Up-regulation of heparin binding epidermal growth factor-like growth factor and amphiregulin expression in Helicobacter pylori-infected human gastric mucosa

ALIMENTARYTRACT

DIGEST LIVER IJIS 2002~3~:~SS-505

Up-regulation of heparin binding epidermal growth factor-like growth factor and amphiregulin expression in Helicobacter pylori-infected human gastric mucosa C. Tuccillol 4* B.A. Manzol* G. Nardone2 G. D’Argenio3 A. Rocco2 A. Di Popolo4 N. Della Valle3 S. Staibano5 G. De Rosa5 V. RiccF C. Del Vecchio Blancol R. Zarrilli4 M. Romanol 4

From I Department of Medicine, Gasfroenterology, Second University of Naples, Naples; 2 Hepatology Unit, 3 Gastroenterology Unit. 4L?epartment of Cellular and Molecular Biology and Pathology ‘L. Celifano’Y 5Department of Biomorphologic and Functional Sciences, Pathology Section, “Federico II” University, Naples; 6 institute of Human Physiology, University of Pavia, Italy; * C. T. and B.A.M. contributed equally fo this work. af/6hws fsf comw~&lmt? Dr. M. Romeno, Dipartimentodi lnternistica Clinica e Sperimentale Gastroenterologia, Seconda Universitd di Napoli, c/o II Policlinico, Padiglione 3, Second0 Piano, via Pansini 5, 80131 Napoli, I&iy. Fax: +39-081-5666714. E-mail: marco. romano@unine2. it achnswl$dgemmlb Work supported in part by grants from Comitato Nazionale Bioeecnologie e Bologie Molecolara of CNR, M/L/t?, CIRANALJof II Universita di Napoli, and 5YK GULUEN, Italy, Authors thank M. Berardone and 8. Teocle for artwork and Dr. RX. Harris, Vanderbilt University Medical School, Nashville, TN, USA, for providing antibody to human HE-EGF, Submitted December 31. 2001. Accepted after revision, February 22, 2002.

499

Host response plays a major role in pathogenesis of Hegastroduodenal disease including adenocarcinoma of distal stomach. Epidermal growth factor-related growth factors are important modulators of gastric homeostasis in normal and damaged gastrointestinal mucosa. Aim. To evaluate expression of heparin binding epidermal growth factor and amphiregulin in antral mucosa of Helicobacter pylori-infected and non-infected dyspeptic patients and to correlate levels of heparin binding-epidermal growth factor and amphiregulin mRNA with mitogenie activity of gastric epithelial cells. Methods. A total of IO Helicobacter pylori-infected and 15 Helicobacter pylori non-infected [IO with and 5 without gastritis] dyspeptic patients were studied. Diagnosis of Helicobacter pylori infection was based on rapid urease test and histology Heparin binding-epidermal growth factor and amphiregulin mRNA expression in antral mucosa were assessed by reverse transcriptase-polymerase chain reaction. Protein expression and localization of both peptides were determined by immunohistochemistry. Mitogenic activity of antral gastric mucosa was assessed by determination of proliferating cell nuclear antigen labelling index by immunohistochemistry. Results. Heparin binding-epidermal growth factor and amphiregulin mRNA expression increased in Helicobacter pylori-infected vs Helicobacter pylori non-infected patients. Heparin binding-epidermal growth factor and amphiregulin immunostaining was more intense and deeper in gastric gland compartment in infected mucosa than in noninfected mucosa. Increase in heparin binding-epidermal growth factor and amphiregulin mRNA expression significantly correlated with increase in proliferating cell nuclear antigen labelling index. Conclusions. Helicobacter pylori gastritis is associated with up-regulation of heparin binding-epidermal growth factor and amphiregulin which correlates with increased mitogenic activity of gastric mucosa. Increased heparin binding-epidermal growth factor and amphiregulin expression is postulated to contribute to reparative response of gastric mucosa to Helicobacter pylori infection.

Background. licobacter

Digest

Liver

pylori-induced

Dis 2002;34:499-505

Key words: amphiregulin; growth factor; proliferating

gastric mucosa; cell nuclear antigen

Helicobacter

py/ori; heparin

binding-epidermal

Introduction Helicobacter pylori (H. pylori) is the major causative agent of chronic superficial gastritis and peptic ulcer disease and seems to play an important role in the development of adenocarcinoma of the distal stomach in humans lm3.The mechanisms whereby H. pylori may cause gastroduodenal

“---

disease and contribute to gastric carcinogenesis are still hypothetical 4. However, production by the bacterium of specific virulence factors that cause damage to the epithelial cells and impair the healing process of the damaged mucosa together with the response of the host to the infection may be involved4. Polypeptide growth factors, and, in particular, epiderma1 growth factor (EGF)-related growth factors, are important modulators of gastric homeostasis in normal and damaged gastrointestinal (GI) mucosa and play a crucial role in the reparative events following gastric mucosal injury 5-8. Moreover, altered expression of EGF-related peptides has been reported in GI malignancies in humans 9-‘2. There are still controversial aspects about the possible relationship between H. pylori infection and EGF-related growth factors. We have recently shown that the expression of heparin binding EGF-like growth factor (HB-EGF) and amphiregulin (AR), members of the EGF receptor family of ligands, is up-regulated in human gastric epithelial cells exposed to H. pylori, whereas transforming growth factor CI (TGF-a) is not 13.Moreover, we have previously shown that the tissue concentration of TGF-a is decreased in H. pylori-infected human gastric mucosa ‘I. On the other hand, Schiemann et al. have recently shown a decrease in HB-EGF, AR, and TGF-a mRNA expression in H. pylori-infected human gastric mucosa Is. This study was, therefore, designed to evaluate the expression of HB-EGF and AR in the human gastric mucosa from H. pylori-infected and non-infected dyspeptic patients and to correlate the levels of HB-EGF and AR mRNA with the mitogenic activity of gastric epithelial cells as assessed by determination of proliferating cell nuclear antigen (PCNA), a well-established marker of cell proliferation 16.

Patients and methods Patients We studied 25 patients referred to our endoscopy units on account of dyspepsia. Ten (6 male and 4 female, age range 42-63 years, median 46) were H. pylori-infected and 15 were H. pylori non-infected. Of the 15 H. pylori-non-infected subjects, 10 (5 male and 5 female, age range 31-54 years, median 38) had some degree of gross gastric injury at endoscopy and chronic gastritis at histology, while 5 (3 male and 2 female, age range 25-42 years, median 31) had completely normal stomach both at endoscopy and histology. Diagnosis of H. pylori infection was based on rapid urease test and histology. Two biopsy samples were taken from the gastric antrum, body and angulus for histology. Haematoxylin and eosin staining was used for histological assessment

6. Tuccillo et al.

and a modified Giemsa staining was used for H. pylori identification. For determination of HB-EGF and AR mRNA expression, 4 biopsy samples were taken from the antrum, snap frozen in liquid nitrogen and stored at -70°C until assayed. A blood sample was obtained from each of the H. pylori-infected subjects to determine the CagA status by Western blotting (Helico 2.0, Genelabs Diagnostics, Singapore). None of the subjects had been drinking alcohol or taking non-steroidal antiinflammatory or anti-secretory drugs for at least 15 days prior to endoscopy. Each patient gave his/her informed consent to enter the study. The procedures followed in this study were in accordance with the ethical standards of the committee on human experimentation of the institution in which they were done and in accordance with the Declaration of Helsinki. Reverse transcriptase-polymerase chain reaction (RTPCR) analysis RT-PCR analysis was performed on total RNA isolated from gastric antral biopsies as described previously I7 lx. First-strand complementary DNA was prepared using 200 units of reverse transcriptase (Supertranscript RT, Gibco BRL, Gaithersburg, MD, USA), 1 ug of total RNA as template, and 10 pmol/l of random hexamers in the presence of 0.1 mmol/l dithiothreitol, 0.5 mmol/l dNTP-litium salt (Pharmacia, Milan, Italy), and 20 units of RNase inhibitor (Promega, Madison, WI, USA). The reaction profile was 37°C x 10 minutes, followed by 42°C x 60 minutes. To control for contamination by genomic DNA, all RNA samples were run in duplicate with or without addition of reverse transcriptase. Semiquantitative RT-PCR coamplification of HBEGF/glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and AR/GAPDH transcripts was performed using HB-EGF (sense, GCCACACCAAACAAGGAGGAGCAC; antisense, AGATGACAGCACAGCCACCAC), AR (sense, CCTTCTAGTAGTGAACCGTCCTCG; antisense, GCATGTTACTGCTTCCAGGTGCTC), and GAPDH (sense, CACCATCTTCCAGGAGCGAG; antisense, TCACGCCACAGTTTCCCGGA)-specific primers. Primers were placed on different exons. Primers were designed on the basis of the coding sequences of the human HBEGF or AR mRNA (accession number M60278 and M30704, respectively). GAPDH primers were as previously described I7 ‘*. All primers were provided by PRIMM Srl (Milan, Italy) and were used at the final concentration of 2 mmol/l. PCR amplifications were performed using 50 ng of cDNA in the presence of 0.2 mM dNTP (Boehringer Mannheim, Germany), 1.5 yCi o- 32P dGTP, and 0.3 ul AmpliTaq DNA polymerase (Perkin Elmer, Branchburg, NJ, USA). MgC12 was added at the final concentration of 1.5 mmol/l. After an 499

HG-fGF and AR expression

in H. pylorigastritis

initial denaturation step, 95°C x 2 minutes, the PCR amplification was performed using the following profiles: HB-EGF/GAPDH: 94°C x 1 minute, 62°C x 1 minute, and 72°C x 1 minute for 30 cycles. GAPDH primers were added after 7 cycles. AIUGAPDH: 94°C x 1 minute, 54°C x 1 minute, and 72°C x 1 minute for 28 cycles. GAPDH primers were added after 5 cycles. In all cases, the final extension was at 72°C x 10 minutes. PCR products were phenol-chloroform extracted, ethanol precipitated and subjected to 6 and 4% polyacrylamide gel electrophoresis, respectively, and autoradiography. Sizes of the amplified fragments were estimated from migration of the 1-kb ladder molecularweight marker (Gibco Laboratories, Grand Island, NY, USA), and identity was assessed by restriction-enzyme digestion. To test for contamination by genomic DNA, samples were run in duplicate with (+RT) or without (-RT) the addition of reverse transcriptase. PCR products were quantified by densitometric scanning of the autoradiograms using a Howteck Scanmaster 3 densitometric with RFL Print-TM Software (Pharmacia, Biotech Inc, Cologno Monzese, Italy). HB-EGF and AR mRNA levels were expressed as arbitrary units of optical density. Each individual value of mRNA levels represents the mean value of three independent RTPCRs. HB-EGF and AR transcripts levels were normalised to those of GAPDH. HB-EGF and AR immmunolocalisation Immunohistochemistry was performed as previously described i9. In brief, 4u thick serial sections were cut from paraffin blocks, mounted on acid-cleaned glass slides, and heated at 55°C for 60 min. Slides were dewaxed and rehydrated, then the endogenous peroxidase activity was inhibited by incubation with 0.3% Hz02 in methanol (20 min at room temperature). To reduce non-specific background staining, slides were incubated with 5% horse serum (15 min at room temperature). To enhance immunostaining, sections were treated with an antigen retrieval solution (10 mM citric acid monohydrate, pH 6.0, adjusted with 2N NaOH) and heated three times in a microwave oven at high power for live minutes. Rabbit anti-human HB-EGF polyclonal antibody 2998, kindly provided by Dr. R.C. Harris, Vanderbilt University, Nashville, TN, USA, and rabbit anti-human AR polyclonal antibody (Neo-Markers, Union City, CA, USA) were used at 1: 1000 and 1:50 dilution in phosphate buffer solution (PBS), respectively. Incubation was performed for 1 hour at room temperature. Slides were then washed in PBS for 5 minutes and incubated with biotinylated anti-rabbit IgG antibody for 40 minutes at room temperature. After washing with PBS, sections were incubated with avidin-biotin complex (ABC standard, Vector Laboratories Inc., Burlingame, CA, USA). Peroxidase conju500

gates were subsequently localised by diaminobenzidine tetrahydrochloride as a chromogen. Sections were counterstained with Harris’s haematoxylin. Antibody specificity was confirmed by preabsorption of antiHB-EGF and anti-AR antibodies with recombinant human (rh) HB-EGF (Sigma Chemical Co., St Louis, MO, USA) or rhAR (R&D Systems, Inc., Minneapolis, MN, USA) and by incubation without the primary antiserum. Mitogenic activity Gastric epithelial cell mitogenic activity was determined using an immunohistochemical staining for PCNA as previously described 19. PCNA is a well-established marker of cell proliferation I6 I9 2o that, in our hands, correlates with other markers of gastric epithelial cell mitogenesis such as AgNOR 19.Tissue samples were processed as described above. Slides were then incubated in a moist chamber overnight at 4°C with monoclonal primary antibody anti-PCNA (anti-PCNA clone PClO; Upstate Biotechnology, Lake Placid, NJ, USA, dilution 1:500). Visualization of immunoreaction was as described above. Negative controls with human non-immune serum substituting for specific primary antibody were included in each run. A human reactive lymph node was the positive control for PCNA. PCNA labelling index was determined by two independent observers (A.R. and S.S.) blinded to H. pyZori status by counting PCNA positive cells in at least five random fields of 300 cells each and expressed as percent of PCNA immunoreactive cells. The interobserver agreement was excellent with a k coefficient value of 0.75. Statistical analysis Significance of differences was evaluated by Wilcoxon rank sum test. Correlation was assessed by regression analysis. Significance was defined as a p value of ~0.05. Results

Endoscopic and histological features Of the H. pylori non-infected patients, 8 had antral erythema, 2 had gastroduodenal erosions and 5 had no macroscopic injury at endoscopy. At histology, 9 had mild to moderate chronic non-active superficial gastritis, one showed mild chronic active gastritis, and 5 had normal histology. Of the 10 H. pylori infected patients, 4 had antral erythema, 5 had gastroduodenal erosions and 1 had duodenal ulcer at endoscopy. At histology, all the H. pylori infected subjects had mild to moderate chronic active superficial gastritis, with intestinal metaplasia in one, and mild to moderate H. pylori density. Seven H. pylori-infect-

6. Tuccillo et al.

ed subjects showed positivity while 3 did not. HB-EGF

for anti-CagA

antibody

and AR mRNA expression

HB-EGF and AR mRNA expression, as assessed by semiquantitative RT-PCR coamplification of HB-

HPHP+ -+FtT UT +uT +iT

GAPDHd -267bp

H&EGF-

. ;

i ;

4. .. w

i’ f I-@+

l-6EGF

f

HP-

Hp+ AR

Fig. 1. HB-EGF and AR mRNA expression in human antral gastritis. a: Semiquantitative RT-PCR coamplification of HB-EGF/GAPDH and AWGAPDH transcripts in non-infected [Hp-I or H. pylori-infected [HP+’ gastric biopsies. HB-EGF/GAPDH and AWGAPDH PCR products were separated by electmphorasis on 6% and 4% polyacrylamide gals, respectively. To test for contamination by genomic DNA, samples were run in duplicate with f+RTI or without f-RTI the addition of reverse trenscriptase. Representative autoradiograms are shown. Amplified PCR products ate indicated on left side of autoradiograms. Sizes are shown on right. b: Densitometric scan values of HB-EGF and AR mRNA levels in gastric biopsies fmm H. pybri noninfected (Hp.1 or H. py/ori-infected fHp+I patients. HE-EGF and AR transcript levels are normalised to those of GAPDH and are expressed as arbitrary units Median densitometric scan values of each group are indicated by horizontal bars. Abbreviations: see list.

EGF/GAPDH and ARZGAPDH transcripts, was detectable in the antral gastric mucosa from non-infected dyspeptic subjects and was significantly higher in H. pylori-infected patients (Fig. 1, panel A). In particular, HB-EGF mRNA levels were 2.5-fold higher in H. pyZori-infected compared with non-infected subjects with gastritis (median 1.15, range 0.62-1.45 HBEGF/GAPDH arbitrary units vs median 0.46, range 0.20-0.70 HB-EGF/GAPDH arbitrary units, respectively, p
of HB-EGF

and AR

We also studied expression and localization of immunoreactive HB-EGF and AR in the gastric antrum of subjects with and without H. pylori infection (Fig. 2). An increase in the intensity of the immunostaining for HB-EGF and AR was observed in H. pylori-infected gastric mucosa compared with non-infected mucosa (Fig. 2, A vs C and B vs D, respectively). Both peptides showed a cytoplasmic localization with a reinforcement of the signal at the cell membrane level (Fig. 2 C, D). Moreover, in H. pylori-infected subjects, the immunostaining for HB-EGF and AR was detectable not only in the superficial epithelium (as mainly observed in H. pylori non-infected subjects) but also deeper in the glandular compartment of the mucosa (Fig. 2 C, D). A number of cells showed nuclear immunoreactivity for AR in the glandular compartment of H. pyloriinfected mucosa but not in the non-infected mucosa (Fig. 2, B vs D). Mitogenic

activity

To assess the mitogenic activity of the gastric mucosa, we evaluated the number of PCNA positive cells by immunohistochemistry. PCNA labelling index was slightly but significantly higher in H. pylori-infected

501

HE-ECF and AR expression

in K py/wi gastritis

Fig. 2. Locaiisation of immunoreactive HB-EGF and AR in the gastric antrum of dyspeptic subjects with and without H. py/ori infection. 3 and 6. HBEGF and AR immunostaining, respectively, in ff. py/ori negative chronic gastritis (original magn. 400x and 250x, respectively]. G and II. HB-EGF and AR immunostaining, respectively, in H. py/ori positive chronic gastritis, [original magn. 400x). Arrowheads indicate nuclear AR immunoreactivity. Abbreviations: see list.

32.5

. . : I w . .

! 8 .

3: .

25.0 HP-

f4P *

Fig. 3. Mitogenic activity of gastric mucosa in H. pylori positive Wp+l and negative U-/p1 gastritis as assessed by determination of PCNA labelling index. Median value in each group is represented by horizontal bars. Abbreviations: see list.

502

gastric mucosa than it was in non-infected mucosa with gastritis (median 30.6%, range 27.5%-32.5% vs median 27.8%, range 26.6%-30.1%, ~~0.05) (Fig. 3). PCNA labelling index in the 5 H. pylori negative subjects with completely normal stomach was lower than that observed in H. pylori negative subjects with gastritis (i.e., median 26.4%, range 24.1%-29.4%), but this did not reach statistical significance. The PCNA labelling index significantly correlated with HB-EGF or AR mRNA expression as assessed by linear regression analysis. (r=0.93, p
Discussion This study shows an increased expression of HB-EGF vs H. pylori non-infected and AR in H. pylori-infected

-____--

patients. The increase in HB-EGF and AR mRNA expression significantly correlated with the increase in the PCNA labelling index. H. pylori infection causes gastritis and gastroduodenal mucosal ulceration and is associated with an increased risk for development of adenocarcinoma of the distal stomach in humans ‘-3. Specific virulence factors produced by the bacterium contribute to the development of gastroduodenal mucosal injury and impair the healing process of the damaged mucosa 2122. However, host response to the infection and environmental factors are thought to be involved in the pathogenesis of H. pylorirelated gastroduodenal disease 4 *‘. In particular, an increase in the proliferative activity of gastric epithelial cells without a corresponding increase in apoptosis has been suggested to be implicated in H. pylori-related gastric carcinogenesis 23. EGF-related growth factors play a crucial role in the maintenance of gastric homeostasis s. In particular, they are involved in the protection and healing of the gastric mucosa 6-8 and modulate the balance between proliferation and apoptosis in normal and damaged GI mucosa s‘). In this study, we evaluated the expression of HB-EGF and AR, members of the EGF receptor family of ligands, in the antral gastric mucosa obtained from dyspeptic patients with and without H. pylori infection and found a significant increase in the gastric tissue levels of both peptides in H. pylori-infected subjects compared with non-infected patients. In H. pylori-infected subjects we found an approximately 2.5fold increase in HB-EGF and a 2-fold increase in AR mRNA expression compared with non-infected patients with and without endoscopic or histological gastric damage. Also, HB-EGF and AR immunostaining appeared more intense in the H. pylori-infected gastric mucosa than in the non-infected mucosa. In H. pyloriinfected subjects, the immunostaining for HB-EGF and AR was detectable not only in the superficial epithelium but also deeper in the glandular compartment of the gastric mucosa. We also observed a number of cells showing nuclear immunoreactivity for AR in the glandular compartment of H. pylori-infected gastric mucosa but not in the non-infected mucosa. Nuclear AR immunoreactivity has previously been reported in a number of studies, but whether AR plays any biological role in the nucleus is still uncertain l4 2s.Nuclear localization of growth factors and their receptors has now been reported for many molecules and suggested to play a role in intracellular signalling 26. Whether nuclear AR immunoreactivity in H. pylori-infected gastric mucosa has any biological significance needs to be determined. In agreement with our previous report showing that H. pylori-induced up-regulation of HBEGF and AR in gastric cells in vitro was independent of CagA, we did not detect any difference in HB-EGF “~-.“-

C. Tuccillo et al.

or AR mRNA levels between the seven patients with, and the three patients without anti-CagA antibodies. However, the role of the Cag status in HB-EGF or AR up-regulation in H. pylori-infected subjects needs further investigation. Whether a relationship exists between H. pylori infection and EGF-related peptides is not completely clear. TGF-a expression has been reported to be decreased both at the mRNA and protein level in H. pylori gastritis in humans l4 Is. We have recently shown that the expression of HB-EGF and AR, but not TGF-a, is upregulated in human gastric epithelial cells exposed to H. pylori in vitro I3. Also, as in our study, an increase in AR mRNA expression in the antrum but not the body of patients with H. pylori gastritis independent of the tag status has recently been demonstrated by Cox et al. *‘. On the other hand, a decrease in HB-EGF and AR mRNA expression has been reported to occur in H. pylori-infected human gastric mucosa “. The apparent discrepancy between our study and the study of Schiemann et al. Is showing down-regulation of HB-EGF and AR in H. pylori gastritis might be due to the fact that they studied 7 H. pylori-infected patients all with duodenal ulcer whereas in our study only 1 of the 10 H. pyZori-infected patients had duodenal ulcer. Interestingly, the lowest level of HB-EGF and AR mRNA expression in our series of H. pylori-infected subjects was observed in the patient with duodenal ulcer. It is well known that H. pylori infection exerts diverse effects on gastric physiology and this may be associated with different clinical outcomes 28. That H. pylori-infected subjects with non ulcer dyspepsia have a high level of expression of HB-EGF and AR compared with duodenal ulcer patients may suggest a different perturbation of gastric homeostasis in different clinical settings. Human gastric mucosa colonised by H. pylori shows an increased mitogenic activity (30, 31). We found a slight, but significant, increase in gastric epithelial cell proliferation, consistent with similar reports of previously published studies 7-930. The increase in mitogenic activity strongly correlated with the increased expression of HB-EGF and AR. Since EGF receptor ligands stimulate gastric epithelial cell mitogenesis and inhibit apoptosis 5 9, our findings suggest that the increased proliferative activity of H. pylori-infected gastric mucosa might be driven by a sustained overexpression of EGF-related growth factors. However, the biological relevance of the small increase in cell proliferation observed in our study needs to be interpreted with caution. This finding contrasts with our previous observation in vitro showing that H. pylori-induced overexpression of HB-EGF and AR in MKN 28 cells is associated with inhibition of cell proliferation 13. One possible explanation for this apparent discrepancy may be that in vitro experimental studies are representative of

503

HA-EGF and AR expression

in H. pykwi gastritis

an acute H. pylori-mediated effect whereas clinical studies on human subjects infected by H. pylori are representative of the effect of persistent H. pylori infection. Other factors may be involved in the hyperproliferative activity of gastric epithelium in H. pylori gastritis. Peek et al. have recently shown that in H. pyloricolonised Mongolian gerbils, the increased gastric epithelial cell growth may be mediated by gastrin-dependent mechanisms 3’. Interestingly, in insulin-gas&in transgenic mice, hypergastrinaemia is associated with overexpression of HB-EGF 32. Also, gastrin has been demonstrated to up-regulate HB-EGF and AR, but not TGF-a, expression in rat gastric epithelial cells in vitro 3334. Moreover, H. pylori infection up-regulates the expression of cycle-oxygenase-2 (COX-2), the inducible isoform of the enzyme responsible for prostaglandin synthesis 35, in gastric mucosal cells in vitro 36and in vivo I7 3738,the highest level of expression being in the antral mucosa 38. COX-2 also stimulates cell growth and inhibits apoptosis 39 and may, therefore, contribute to the hyperproliferative response of gastric mucosa to H. pylori colonisation. In conclusion, we have shown that H. pylori gastritis is associated with up-regulation of HB-EGF and AR expression. The increased HB-EGF and AR expression strongly and significantly correlates with the increased proliferative activity of the H. pylori-infected gastric mucosa. The identification of H. pylori specific signalling pathways leading to the induction of cell cycle mediators throw further light on the mechanism of H. pylori-associated gastric carcinogenesis and might be of interest for therapeutic purposes to overcome H. pyZori-associated gastric cancer. However, one must be cautious in drawing conclusions on the pathogenic implications, due to the fact that 5 subjects in the H. pylori-infected group had gastroduodenal erosions at endoscopy and might hypothetically represent a duodenal ulcer phenotype which should be protected against gastric cancer *l . We postulate that H. pylori-associated gastric mucosal cell injury triggers the compensatory overexpression of growth factors which stimulate cell proliferation and inhibit apoptosis s 9. A sustained growth factor overexpression causes an overall increase in the gastric epithelial cell turnover that, together with increased oxidative DNA damage 4o4’, may ultimately favour the progression from chronic gastritis to adenocarcinoma in the multistep model of gastric carcinogenesis. One may envisage the chemopreventive use of a specific EGF receptor tyrosine kinase inhibitor, alone or in combination with a selective COX2 inhibitor4*, in those H. pylori-infected subjects who are resistant to conventional therapeutic regimens and potentially at risk for developing adenocarcinoma of the distal stomach.

List of abbreviations AR: amphiregulin; COX-2: cyclooxygenase-2; EGF: epidermal growth factor; GAPDH: glyceraldehyde3phosphate dehydrogenase; GI: gastrointestinal; H. py/ori: He/icobactarpy/ori; HE-EGF: heparin binding- epidermal growth factor; PBS: phosphate buffer solution; PCNA: proliferating cell nuclear antigen; PCR: polymerase chain reaction: rh: recombinant human; FIT-PCR: reverse transcriptase-polymerase chain reation; TGF-a: transforming growth factor alpha.

References I Blaser MJ. Hypothesis: the changing relationships of Helicobacter pylori and humans: implications for health and disease. J Infect Dis 1999;179:1523-30. z Huang J-Q, Sridhar S, Chen Y, Hunt RH. Meta-analysis of the relationship between Helicobacter pylori seropositivity and gastric cancer. Gastroenterology 1998;114: 1169-79. 3 Watanabe T, Tada M, Nagai H, Sasaki pylori infection induces gastric cancer troenterology 1998;115:642-8. 4 Zarrilli ithelial crobiol

R, Ricci V, Roman0 cells to Helicobacter 1999; 1:93-9.

M. Molecular pylori-induced

S, Nakao M. Helicobacter in mongolian gerbils. Gasresponse of gastric epcell damage. Cell Mi-

5 Barnard JA, Beauchamp RD, Russell WE, DuBois RN, Coffey RJ. Epidermal growth factor-related peptides and their relevance to gastrointestinal pathophysiology. Gastroenterology 1995;108:564-80. b Roman0 M, Polk WH, Awad JA, Arteaga CL, Nanney LB, Wargovich MJ, et al. Transforming growth factor a protection against drug-induced damage to the rat gastric mucosa in vivo. J Clin Invest 1992;90:2409-21. ’ Roman0 M, Krause ER, Boland CR, Coffey RJ. Comparison between transforming growth factor alpha and epidermal growth factor in the protection of rat gastric mucosa against drug-induced injury. Ital J Gastroenterol 1994;26:223-8. 8 Roman0 M, Lesch CA, Meise KS, Veljiaca M, Sanchez B, Krause ER, et al. Increased gastroduodenal concentrations of transforning growth factor o in adaptation to aspirin in monkeys and rats. Gastroenterology 1996;llO: 1446-55. 9 Coffey RJ, McCutchen CM, Graves-Deal R, Polk WH, Jr. Transforming growth factors and related peptides in gastrointestinal neoplasia. J Cell Biochem 1992;(Suppl 16G):ll I-8. ‘(I Ciardiello F, Kim N, Saeki T, Dono R, Persico MG, Plowman GD, et al. Differential expression of epidermal growth factor-related proteins in human colorectal tumors. Proc Nat1 Acad Sci USA 1990;87:4905-9. I’ Naef M, Yokoyama M, Friess H, Buchler MW, Korc M. Co-expression of heparin-binding EGF-like growth factor and related peptides in human gastric carcinoma. Int J Cancer 1996;66:315-21. I2 Kitadai Y, Yasui W, Yokozaki H, Kuniyasu H, Ayhan A, Haruma K, et al. Expression of amphiregulin, a novel gene of the epiderma1 growth factor family, in human gastric carcinomas. Jpn J Cancer Res 1993;84:879-84. I3 Roman0 M, Ricci V, Di Pop010 A, Sommi P, Del Vecchio Blanc0 C, Bruni CB, et al. Helicobacter pylori upregulates expression of epidermal growth factor-related peptides, but inhibits their proliferative effect in MKN 28 gastric mucosal cells. J Clin Invest 1998;101:1604-13. I4 Persico M, Suozzo R, Zarrilli R, Tuccillo C, Ricci Decreased gastroduodenal mucosal concentration ing growth factor a in Helicobacter pylori-infected tients. Am J Gastroenterol 1998;12:2643-4.

V, Roman0 M. of transforndyspeptic pa-

C. Tuccillo et al.

Is Schiemann U, Konturek IW, Osterhoff M, Assert R, Rembiasz K, Pfeiffer D, et al. Decreased expression of epidermal growth factor receptor and mRNA of its ligands in Helicobacter pylori-infected gastric mucosa. Stand J Gastroenterol 2001;36:23-3 1. Ih Travali S, Ku DH, Rizzo MG, Ottavio L, Baserga B. Structure of the human gene for the proliferating antigen. J Biol Chem 1989;264:7466-72.

R, Calabretta cell nuclear

I7 Zarrilli R, Tuccillo C, Santangelo M, Nardone G, Roman0 M. Increased COX-2, but not COX- 1, mRNA expression in Helicobacter pylori gastritis. Am J Gastroenterol 1999;94:3376-8. Ix Nardone G, Roman0 M, Calabro A, Pedone PV, de Sio I, Persico M, et al. Activation of fetal promoters of insulin-like growth factor-11 gene in hepatitis C virus-related chronic hepatitis, cirrhosis and hepatocellular carcinoma. Hepatology 1996;23:1304-12. I4 Nardone G, Staibano S, Rocco A, Mezza E, D’Armiento FP, Insabato L, et al. Effect of Helicobacter pylori infection and its eradication on cell proliferation, DNA status, and oncogene expression in patients with chronic gastritis. Gut 1999;44:789-99. ?” Irazusta SP, Vassalklo J, Magna LA, Metze K, Trevisan M. The value of PCNA and AgNOR staining in endoscopic biopsies of gastric mucosa. Path01 Res Pratt 1998; 194:33-9. ?’ Ricci V, Zarrilli R, Roman0 M. Voyage of Helicobacter pylori in human stomach: Odyssey of a bacterium. Digest Liver Dis 2002;34:2-8. L? Ricci V, Ciacci C, Zarrilli R, Sommi P, Tummuru MK, Del Vecchio Blanc0 C, et al. Effect of Helicobacter pylori on gastric epithelial cell migration and proliferation in vitro: role of VacA and CagA. Infect Immun 1996;64:2829-33. ?1 Peek RM Jr, Moss SF, Tham KT, Perez-Perez GI, Wang S, Miller GG, et al. Helicobacter pylori cagA+ strains and dissociation of gastric epithelial cell proliferation from apoptosis. J Nat1 Cancer Inst 1997;89:863-9. 24 Johnson GR, Saeki T, Auersperg N, Gordon AW, Shoyab M, Salomon DS, et al. Response to and expression of amphiregulin by ovarian carcinoma and normal ovarian surface epithelial cells: nuclear localization of endogenous amphiregulin. Biochem Biophys Res Commun 1991; 180:48 l-8. ZT Srinivasan R, Gillett CE, Barnes DM, Gullick WJ. Nuclear expression of the c-erbB-4/HER-4 growth factor receptor in invasive breast cancers. Cancer Res 2000;60: 1483-7. ” Jans DA, Hassan G. Nuclear targeting by growth factors, cytokines, and their receptors: a role in signaling? Bioessays 1998;20:4001 1. :’ Cox JM, Clayton CL, Tomita T, Wallace DM, Robinson PA, Crabtree JE. cDNA array analysis of tag pathogenicity island-associated Helicobacter pylori epithelial cell response genes. Infect Immun 2001;69:6970-6980. lx McCall KEL, El-Omar E. Mechanisms involved in the development of hypochlorhydria and pangastritis in Helicobacter pylori infection. In: Hunt RH, Tytgat GNY, editors. Helicobacter pylori - Basic mechanisms to clinical cure 2000. Dordrecht, NL: Kluver Academic Publishers; 2000. p. 373-84.

I I

29 Jones NL, Shannon PT, Cutz E, Yeger H, Sherman PM. Increase in proliferation and apoptosis of gastric epithelial cells early in the natural history of Helicobacter pylori infection. Am J Pathol 1997;151:1695-703. ‘” Brenes F, Ruiz B, Correa P, Hunter F, Rhamakrishnan T, Fontham E, et al. Helicobacter pylori causes hyperproliferation of the gastric epithelium: pre- and post-eradication indices of proliferating cell nuclear antigen. Am J Gastroenterol 1993;88: 1870-5. j’ Peek RM, KT, et al. events and ogy 2000;

Jr, Wirth H-P, Moss SF, Yang M, Ardalla AM, Tham Helicobacter pylori alters gastric epithelial cell cycle gastrin secretion in Mongolian gerbils. Gastroenterol118:48-59.

32 Wang TC, Dangler CA, Chen D, Goldenring JR, Koh T, Raychowdury R, et al. Synergistic interaction between hypergastrinemia and Helicobacter infection in a mouse model of gastric cancer. Gastroenterology 2000; 118:36-47. 31 Tsutsui S, ShinomuraY, Higashiyama S, HigashimotoY, Miyazaki Y, Kanayama S, et al. Induction of heparin-binding epidermal growth factor-like growth factor and amphiregulin mRNAs by gastrin in the rat stomach. Biochem Biophys Res Commun 1997;235:520-3. 14 Miyazaki Y, Shinomura Y, Tsutsui S, Zushi S, Higashimoto Y, Kanayama S, et al. Gastrin induces heparin-binding epidermal growth factor-like growth factor in rat gastric epithelial cells gastrin transfected with receptor. Gastroenterology 1999;116:78-89. 3j Fiorucci S, Antonelli E. Cycle-oxygenase enzymes. Structural basis for selective inhibition of cycle-oxygenases by anti-inflammatory agents. Digest Liver Dis 2001;33(Suppl 2):S2-7. ” Roman0 M, Ricci V, Memoli A, Tuccillo C, Di Pop010 A, Sommi P, et al. Helicobacter pylori up-regulates cyclooxygenase-2 mRNA expression and prostaglandin E2 synthesis in MKN 28 gastric mucosal cells in vitro. J Biol Chem 1998;273:28560-3. 17 McCarthy CY, Crofford LJ, Greenson J, Scheiman JM. Cyclooxygenase-2 expression in gastric antral mucosa before and after eradication of Helicobacter pylori infection. Am J Gastroenterol 1999;94:1218-23. 1* Fu S, Ramanujam KS, Wong A, Fantry GT, Drachenberg CB, James SP, et al. Increased expression and cellular localization of inducible nitric oxide synthase and cyclooxygenase-2 in Helicobacter pylori gastritis. Gastroenterology 1999; 1 16: 13 19-29. 34 Williams CS, Mann es in inflammation, 1999;18:7908-16. 4” Correa eration.

P, Miller Br Med

M, DuBois cancer,

RN. The role of cyclooxygenasand development. Oncogene

MJS. Carcinogenesis, Bull 1998;54: 15 l-62.

apoptosis

and cell

prolif-

4’ Baik S-C, Youn H-S, Chung M-H, Lee W-K, Cho M-J, Ko G-H, et al. Increased oxidative DNA damage in Helicobacter pylori-infected human gastric mucosa. Cancer Res 1996;56: 1279-82. Q Gupta RA, DuBois Med 2000;6:974-5.

RN.

Combinations

for cancer

prevention.

Nat

Digestive and Liver Disease and The Italian Journal of Gastroenterology (Volumes 29-34) are available on-line at the web site:

http://www.dldjournal.it Possibility of on-line subscriptions.

505