Hata, M.: Sildenafil induced priapism. Bull Tokyo Dent Coll, 40: 215, 1999 5. Sur, R. L. and Kane, C. J.: Sildenafil citrate-associated priapism. Urology, 55: 950, 2000 6. Yoon, H., Kim, D. S., Lim, J. S., Chung, W. S. and Park, Y. Y.: Intracavernosal injection of sildenafil citrate: misapplication of the drug. J Urol, 165: 1218, 2001 7. Aboseif, S. R. and Lue, T. F.: Hemodynamics of penile erection. Urol Clin North Am, 15: 1, 1988 8. Siegel, J. F., Rich, M. A. and Brock, W. A.: Association of sickle cell disease, priapism, exchange transfusion and neurological events: ASPEN syndrome. J Urol, 150: 1480, 1993 9. Broderick, G. A., Gordon, D., Hypolite, J. and Levin, R. M.: Anoxia and corporal smooth muscle dysfunction: a model for ischemic priapism. J Urol, 151: 259, 1994 10. Kim, N. N., Kim, J. J., Hypolite, J., Garcia-Diaz, J. F., Broderick, G. A., Tornheim, K. et al: Altered contractility of rabbit penile corpus cavernosum smooth muscle by hypoxia. J Urol, 155: 772, 1996 11. Lin, C. S., Ho, H. C., Gholami, S., Chen, K. C., Jad, A. and Lue, T. F.: Gene expression profiling of an arteriogenic impotence model. Biochem Biophys Res Commun, 285: 565, 2001 12. Liu, X., Lin, C. S., Graziottin, T., Resplande, J. and Lue, T. F.: Vascular endothelial growth factor promotes proliferation and migration of cavernous smooth muscle cells. J Urol, 166: 354, 2001 13. Ruan, H., Wang, J., Hu, L., Lin, C.-S., Lamborn, K. R. and Deen, D. F.: Killing of brain tumor cells by hypoxia-responsive element mediated expression of BAX. Neoplasia, 1: 431, 1999 14. Liu, X. H., Kirschenbaum, A., Yao, S., Stearns, M. E., Holland, J. F., Claffey, K. et al: Upregulation of vascular endothelial growth factor by cobalt chloride-simulated hypoxia is mediated by persistent induction of cyclooxygenase-2 in a metastatic human prostate cancer cell line. Clin Exp Metastasis, 17: 687, 1999 15. Glantz, S. A.: Primer of Biostatistics, 3rd ed. New York: McGraw Hill, 1992 16. Lee, S. G., Lee, H. and Rho, H. M.: Transcriptional repression of the human p53 gene by cobalt chloride mimicking hypoxia. FEBS Lett, 507: 259, 2001 17. Soff, G. A., Cornwell, T. L., Cundiff, D. L., Gately, S. and Lincoln, T. M.: Smooth muscle cell expression of type I cyclic GMPdependent protein kinase is suppressed by continuous exposure to nitrovasodilators, theophylline, cyclic GMP, and cyclic AMP. J Clin Invest, 100: 2580, 1997 18. Kim, N. N., Huang, Y., Moreland, R. B., Kwak, S. S., Goldstein, I. and Traish, A.: Cross-regulation of intracellular cGMP and cAMP in cultured human corpus cavernosum smooth muscle cells. Mol Cell Biol Res Commun, 4: 10, 2000 19. McAuley, I. W., Kim, N. N., Min, K., Goldstein, I. and Traish, A. M.: Intracavernosal sildenafil facilitates penile erection independent of the nitric oxide pathway. J Androl, 22: 623, 2001 20. Narravula, S. and Colgan, S. P.: Hypoxia-inducible factor 1-mediated inhibition of peroxisome proliferator-activated receptor alpha expression during hypoxia. J Immunol, 166: 7543, 2001 21. Mazure, N. M., Chauvet, C., Bois-Joyeux, B., Bernard, M. A., Nacer-Cherif, H. and Danan, J. L.: Repression of alphafetoprotein gene expression under hypoxic conditions in human hepatoma cells: characterization of a negative hypoxia response element that mediates opposite effects of hypoxia inducible factor-1 and c-Myc. Cancer Res, 62: 1158, 2002
REGULATION OF PHOSPHODIESTERASE-5
S19
DISCUSSION Dr. Irwin Goldstein. Do we have evidence that diabetes, vascular disease, hypertension or high cholesterol up-regulate the PDE, which causes the impotence? In other words, is there so much PDE that you cannot sustain the erection? If we could show that, wouldn’t medical management with androgens have an interesting context because they would have the ability to affect the regulation? Is there any evidence that disease up-regulates PDE? Dr. Tom Lue. The PDE field is so new that not many people are working on that. In our laboratory we are now starting to look at all the possibilities and all the different disease entities. Dr. Ajay Nehra. Have you looked at PDE-5 in impotent patients yet? Doctor Lue. We have just begun to do that. Dr. William Steers. It would be very unlikely that you would up or down-regulate PDE-5 without affecting another PDE. Have you looked at the other PDEs in those cells as well? Doctor Lue. No. This is just the beginning. Dr. Karl-Erik Andersson. Your data showed that high concentrations of sildenafil added to cell culture up-regulated PDE. If there is no activity in the system, there should be very low concentrations of cGMP, and the activity of PDE must be dependent on the substrate. That means that you cannot say that you need very high concentrations of sildenafil to be able to get an up-regulation because in vivo you have activity in the system. You have a lot of substrate. There could also be possibilities of getting up-regulation, even at much lower concentrations. Doctor Lue. Basically, what we are showing is just pure cell culture data. We did not consider the downstream mechanisms. Now obviously, protein kinase G can also work on the up or down-regulation of PDE-5, and so it is much more complicated in an in vivo system. Protein kinase G also down-regulates in terms of activity. Dr. Ridwan Shabsigh. I fully agree that up-regulation of PDE-5 is not expected in the infrequent and low dose use of PDE-5 inhibitors in the context of erectile dysfunction. The average use is about 4 to 6 times a month. However, PDE-5 inhibitors are being considered treatment for other conditions, including pulmonary hypertension in newborns and infants. In that context, I think up-regulation may be an issue. Doctor Lue. Our study was only on the smooth muscle cells from potent men. We have not studied the impotent men yet.