Up-regulation of glyoxalase 1 by mangiferin prevents diabetic nephropathy progression in streptozotocin-induced diabetic rats

European Journal of Pharmacology 721 (2013) 355–364

Contents lists available at ScienceDirect

European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar

Endocrine pharmacology

Up-regulation of glyoxalase 1 by mangiferin prevents diabetic nephropathy progression in streptozotocin-induced diabetic rats Yao-Wu Liu 1, Xia Zhu 1, Liang Zhang, Qian Lu, Jian-Yun Wang, Fan Zhang, Hao Guo, Jia-Le Yin, Xiao-Xing Yin n Key Laboratory of New Drugs and Clinical Application, Xuzhou Medical College, Xuzhou 221004, Jiangsu, China

art ic l e i nf o

a b s t r a c t

Article history: Received 20 January 2013 Received in revised form 24 July 2013 Accepted 26 August 2013 Available online 10 September 2013

Advanced glycation endproducts (AGEs) and its precursor methylglyoxal are associated with diabetic nephropathy (DN). Mangiferin has many beneficial biological activities, including anti-inflammatory, anti-oxidative and anti-diabetic effects. We investigated the effect of mangiferin on DN and its potential mechanism associated with glyoxalase 1 (Glo-1), a detoxifying enzyme of methylglyoxal, in streptozotocin-induced rat model of DN. Diabetic rats were treated orally with mangiferin (15, 30, and 60 mg/kg) or distilled water for 9 weeks. Kidney tissues were collected for morphologic observation and the determination of associated biochemical parameters. The cultured mesangial cells were used to measure the activity of Glo-1 in vitro. Chronic treatment with mangiferin significantly ameliorated renal dysfunction in diabetic rats, as evidenced by decreases in albuminuria, blood urea nitrogen, kidney weight index, periodic acid-schiff stain positive mesangial matrix area, glomerular extracellular matrix expansion and accumulation, and glomerular basement membrane thickness. Meanwhile, mangiferin treatment caused substantial increases in the enzymatic activity of Glo-1 in vivo and in vitro, and protein and mRNA expression of Glo-1, reduced levels of AGEs and the protein and mRNA expression of their receptor (RAGE) in the renal cortex of diabetic rats. Moreover, mangiferin significantly attenuated oxidative stress damage as reflected by the lowered malondialdehyde and the increased glutathione levels in the kidney of diabetic rats. However, mangiferin did not affect the blood glucose and body weight of diabetic rats. Therefore, mangiferin can remarkably ameliorate DN in rats through inhibiting the AGEs/RAGE aix and oxidative stress damage, and Glo-1 may be a target for mangiferin action. & 2013 Elsevier B.V. All rights reserved.

Keywords: Diabetes nephropathy Mangiferin Glyoxalase 1 AGEs/RAGE Oxidative stress

1. Introduction As a global disease, diabetes nephropathy (DN) is one of the most severe diabetic microangiopathies and accounts for approximately one third of end-stage renal disease (Rossing, 2006). Several mechanisms have been considered to be involved in the pathogenesis of DN and other diabetes-associated complications, such as the accumulation of advanced glycation endproducts (AGEs), and oxidative stress (Brownlee, 2001). AGEs are a major mediator of the untoward effects of hyperglycemia (Suzuki and Miyata, 1999). AGEs may generate from nonenzymatic reactions between proteins and carbonyl compounds, like methylglyoxal (MG), glyoxal, and 3-deoxyglucosone (Brownlee et al., 1988). Protein glycation caused by MG, a key precursor of AGEs formation, may be a central player in the complications of diabetes due

n Correspondence to: Key Laboratory of New Drugs and Clinical Application, Xuzhou Medical College, No. 209, Tongshan Road, Xuzhou 221004, Jiangsu, China. Tel.: þ 86 516 83262009; fax: þ86 516 83262630. E-mail address: [email protected] (X.-X. Yin). 1 The two authors contributed equally to this project.

0014-2999/$ - see front matter & 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.ejphar.2013.08.029

to its ability to increase both inflammation and oxidative stress (Di Loreto et al., 2008; Rabbani and Thornalley, 2008; Sena et al., 2012; Yamawaki et al., 2008). MG can accumulate in body and accelerates the formation of AGEs. DN may be related to the accumulation of toxic alpha-oxoaldehydes such as MG. Therefore, therapeutic strategies aimed at reducing dicarbonyl compounds or enhancing their clearance and subsequently inhibiting AGEs formation would be effective to prevent the pathogenesis of DN. The glyoxalase system is a major detoxication system for dicarbonyl compounds in human body, where glyoxalase 1 (Glo-1) is the rate-limiting enzyme. With reduced glutathione (GSH) as a cofactor, Glo-1 can promptly clear alpha-carbonyl aldehydes, e.g. MG, inhibiting AGEs formation. Glo-1 can also directly inhibit AGEs formation in bovine endothelial cells (Shinohara et al., 1998) and GM7373 endothelial cells (Thornalley, 2003). Moreover, Glo-1 over-expression has been shown to reduce indices of diabetic complications (Brouwers et al., 2011; Queisser et al., 2010). Hyperglycemia-induced reactive oxygen species have increased the expression of AGEs and RAGE (receptor for AGEs), which is mediated by MG, which can be normalized by Glo-1 over-expression (Brouwers et al., 2011; Yao and Brownlee, 2010). Glo-1 can

356

Y.-W. Liu et al. / European Journal of Pharmacology 721 (2013) 355–364

attenuate damages in mitochondria from oxidative stress (Rabbani and Thornalley, 2008). Moreover, Glo-1 over-expression can reduce oxidative stress damage in diabetic rats (Brouwers et al., 2011). Thus, Glo-1 may become a preventative and therapeutic target of diabetic complications, including DN. Mangiferin, also called chinonin, is a major glucoside of xanthone in Rhizome Anemarrhena. Mangiferin has many biological activities, including anti-inflammatory, anti-oxidative and anti-diabetic effects (Miura et al., 2001; Muruganandan et al., 2005; Prabhu et al., 2006). Mangiferin improves diabetic complications in heart and kidney (Li et al., 2010; Muruganandan et al., 2002). Several studies have showed that this compound inhibits AGEs formation and aldose reductase activity in in vitro study (Tang et al., 2004; Yoshikawa et al., 2001). Li et al. (2010) illustrate that mangifrein could prevent the progression of DN by suppressing renal fibrosis. All these reports indicate that mangiferin may have a beneficial effect on the progression of DN. However, the intimate mechanism of mangiferin on DN progression remains unknown. Therefore, our study is aimed to investigate the effects of mangiferin on the nephropathy in streptozotocin-induced diabetic rats, a rodent model of type 1 diabetes, and the pathological factors related to Glo-1 in diabetic condition.

2.3. Renal function assessment Renal function was assessed by the measurement of kidney weight index, urinary protein and blood urea nitrogen (BUN). Decapsulated left and right kidneys were excised and weighted. Kidney weight index (mg/g) was the ratio of the two kidneys' weight and the body weight of a rat. The Coomassie brilliant blue method was used to quantify the urinary protein secretion by a urinary protein assay kit (Jiancheng Bioengineering Institute, Nanjing, China). BUN was measured using a diacetyl-latter colorimetric method by a BUN assay kit (Jiancheng Bioengineering Institute, Nanjing, China). 2.4. Periodic acid-Schiff (PAS) staining

2. Material and methods

Kidney tissues were fixed in a 10% buffered formalin solution and embedded in paraffin for histological analysis. The 3 μm thick paraffin sections were dewaxed and brought to water through graded ethanols. The sections were stained with PAS, cleared in xylene and mounted with neutral balsam before examined using an Olympus BX-50 microscope. The three most central sections of each defect were analyzed. Linear measurements were obtained with an image analysis system (Image-Pro Plus 4.0, Media Cybernetics, Silver Spring, MD).

2.1. Animals

2.5. Transmission electron microscopic examination

Male Sprague Dawley rats (10 weeks) were bred in the Center of Experimental Animal, Xuzhou Medical College (Xuzhou, China). All animals were housed under a controlled room humidity (50% 710%), and maintained under a 12-h light/dark cycle with free access to water and food. All animal experiments were performed in accordance with the license by Jiangsu Province Science and Technology Office (Nanjing, China) and the approval from the Animal Ethics Committee of Xuzhou Medical College. All experiments were conformed to the Guidelines for Ethical Conduct in the Care and Use of Animals. Every effort was made to minimize stress to the animals.

For transmission electron microscopic examination, small pieces of the kidney cortex (1 mm3) were fixed in 2.5% glutaraldehyde in 200 mmol/l sodium phosphate buffer (pH 7.4) for 2 h. Then the tissue sections were washed with PBS for 3 h to remove glutaraldehyde, and fixed in osmic acid for 2 h before rinsed with water for 2 h. The sections were dehydrated in alcohol (from 50% to 90%) and dried using anhydrous acetone and Araldites sequentially. Finally, the tissue sections were embedded in pure Araldite. Ultrathin (70 nm) sections were cut with a glass knife on a RMC HT-XL ultratome and mounted on a copper grid (200 mesh). The sections were stained with uranyl acetate and lead citrate. The TEM H-600A-2 (Hitachi, Japan) was used for viewing and photographing.

2.2. Experimental design 2.6. Fluorescent determination of AGEs levels in renal cortex The rats fasted for 12 h were subjected to a single intraperitoneal injection of 55 mg/kg streptozotocin (STZ) freshly dissolved in 0.1 mol/l sodium citrate buffer at pH 4.5. Age-matched normal rats were received sodium citrate buffer alone. The development of diabetes was accessed using the value of fasting blood glucose (FBG) with a reagent kit (Jiancheng Bioengineering Institute, Nanjing, China). The rats with the FBG level above 13.9 mmol/l were considered diabetic rats 72 h after STZ injection. Then, the diabetic rats were randomly divided into four groups with ten animals each, namely diabetic rats treated with three doses of mangiferin (15, 30 and 60 mg/kg) or distilled water through an oral gavage for 9 weeks. Mangiferin (497% purity, Fengshanjian Medicinal Research Co. Ltd., Kunming, China) was suspended in distilled water. Age-matched normal rats (n¼10) were received distilled water. Blood glucose was examined for the fasted rats for 7–8 h. After 9-week treatment, 24-h rat urine was collected by metabolic cages for albuminuria measurement. Then the animals were sacrificed under ethyl ether anesthesia, and blood was collected via femoral vein bleeding with serum separated. The rat kidneys were removed, with 1/4 of each kidney decapsulated and fixed in 10% formalin for 24 h before paraffin embedding. Renal cortex was cut into 1 mm3 units and fixed in 2.5% glutaraldehyde for 2 h before transmission electron microscopic examination. The kidney left was rapidly removed with cortex isolated. The samples were stored at  80 1C before use.

The weighed and frozen rat kidney cortex was homogenized in 10 volumes (w/v) of 100 mmol/l PBS extraction buffer (pH 7.4) with a motor-operated homogenizer (FLUKO Equipment Shanghai Co. Ltd., China) in an iced water bath. The homogenate was centrifuged at 4 1C at 10,000 g for 15 min, and the supernatant was collected for Glo-1 activity and other biochemical parameter assays. The pellets were washed three times with distilled water, to which 1.0 ml CHCl3-MeOH (1:1) was added. The mixture was shaken overnight at room temperature. Next, 0.5 ml MeOH–H2O (4:1) was added and centrifuged at 4 1C at 4000 g for 5 min. The pellets were washed sequentially with MeOH and distilled water for twice and then washed once with 0.02 mol/l Hepes buffer (pH 7.5) containing 0.1 mol/l CaCl2. The resulting samples were suspended in 1.0 ml Hepes buffer overnight at 4 1C, and then in 1.0 ml Hepes buffer containing 290 U of type I collagenase (SigmaAldrich Co. LLC.) after removing the buffer by centrifugation. Antiseptics methylbenzene and chloroform (both 2.0 μl) were added and the mixture was shaken for 24 h at 37 1C for centrifugation. Next, the supernatant was collected for determination of fluorescence intensity using a fluorescent instrument (9203-941, Promega Biosystems Sunnyvale, Inc., CA, USA) with the Hepes buffer containing type I collagenase as a standard. The AGEs level in kidney cortex was expressed as the enzymatic activity of type I collagenase (U) per milligram of protein.

Y.-W. Liu et al. / European Journal of Pharmacology 721 (2013) 355–364

2.7. Glo-1 activity assay The Glo-1 assay was performed using a spectrophotometric method monitoring the increase in absorbance at 240 nm due to the formation of S-D-lactoylglutathione at 25 1C for 2 min (Maher et al., 2011). The standard sample consisted of 8 mmol/l MG, 2 mmol/l GSH, 10 mmol/l magnesium sulfate and 50 mmol/l phosphate potassium at pH 6.6. The mixture was allowed to stand for at least 2 min to ensure the equilibration of hemithioacetal formation before the addition of kidney homogenate supernatant (30–50 μg protein). Glo-1 activity was expressed as the percentage of S-Dlactoylglutathione/min/mg protein in the normal rats (100%). Protein concentration was determined by a BCA assay kit (Beyotime Institute of Biotechnology, Nanjing, China). 2.8. Assay of Glo-1 and RAGE protein expressions by Western blotting The weighed and preserved kidney was homogenized using a sonicator with 10 volume (w/v) of 50 mmol/l (pH 7.4) Trisbuffered saline containing 0.6 mmol/l phenylmethylsulphonyl fluoride, 1 mmol/l Na3VO4 and 50 mmol/l NaF in an iced water bath. The homogenates were placed at 4 1C for at least 60 min and then centrifuged at 4 1C at 10,000 g for 15 min. The supernatant was collected for Western blotting. Protein concentration in the supernatant was determined using the BCA protein assay kit (Beyotime Institute of Biotechnology, Nanjing, China). The protein samples (100 μg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to Biotrace™ nitrocellulose membranes. The membrane was blocked with 5% blocking buffer for 120 min and incubated overnight at 4 1C with primary antibodies including goat anti-Glo-1 (R&D System, USA) and rabbit anti-RAGE (Abcam company, UK). The proteins were detected using alkaline phosphatase-conjugated affinipure donkey anti-goat or goat anti-rabbit secondary antibody. The membranes were exposed to BCIP/NBT alkaline phosphatase color developing reagent (Beyotime Institute of Biotechnology, Nanjing, China) for 15 min. The signal densities on the blots were measured with Image J software and normalized using rabbit anti-β-actin (Bioworld Technology Inc., USA) as an internal control (optical densitydetected protein/optical densityinternal control). 2.9. Assay of Glo-1 and RAGE mRNA levels by real-time RT-PCR Total RNA was extracted from kidney cortex using TRIzol reagent (Invitrogen, USA) according to the manufacturer's protocol. Then High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA) was used for the reverse transcription of total mRNA to cDNA. The 2  RT master mix was prepared according to the manufacturer's protocol. In this assay, 1.5 μg total RNA sample was added to a thermal cycler using the following conditions: 25 1C for 10 min, 37 1C for 120 min, 85 1C for 5 min, and 4 1C for 5 min. The Roche 480 LightCyclers system with SYBR Green dye binding to PCR product was used to quantify target mRNA accumulation via fluorescence RT-PCR. cDNAs were mixed with the LightCyclers 480 SYBR Green I PCR master mix and primers

357

(Shanghai Sangon Company, China) (Table 1). The PCR reaction had 40 cycles of denaturation at 95 1C for 20 s, annealing at 60 1C for 15 s, and elongation at 72 1C for 15 s and was repeated in triplicate. To verify the accuracy of the amplicons, a melting curve analysis was performed after amplification. The parameter Cp (crossing point) value was measured to determine the starting copy number of target genes. Lower Cp value indicated higher amounts of PCR products. In addition to profiling all samples for the target sequences, samples were profiled for β-actin expression as a reference. For the amplification reaction in each well, a Cp was observed in the exponential phase of amplification, and the quantification of relative expression levels was achieved using standard curves for both target and endogenous control samples. Relative transcript abundance of a gene is expressed as 2  ΔCp values (ΔCp¼Cptarget Cpreference). 2.10. Determination of GSH and malondialdehyde (MDA) levels in kidney The amounts of GSH and MDA were determined according to our previous report (Liu et al., 2012). The compound 3-Carboxy-4nitrophenyl disulfide can react with sulfhydryl compounds (e.g. GSH), giving a yellow compound with stronger absorption at 420 nm. MDA can be condensed with thiobarbituric acid, producing a pink product with maximal absorption at 532 nm. The determination of GSH or MDA level was performed using a corresponding commercial kit (Jiancheng Bioengineering Institute, Nanjing, China). 2.11. Assay of glyoxalase-1 activity in vitro Rat mesangial cells were purchased from China Center for Type Culture Collection, Wuhan University (No. HBZT-1). The 5th–8th generations of mesangial cells were taken after incubating for 24 h under a normal condition (containing 5.56 mmol/l glucose, 10% FBS, 100 U/ml penicillin and 100 μg/ml streptomycin, 37 1C, 5% CO2). The cultured mesangial cells were divided into five groups, and each group contained six bottles: a normal control group (NS, 5.56 mmol/l glucose-DMEM), a high glucose group (HG, 45 mmol/l glucose-DMEM), a solvent control group (HGþ DMSO, 0.1% DMSO 45 mmol/l glucose-DMEM), a low concentration of mangiferin group (HG þMF-L, 2 μmol/l mangiferin 45 mmol/l glucose-DMEM), a moderate concentration of mangiferin group (HG þMF-M, 5 μmol/l mangiferin 45 mmol/l glucose-DMEM), a high concentration of mangiferin group (HGþ MF-H, 10 μmol/l mangiferin 45 mmol/l glucose-DMEM). After 48 h of incubation, the cells were harvested. The cell population was adjusted to 1.5  106/ml, and 1 ml of cell suspension was taken from each group. Afterwards, the suspensions were centrifuged three times at 1000 rpm at 4 1C for 5 min. Then the cell pellet was resuspended in 2 ml cell lysis solution, followed by centrifugation at 2500 rpm at 4 1C for 5 min. The supernatants were removed and stored at  20 1C for subsequent analysis. The effect of mangiferin on glyoxalase-1 activity in vitro was detected following by the method mentioned above.

Table 1 Primer sequences and amplicon sizes. Gene

Glo-1 RAGE β-actin

Primer sequence (5′-3′) Forward

Reverse

GAAGATGACGAGACGCAGAGTTAC GGAAGGACTGAAGCTTGGAAGG CCCATCTATGAGGGTTACGC

CAGGATCTTGAACGAACGCCAGAC TCCGATAGCTGGAAGGAGGAGT TTTAATGTCACGCACGATTTC

Amplicon Length (bp)

Temperature (1C)

180 102 150

60 60 60

358

Y.-W. Liu et al. / European Journal of Pharmacology 721 (2013) 355–364

2.12. Statistical analysis Results were expressed as Mean 7 S.E.M. The intergroup variation was measured by one way ANOVA followed by Tukey's test. Statistical significance was considered at Po0.05. Statistical analysis was done using the SPSS Statistical Software version 13.0.

3. Results

compared with those of the normal group (each group P o0.01). Chronic mangiferin treatment attenuated the above-mentioned indexes of diabetic animals. The low dose group showed a decrease in serum BUN (Po 0.01, Fig. 1C) but without any statistical significance for kidney weight index (Fig. 1A) and urinary protein secretion (Fig. 1B) when compared to the diabetic rat group. Oral administration of middle and high mangiferin doses to diabetic rats significantly (P o0.05 or Po 0.01, Fig. 1) normalized the altered three parameters when compared with diabetic rat group.

3.1. Effects of mangiferin on FBG and body weight of diabetic rats Serum glucose levels of the experimental rats were measured at Week 0, Week 4 and Week 9 after treatment with mangiferin. Compared with the age-matched normal rats, diabetic rats had higher (Po0.01) FBG levels throughout the treatment process. However, the FBG levels remained high in diabetic rats treated with mangiferin both at Week 4 and Week 9, and no significant difference was found between treated and untreated groups (Table 2). The body weight of the experimental rats was also measured from Week 1 to Week 9 following mangiferin treatment. Compared with the age-matched normal rats, diabetic rats had the reduced body weight after STZ induction (P o0.01). Low dose mangiferin had no obvious effect on the body weights of diabetic rats. The body weight was increased significantly at Week 5 and 9 in middle dose mangiferin group, and at Week 6 in high dose group compared with that of diabetic group (Po 0.05, Table 3). 3.2. Effects of mangiferin on renal dysfunction in diabetic rats Fig. 1 illustrates the effect of mangiferin on kidney weight index (Fig. 1A), urinary protein secretion (Fig. 1B), and serum BUN (Fig. 1C) in the normal and experimental rat groups. There were significant increases in the kidney weight index, urinary protein secretion and BUN level in the serum of diabetic rat group

Table 2 Effects of mangiferin on fasting blood glucose in STZ-induced diabetic rats after treatment. Group

Fasting blood glucose (mmol/l)

Cont DM DM þMF-L DM þMF-M DM þMF-H

Week(0)

Week(4)

Week(9)

5.4 70.2 20.6 70.7a 20.6 70.5 20.7 70.5 20.6 70.4

4.4 7 0.2 19.5 7 1.2a 16.17 1.1 22.17 2.1 23.9 7 2.1

4.6 7 0.2 23.9 7 2.4a 24.6 7 1.4 26.17 1.5 21.2 7 1.3

Mesangial matrix expansion is one of DN pathological features (Sharma et al., 2003). These changes present in the kidneys of the normal and experimental rat groups are shown in Fig. 2A–E using PAS-stain. Diabetic rats showed an accelerated mesangial matrix expansion, which was characterized in the remarkable increase of PAS-stained positive area compared to that of the normal group (P o0.01, Fig. 2F). However, treatment with different concentrations of mangiferin reduced mesangial matrix expansion of diabetic rats (P o0.01, Fig. 2F). The transmission electron microscopic examination of rat kidney ultrastructure showed the changes in glomerular basement membrane, foot processes and mesangial area. The ultrastructural changes occurring in kidney of the normal and experimental groups are shown in Fig. 3A–G. Fig. 3A represents the electron micrograph of kidney of the normal group, which displays normal glomeruli, podocytes and mesangial cells. The electron micrograph of diabetic rat kidney (Fig. 3B–D) illustrated that the glomerular filtration barrier was destroyed, evidenced by thick basement membrane (Fig. 3B), loss of podocytes foot processes (Fig. 3C), degeneration of podocytes and the increased number of mesangial cells (Fig. 3D). Fig. 3E shows that small ultrastructural changes occurred in the low dose group compared with those of diabetic rats. Fig. 3F apparently demonstrats the protective effects of the middle dose mangiferin on the diabetic rat kidney by virtue of an apparent appearance of normal architecture. Likewise, the electron micrograph of the diabetic rat kidney after treatment with high dose mangiferin indicated a similar pattern of protection (Fig. 3G), which was comparable with the normal group (Fig. 3A).

3.4. Effects of mangiferin on AGEs accumulation, RAGE protein and mRNA levels in the kidney of diabetic rats AGEs are known to be accumulated in diabetics and may be an important mediator of the untoward effects of hyperglycemia (Suzuki and Miyata, 1999). To investigate the possibility of mangiferin to inhibit AGEs-RAGE axis, we examined AGEs amount and

Mean 7 S.E.M., n ¼8–10; a

3.3. Effects of mangiferin on mesangial matrix expansion and the ultrastructure of diabetic rat kidney

P o0.01, compared with control.

Table 3 Effects of mangiferin on body weight in STZ-induced diabetic rats after treatment. Group

Cont DM DM þMF-L DM þMF-M DM þMF-H

Body weight(g) Week (0)

Week (1)

Week (2)

Week (3)

Week (4)

Week (5)

Week (6)

Week (7)

Week (8)

Week (9)

226 7 3 2217 2 2247 2 225 7 2 2197 2

281 73 255 72a 252 74 244 75 225 73

311 74 228 73a 233 74 231 74 219 73

3317 5 2317 5a 2147 3 2177 5 208 7 4

365 7 6 225 7 8a 2127 4 2277 8 2157 6

3677 6 223 7 8a 239 7 6 2497 8b 2277 8

402 7 7 225 7 10a 244 7 5 244 7 9 249 7 3b

409 7 9 2407 10a 2437 4 252 7 9 252 7 4

4017 9 256 7 8a 2417 4 253 7 8 252 7 6

386 79 230 76a 221 75 256 79b 247 76

Mean 7 S.E.M., n ¼10; a b

P o0.01, compared with control. Po 0.05, compared with DM.

Y.-W. Liu et al. / European Journal of Pharmacology 721 (2013) 355–364

359

and mRNA levels of Glo-1, and the clearance rate of MG. We found that Glo-1 activity was markedly decreased in the kidney of diabetic rats compared with that of the normal group (P o0.05, Fig. 5A). The protein and mRNA amounts of Glo-1 were significantly reduced in the kidney of diabetic rats compared with those of the normal group (P o0.05 and Po 0.01 respectively, Fig. 5C and D). Middle and high doses of mangiferin significantly enhanced the Glo-1 activity (both P o0.05, Fig. 5A) and protein expression (both P o0.01, Fig. 5C) in diabetic rats. All the three doses of mangiferin could significantly elevate the Glo-1 mRNA level in diabetic rats (each group Po 0.01, Fig. 5D). 3.6. Effects of mangiferin on the activity of Glo-1 in mesangial cells We also examined the effect of mangiferin on the enzymatic activity of Glo-1 in vitro with rat mesangial cells. It was found that the activity of Glo-1 was significantly decreased in mesangial cells cultured with high glucose compared with normal glucose (P o0.05, Fig. 5B). Nevertheless, pretreatment with mangiferin prevented the decline of Glo-1 activity caused by high glucose culture, and middle and high doses of mangiferin showed significant differences (both P o0.01, Fig. 5B). 3.7. Effects of mangiferin on oxidative stress damage caused by diabetes To investigate whether the decrease of MG hyperactivity by mangiferin had inhibitory effects on oxidative stress, we examined the renal MDA and GSH levels in both normal and experimental rats. Diabetic rats presented an increase in MDA level (Po 0.01) but a decrease in GSH level (P o0.01) in kidney, which were then reversed by the chronic treatment with high dose mangiferin (both groups P o0.01, Fig. 6). Moreover, the middle dose mangiferin significantly reduced the renal MDA amounts (P o0.01).

4. Discussion

Fig. 1. Effects of mangiferin on kidney weight index (A), urinary protein secretion (B) and BUN (C) of normal rats (Cont), STZ-induced diabetic rats (DM), and diabetic rats treated with mangiferin at low (DM þMF-L), middle (DMþ MF-M) and high (DMþ MF-H) doses. Mean 7 S.E.M., n¼ 6–7, nnP o0.01, vs. Cont group; #Po 0.05, ## Po 0.01, vs. DM group.

the protein and mRNA levels of RAGE in kidney of diabetic rats, which were significantly increased in comparison with the normal group (each group P o0.01, Fig. 4). Both middle and high doses of mangiferin treatment significantly decreased the AGEs levels in diabetic rats (P o0.05 and P o0.01, respectively, Fig. 4A), while all the three doses of mangiferin significantly reduced the RAGE protein and mRNA levels in diabetic rats (P o0.05 or P o0.01, Fig. 4B and C).

3.5. Effects of mangiferin on the activity, the protein and mRNA levels of Glo-1 in diabetic rat kidneys To investigate the mechanisms underlying the reduced AGEs accumulation induced by mangiferin via the lowered MG hyperactivity, we examined the enzymatic activity, protein expression

This study was aimed to analyze the effects of mangiferin on the renal dysfunction of diabetic rats and the mechanism associated with MG toxicity. STZ-induced diabetic rats presented renal dysfunction and significant increases in protein glycation and oxidative stress in kidney, with MG hyperactivity as a core factor. Mangiferin significantly and dose-dependently ameliorated the renal damages of diabetic rats, which was related to the enhancement of Glo-1 function, and the suppression AGEs/RAGE axis and oxidative stress damages in diabetic rat kidney. Glo-1 could be a target protein of mangiferin. Although mangiferin did not affect the blood glucose level of diabetic rats, diabetic rats treated with mangiferin showed decreases in urinary protein, BUN and kidney weight index. Mangiferin treatment also attenuated renal morphologic alterations characterized by reduced mesangial expansion, glomerular hypertrophy, and fusion of foot processes. These results indicated that mangiferin treatment markedly ameliorated renal dysfunction of diabetic rats. Thus, the potential mechanism for DN includes both direct and indirect effects of hyperglycemia, and intermediate metabolic products of hyperglycemia also caused renal damages. MG is mainly from triosephosphates produced during glycolysis, with 10,000–50,000 fold higher intrinsic reactivity towards glycation than glucose (Thornalley, 2005). Under diabetic or hyperglycemic condition, more MG was produced in body fluid and tissue (Lu et al., 2011). Semicarbazide-sensitive amine oxidase (SSAO)-mediated deamination may be involved in structural

360

Y.-W. Liu et al. / European Journal of Pharmacology 721 (2013) 355–364

Fig. 2. Effects of mangiferin on the renal pathology of normal rats (Cont), STZ-induced diabetic rats (DM), and diabetic rats treated with mangiferin at low (DMþ MF-L), middle (DMþMF-M) and high (DMþMF-H) doses. Representative micrographs of PAS-stained paraffin sections (A–E) shows the effect of mangiferin on glomerular histology, extracellular cell matrix expansion and accumulation of DN rats (magnification, 400  ). (A) Normal rat glomeruli; (B) DM rat glomeruli; (C) The glomeruli of DN rats treated with low mangiferin dose; (D) The glomeruli of DN rats treated with middle mangiferin dose; (E) The glomeruli of DN rats treated with high mangiferin dose; (F) Quantitative analysis of PAS stain positive area. Mean 7 S.E.M., n¼ 9. nnP o0.01, vs. Cont group; ##Po 0.01, vs. DM group.

Fig. 3. Effects of mangiferin on the changes of renal ultrastructure in normal rats (Cont), STZ-induced diabetic rats (DM), and diabetic rats treated with mangiferin at low (DMþ MF-L), middle (DMþ MF-M) and high (DMþ MF-H) doses. Representative micrographs of transmission electron microscopy showed the effect of mangiferin on glomerular basement membrane, foot processes and mesangial area of DN rats. (A) Group Cont. Magnification: 6000  ; (B) Group DM. Magnification: 5000  ; (C) Group DM. Magnification: 5000  ; (D) Group DM. Magnification: 6000  ; (E) Group DM þMF-L. Magnification: 5000  ; (F) Group DMþ MF-M. Magnification: 6000  ; (G) Group DMþ MF-H. Magnification: 6000  . Basement membrane (BM), capillary loop (CL), mesangial cell (MC), nucleus (N), podocytes (P), red blood cells (R), urinary space (US).

Y.-W. Liu et al. / European Journal of Pharmacology 721 (2013) 355–364

Fig. 4. Effects of mangiferin on AGEs production (A), protein expression of the receptor for AGEs (RAGE) (B). and RAGE mRNA expression (C) in the kidneys of normal rats (Cont), STZ-induced diabetic rats (DM), and diabetic rats treated with mangiferin at low (DMþ MF-L), middle (DMþMF-M) and high (DM þMF-H) doses. Mean 7 S.E.M., n¼ 6 (AGEs), n ¼3–4 (protein expression), n¼ 8 (mRNA level). nn P o0.01, vs. Cont group; #Po 0.05, ##Po 0.01, vs. DM group.

modification of proteins and contribute to advanced glycation in diabetes (Yu and Zuo, 1997). MG and formaldehyde are produced via deamination of aminoacetone and methylamine catalyzed by SSAO, respectively (Boor et al., 1992; Yu, 1990). Aminoguanidine is quite potent at inhibiting SSAO both in vitro and in vivo, which is irreversible (Yu and Zuo, 1997). Aminoguanidine reacts with Amadori fragmentation products. preventing glycation and AGEs formation (Edelstein and Brownlee, 1992). MG may play a role in the development of DN. Studies of early stage of diabetic renal dysfunction showed that glomerular hyperfiltration was

361

associated with the elevated MG level (Beisswenger et al., 1997) which may be associated with early albuminuria (Beisswenger et al., 1995). Moreover, MG is a key precursor of AGEs formation. In our study, diabetes induced by STZ resulted in increases in AGEs levels, RAGE expression at both protein and mRNA levels in kidney of rats, and damages in renal function and morphology. These findings were consistent with previous studies that AGEs/RAGE axis was involved in the pathogenesis of DN (Suzuki et al., 2006; Tanji et al., 2000; Yamamoto et al., 2001). Thus, MG-mediated glycation and AGEs formation may be one of the reasons for the pathogenesis of DN. AGEs have been regarded as an important mediator of the untoward effects of hyperglycemia (Suzuki and Miyata, 1999), because the progression of diabetic complications could be prohibited by the inhibitors of glycoxidation products that do not change glycemia (Brownlee et al., 1986). AGEs stimulated a variety of cellular responses, including matrix production, pro-fibrotic responses, and pro-inflammatory responses, via RAGE, a specific cell-surface receptor on several cell types, including glomerular mesangial cells (Schmidt et al., 1999, 2001). In addition, the increased level of circulating RAGE associated with immune complexes in glomeruli may play a role in albuminuria and tissue injury (Suzuki and Miyata, 1999; Schmidt et al., 1999). Our study found that mangiferin inhibited AGEs accumulation, and caused a decrease in RAGE protein expression and a downregulation of RAGE mRNA level, without obvious effects on hyperglycemia. In vitro study showed that mangiferin had an inhibitory effect on AGEs formation (Guo et al., 2009), and mangiferin could decrease the AGEs levels in diabetic rats (Li et al., 2010). Therefore, the inhibition of AGEs formation and normalization of RAGE protein and mRNA levels by mangiferin may largely contribute to the amelioration of DN. It has been shown that genetic deletion or pharmacological block of RAGE can prevent renal dysfunction and early structural changes in glomeruli with DN (Myint et al., 2006; Reiniger et al., 2010). These indicated that chronic treatment with mangiferin prevented diabetes-induced AGEs accumulation by decreasing the level of carbonyl groups and re-established a normal RAGE level. Oxidative stress has been implicated in the pathogenesis of diabetes and its complications (Brownlee, 2005; Brouwers et al., 2011), including DN (Forbes et al., 2008; Kashihara1 et al., 2010). A number of studies have indicated that reactive oxygen species generation is a potent factor initiating signal transduction and altering gene expression as a result of the AGEs/RAGE interaction (Miyata et al., 1996; Wautier et al., 1994). Moreover, reports showed that MG had the ability to increase oxidative stress (Di Loreto et al., 2008; Rabbani and Thornalley, 2008; Sena et al., 2012). In the present study, diabetic rats showed severe renal dysfunction, which was coupled with significant increases in oxidative stress in kidney evidenced by an increase in MDA level, an important marker for lipid peroxidation, and a decrease in GSH level, a potent endogenous antioxidant that was the first defense factor against free radicals. These suggested that in addition to activating AGEs/RAGE axis, MG also enhanced oxidative stress damage in kidney of diabetic conditions, which could be ameliorated by mangiferin treatment as expected. Mangiferin improved oxidative damage in STZ-induced diabetic cardiac and renal tissues (Li et al., 2010; Muruganandan et al., 2002), ischaemia-induced oxidative damage in gerbil brain (Marquez et al., 2012) and antioxidant status in isoproterenol-induced myocardial infarction in rats (Prabhu et al., 2006). These results demonstrated that the inhibitory effect of mangiferin on oxidative stress damage was an essential reason for mangiferin to improve diabetes-associated renal dysfunction. Glo-1 is the rate-limiting enzyme of alpha-carbonyl aldehyde metabolism, including MG. Glo-1 can be potentially downregulated in patients with diabetes and other diseases due to the

362

Y.-W. Liu et al. / European Journal of Pharmacology 721 (2013) 355–364

Fig. 5. Effects of mangiferin on Glo-1 activity (A), protein expression (C) and mRNA level (D) in kidney and mesangial cells (B). DM and HG represent diabetes mellitus and high glucose, respectively. The treatment was performed with mangiferin at low (DM þ MF-L), middle (DMþ MF-M) and high (DMþ MF-H) doses. Mean 7 S.E.M., n¼ 6–7 (activity), n ¼3–4 (protein expression), n¼ 8 (mRNA level). Four batches of mesangial cells were used for assay of Glo-1 activity in vitro. nPo 0.05, nnPo 0.01, vs. Cont group; # P o0.05, ##P o0.01, vs. DM group.

possible increase of MG concentration and the rate of MGmediated glycation reactions. Glo-1 was significantly downregulated in both enzymatic activity and protein expression in diabetic rat kidney (Palsamy and Subramanian, 2011) and the cerebral and renal cortex of Akita diabetic mice which were coupled with an increase in protein glycation by MG (Maher et al., 2011). In the current study, STZ-induced diabetic rats presented the significantly down-regulated Glo-1 activity, protein and mRNA levels, combined with remarkable AGEs accumulation and the up-regulation of RAGE protein and mRNA levels. These suggested that the accumulation of MG damaged Glo-1 in diabetic conditions and the down-regulation of Glo-1 elevated the level of protein glycation. Several studies indicated that the elevated activity or amount of Glo-1 could decline AGEs formation via lowering their precursors such as MG (Kalousova et al., 2005; Miyata et al., 2001). Over-expression of Glo-1 could completely normalize the hyperglycemia-induced formation of MG, resulting in lower intracellular MG-derived AGEs formation (Shinohara et al., 1998). Our results demonstrated that mangiferin treatment significantly enhanced Glo-1 activity in vivo and in vitro, accompanied by suppression of the AGEs/RAGE axis. Meanwhile, Miyata et al. (2001) indicated that Glo-1 deficiency was associated with the increased AGEs level, which further underlined the importance of glyoxalase detoxification system, especially Glo-1, for the actual level of AGEs. Notably, Glo-1 over-expression reduced not only hyperglycemia-induced levels of AGEs and RAGE, but also the damages from oxidative stress in diabetic rats (Brouwers et al., 2011; Yao and Brownlee, 2010). Furthermore, MG caused a dramatic decrease of GSH amount and a significant inhibition of

both Glo-1 and glutathione peroxidase activities in hippocampal neurons (Di Loreto et al., 2008). In the present study, the activity, protein and mRNA expression of Glo-1 were both markedly declined in kidney of STZ-induced diabetic rats, combined with a remarkable decrease of GSH, a cofactor of Glo-1. These data strongly indicated that MG played a relevant role in modulating diabetes-induced reactive oxygen species production. Our study also showed that the indexes of oxidative stress, MDA and GSH, were changed in diabetes, and that the up-regulation of Glo-1 by mangiferin attributed to the lowered oxidative stress damages. Meanwhile, mangiferin treatment significantly increased Glo-1 activity as well as GSH level in kidney of diabetic rats, indicating a possibility of MG clearance in tissue would be enhanced by mangiferin through Glo-1. In addition, Glo-1 can also directly inhibit AGEs formation (Shinohara et al., 1998; Thornalley, 2003). Consequently, the inhibitory effects of mangiferin on the activation of AGEs/RAGE axis in diabetic state did not exclude the enhancement of Glo-1 function by mangiferin. Therefore, our results demonstrated that it was the pleiotropy of mangiferin that made mangiferin a good preventive effect on DN progress, and Glo-1 may be a target protein of mangiferin. In summary, the present study demonstrated that oral administration of mangiferin significantly prevented the progression of DN, which was partly due to the inhibitions of AGEs/RAGE axis and oxidative stress damages, which were mediated by the enhancement of Glo-1 function. Moreover, due to abundant mangiferin amount in fruit and food, our findings have provided a promising dietary supplementary approach for diabetic patients with renal complications.

Y.-W. Liu et al. / European Journal of Pharmacology 721 (2013) 355–364

Fig. 6. Effects of mangiferin on the amounts of MDA (A) and GSH (B) in kidney of normal rats (Cont), STZ-induced diabetic rats (DM), and diabetic rats treated with mangiferin at low (DMþ MF-L), middle (DMþMF-M) and high (DM þMF-H) doses. Mean 7 S.E.M., n ¼6–7. nnnP o0.01, vs. Cont group; ##Po 0.01, vs. DM group.

Acknowledgments The work was supported by the fund of Natural Science Foundation of Jiangsu Province (BK2011208), China, Zhen Xing Project of XZMC, China, and the project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions, China.

References Beisswenger, P., Jean, S., Brinck-Johnsen, T., Siegel, A., Cavender, J., 1995. Acetol production is increased in early diabetic nephropathy [Abstract]. Diabetes 44, 23A. Beisswenger, P., Touchette, A., Howell, S., 1997. The effect of hyperglycaemia and diabetes on methylglyoxal and its detoxification pathways (Abstract). Diabetologia 40 (suppl. 1), 588. (I-V). Boor, P.J., Trent, M.B., Lyles, G.A., Tao, M., Ansari, G.A.S., 1992. Methylamine metabolism to formaldehyde by vascular semicarbazide-sensitive amine oxidase. Toxicology 73, 251–258. Edelstein, D., Brownlee, M., 1992. Mechanistic studies of advanced glycosylation end product inhibition by aminoguanidine. Diabetes 41, 26–29. Brownlee, M., 2001. Biochemistry and molecular cell biology of diabetic complications. Nature 414, 813–820. Brownlee, M., 2005. The pathobiology of diabetic complications: a unifying mechanism. Diabetes 54, 1615–1625. Brownlee, M., Cerami, A., Vlassara, H., 1988. Advanced glycosylation end products in tissue and the biochemical basis of diabetic complications. New England Journal of Medicine 318, 1315–1321. Brownlee, M., Vlassara, H., Kooney, A., Ulrich, P., Cerami, A., 1986. Aminoguanidine prevents diabetes-induced arterial wall protein crosslinking. Science 232, 1629–1632. Brouwers, O., Niessen, P.M., Ferreira, I., Miyata, T., Scheffer, P.G., Teerlink, T., Schrauwen, P., Brownlee, M., Stehouwer, C.D., Schalkwijk, C.G., 2011. Overexpression of glyoxalase-I reduces hyperglycemia-induced levels of advanced

363

glycation end products and oxidative stress in diabetic rats. Journal of Biological Chemistry 286, 1374–1380. Di Loreto, S., Zimmitti, V., Sebastiani, P., Cervelli, C., Falone, S., Amicarelli, F., 2008. Methylglyoxal causes strong weakening of detoxifying capacity and apoptotic cell death in rat hippocampal neurons. International Journal of Biochemistry and Cell Biology 40, 245–257. Forbes, J.M., Coughlan, M.T., Cooper, M.E., 2008. Oxidative stress as a major culprit in kidney disease in diabetes. Diabetes 57, 1446–1454. Guo, Z.H., Xi, R.G., Wang, X.B., Wu, L.J., Gao, H.Y., 2009. A new trincallane derivative from Salacia hainanensis Chun et How. Yao Xue Xue Bao 44, 1123–1126. (in Chinese). Kashihara1, N., Haruna1, Y., Kondeti, V.K., Kanwar, Y.S., 2010. Oxidative stress in diabetic nephropathy. Current Medicinal Chemistry 17, 4256–4269. Kalousova, M., Zima, t., Tesar, V., Dusilova-Sulkova, S., Skrha, J., 2005. Advanced glycoxidation end products in chronic diseases-clinical chemistry and genetic background. Mutation Research 579, 37–46. Li, X., Cui, X.B., Sun, X.Y., Li, X.D., Zhu, Q., Li, W., 2010. Mangiferin prevents diabetic nephropathy progression in streptozotocin-induced diabetic rats. Phytotherapy Research 24, 893–899. Lu, J., Randell, E., Han, Y., Adeli, K., Krahn, J., Meng, Q.H., 2011. Increased plasma methylglyoxal level, inflammation, and vascular endothelial dysfunction in diabetic nephropathy. Clinical Biochemistry 44, 307–311. Liu, Y.W., Zhu, X., Li, W., Lu, Q., Wang, J.Y., Wei, Y.Q., Yin, X.X., 2012. Ginsenoside Re attenuates diabetes-associated cognitive deficits in rats. Pharmacology, Biochemistry and Behavior 101, 93–98. Maher, P., Dargusch, R., Ehren, J.L., Okada, S., Sharma, K., David Schubert, D., 2011. Fisetin lowers methylglyoxal dependent protein glycation and limits the complications of diabetes. PLoS One 6, e21226. Muruganandan, S., Gupta, S., Kataria, M., Lal, J., Gupta, P.K., 2002. Mangiferin protects the streptozotocin-induced oxidative damage to cardiac and renal tissues in rats. Toxicology 176, 165–173. Marquez, L., Garcia-Bueno, B., Madrigal, J.L., Leza, J.C., 2012. Mangiferin decreases inflammation and oxidative damage in rat brain after stress. European Journal of Nutrition 51, 729–739. Miyata, T., Hori, O., Zhang, J.H., Yan, S.D., Ferran, L., Iida, Y., Schmidt, A.M., 1996. The receptor for advanced glycation endproducts mediates the interaction of AGEβ2-microglobulin with human mononuclear phagocytes via an oxidantsensitive pathway: implication for the pathogenesis of dialysis-related amyloidosis. Journal of Clinical Investigation 98, 1088–1094. Miura, T., Ichiki, H., Iwamoto, N., Kato, M., Kubo, M., Sasak, H., Okada, M., Ishida, T., Seino, Y., Tanigawa, K., 2001. Antidiabetic activity of the rhizoma of Anemarrhena asphodeloides and active components, mangiferin and its glucoside. Biological and Pharmaceutical Bulletin 24, 1009–1011. Muruganandan, S., Srinivasan, K., Gupta, S., Gupta, P.K., Lal, J., 2005. Effect of mangiferin on hyperglycemia and atherogenicity in streptozotocin diabetic rats. Journal of Ethnopharmacology 97, 497–501. Miyata, T., van Ypersele de Strihou, C., Imasawa, T., Yoshino, A., Ueda, Y., Ogura, H., Kominami, K., Onogi, H., Inagi, R., Nangaku, M., Kurokawa, K., 2001. Glyoxalase I deficiency is associated with an unusual level of advanced glycation end products in a hemodialysis patient. Kidney International 60, 2351–2359. Myint, K.M., Yamamoto, Y., Doi, T., Kato, I., Harashima, A., Yonekura, H., Watanabe, T., Shinohara, H., Takeuchi, M., Tsuneyama, K., Hashimoto, N., Asano, M., Takasawa, S., Okamoto, H., Yamamoto, H., 2006. RAGE control of diabetic nephropathy in a mouse model: effects of RAGE gene disruption and administration of low molecular weight heparin. Diabetes 55, 2510–2522. Prabhu, S., Jainu, M., Sabitha, K.E., Devi, C.S., 2006. Role of mangiferin on biochemical alterations and antioxidant status in isoproterenol-induced myocardial infarction in rats. Journal of Ethnopharmacology 107, 126–133. Palsamy, P., Subramanian, S., 2011. Resveratrol protects diabetic kidney by attenuating hyperglycemia-mediated oxidative stress and renal inflammatory cytokines via Nrf2-Keap1 signaling. Biochimica et Biophysica Acta 1812, 719–731. Queisser, M.A., Yao, D., Geisler, S., Hammes, H.P., Lochnit, G., Schleicher, E.D., Brownlee, M., Preissner, K.T., 2010. Hyperglycemia impairs proteasome function by methylglyoxal. Diabetes 59, 670–678. Rossing, P., 2006. Diabetic nephropathy: worldwide epidemic and effects of current treatment on natural history. Current Diabetes Reports 6, 479–483. Reiniger, N., Lau, K., McCalla, D., Eby, B., Cheng, B., Lu, Y., Qu, W., Quadri, N., Ananthakrishnan, R., Furmansky, M., Rosario, R., Song, F., Rai, V., Weinberg, A., Friedman, R., Ramasamy, R., D’Agati, V., Schmidt, A.M., 2010. Deletion of the receptor for advanced glycation end products reduces glomerulosclerosis and preserves renal function in the diabetic OVE26 mouse. Diabetes 59, 2043–2054. Rabbani, N., Thornalley, P.J., 2008. Dicarbonyls linked to damage in the powerhouse: glycation of mitochondrial proteins and oxidative stress. Biochemical Society Transactions 36, 1045–1050. Suzuki, D., Miyata, T., 1999. Carbonyl stress in the pathogenesis of diabetic nephropathy. Internal medicine (Tokyo) 38, 309–314. Sena, C.M., Matafome, P., Crisostomo, J., Rodrigues, L., Fernandes, R., Pereira, P., Seiça, R.M., 2012. Methylglyoxal promotes oxidative stress and endothelial dysfunction. Pharmacological Research 65, 497–506. Sharma, K., McCue, P., Dunn, S.R., 2003. Diabetic kidney disease in the db/db mouse. American Journal of Physiology—Renal Physiology 284, F1138–F1144. Shinohara, M., Thornalley, P.J., Giardino, I., Beisswenger, P., Thorpe, S.R., Onorato, J., Brownlee, M., 1998. Overexpression of glyoxalase-I in bovine endothelial cells inhibits intracellular advanced glycation endproduct formation and prevents

364

Y.-W. Liu et al. / European Journal of Pharmacology 721 (2013) 355–364

hyperglycemia-induced increases in macromolecular endocytosis. Journal of Clinical Investigation 101, 1142–1147. Suzuki, D., Toyoda, M., Yamamoto, N., Miyauchi, M., Katoh, M., Kimura, M., Maruyama, M., Honma, M., Umezono, T., Yaganme, M., 2006. Relationship between the expression of advanced glycation end-products (AGE) and the receptor for AGE (RAGE) mRNA in diabetic nephropathy. Internal Medicine 45, 435–441. Schmidt, A.M., Yan, S.D., Wautier, J.L., Stern, D., 1999. Activation of receptor for advanced glycation end products: a mechanism for chronic vascular dysfunction in diabetic vasculopathy and atherosclerosis. Circulation Research 84, 489–497. Schmidt, A.M., Yan, S.D., Yan, S.F., Stern, D.M., 2001. The multiligand receptor RAGE as a progression factor amplifying immune and inflammatory responses. Journal of Clinical Investigation 108, 949–955. Thornalley, P.J., 2003. Glyoxalase I-structure, function and a critical role in the enzymatic defence against glycation. Biochemical Society Transactions 31 (part 6). Thornalley, P.J., 2005. Dicarbonyl intermediates in the maillard reaction. Annals of the New York Academy of Sciences 1043, 111–117. Tanji, N., Markowitz, G.S., Fu, C., Kislinger, T., Taguchi, A., Pischetsrieder, M., Stern, D., Schmidt, A.M., D’Agati, A.D., 2000. Expression of advanced glycation end products and their cellular receptor RAGE in diabetic nephropathy and nondiabetic renal disease. Journal of theAmerican Society of Nephrology 11, 1656–1666. Tang, S.Y., Whiteman, M., Peng, Z.F., Jenner, A., Yong, E.L., Halliwell, B., 2004. Characterization of antioxidant and antiglycation properties and isolation of active ingredients from traditional chinese medicines. Free Radical Biology and Medicine 36, 1575–1587.

Wautier, J.L., Wautier, M.P., Schmidt, A.M., Anderson, G.M., Hori, O., Zoukourian, C., Capron, L., Chappey, O., Yan, S.D., Brett, J., 1994. Advanced glycation end products (AGEs) on the surface of diabetic erythrocytes bind to the vessel wall via a specific receptor inducing oxidant stress in the vasculature: a link between surface-associated AGEs and diabetic complications. Proceedings of the National Academy of Sciences of the United States of America 91, 7742–7746. Yao, D., Brownlee, M., 2010. Hyperglycemia-induced reactive oxygen species increase expression of the receptor for advanced glycation end products (RAGE) and RAGE ligands. Diabetes 59, 249–255. Yamamoto, Y., Kato, I., Doi, T., Yonekura, H., Ohashi, S., Takeuchi, M., Watanabe, T., Yamagishi, S., Sakurai, S., Takasawa, S., Okamoto, H., Yamamoto, H., 2001. Development and prevention of advanced diabetic nephropathy in RAGE overexpressing mice. Journal of Clinical Investigation 108, 261–268. Yamawaki, H., Saito, K., Okada, M., Hara, Y., 2008. Methylglyoxal mediates vascular inflammation via JNK and p38 in human endothelial cells. American Journal of Physiology—Cell Physiology 295, C1510–C1517. Yoshikawa, M., Nishida, N., Shimoda, H., Takada, M., Kawahara, Y., Matsuda, H., 2001. Polyphenol constituents from Salacia species: quantitative analysis of mangiferin with alphaglucosidase and aldose reductase inhibitory activities. Yakugaku Zasshi 121, 371–378. Yu, P.H., 1990. Oxidative deamination of aliptatic amines by rat aorta semicarbazide-sensitive amine oxidase. Journal of Pharmacy and Pharmacology 42, 882–884. Yu, P.H., Zuo, D.M., 1997. Aminoguanidine inhibits semicarbazide-sensitive amine oxidase activity: implications for advanced glycation and diabetic complications. Diabetologia 40, 1243–1250.