Up-regulation of miR-181a in clear cell renal cell carcinoma is associated with lower KLF6 expression, enhanced cell proliferation, accelerated cell cycle transition, and diminished apoptosis

Urologic Oncology: Seminars and Original Investigations ] (2017) ∎∎∎–∎∎∎

Original article

Up-regulation of miR-181a in clear cell renal cell carcinoma is associated with lower KLF6 expression, enhanced cell proliferation, accelerated cell cycle transition, and diminished apoptosis Zhenwei Lei, M.D., Xin Ma, M.D., Hongzhao Li, M.D., Yu Zhang, M.D., Yu Gao, M.D., Yang Fan, M.D., Xintao Li, M.D., Luyao Chen, M.D., Yongpeng Xie, M.D., Jianwen Chen, M.D., Shengpan Wu, M.D., Lu Tang, M.D., Xu Zhang, M.D.* Department of Urology, State Key Laboratory of Kidney Diseases, Chinese People’s Liberation Army Medical School, Chinese People’s Liberation Army General Hospital, Beijing, PR China Received 15 May 2017; received in revised form 14 September 2017; accepted 18 September 2017

Abstract Objectives: Dysregulated expression of miR-181a accompanies tumorigenesis in many human cancers. However, in clear cell renal cell carcinoma (ccRCC), the role of miR-181a remains unclear. The aim of this study was to investigate biological functions of miR-181a and its expression levels in ccRCC tissues and cancer cell lines. Material and methods: Expression levels of miR-181a in samples of ccRCC tumors and adjacent nontumor tissues from 42 patients as well as in 786-O, 769-P, A498, and CAKI-1 ccRCC cell lines were determined by quantitative real-time polymerase chain reaction. Potential targets of miR-181a were predicted using bioinformatic approaches and then verified by using the luciferase reporter assay. The effects of miR-181a on cell proliferation, colony formation, cell cycle progression, and apoptosis were investigated in ccRCC cell lines transfected with specific miR-181a mimic and inhibitor. Results: We found that miR-181a expression was up-regulated in ccRCC tissues and cell lines. The expression level of miR-181a significantly correlated with the tumor size, tumor/node/metastasis staging, and Fuhrman grade. Luciferase assays showed that KLF6 was a target of miR-181a. KLF6 expression was inversely correlated with the level of miR-181a. Overexpression of miR-181a led to reduced KLF6 mRNA and protein levels, whereas mutations of the potential miR-181a binding sites in the KLF6 gene abrogated this inhibitory effect. Furthermore, overexpression of miR-181a promoted proliferation and G1/S cell cycle transition, as well as inhibited apoptosis by down-regulating KLF6 in ccRCC cells. Conclusions: miR-181a is up-regulated in ccRCC and may act as a tumor promoting factor by targeting KLF6 expression. Manipulating miR-181a may provide a beneficial effect in the treatment of ccRCC. r 2017 Elsevier Inc. All rights reserved.

Keywords: MicroRNA-181a; KLF6; Clear cell renal cell carcinoma; Proliferation; Apoptosis

1. Introduction Renal cell carcinoma (RCC) accounts for approximately 3% of all human cancers and is one of the most lethal urological malignancies [1]. It is estimated that there were 65,150 new cases and 13,680 deaths in 2013 due to RCC, as the incidence and mortality of this disease are steadily *

Corresponding author. E-mail address: [email protected] (X. Zhang).

http://dx.doi.org/10.1016/j.urolonc.2017.09.019 1078-1439/r 2017 Elsevier Inc. All rights reserved.

increasing [2]. Clear cell renal cell carcinoma (ccRCC), the most common and aggressive histological RCC subtype, accounts for about 75%–80% of all RCCs [3]. Although radical nephrectomy is the most effective treatment for early and local ccRCC, approximately 40% of newly diagnosed patients are in the late stage due to the lack of effective biomarkers. Furthermore, up to 20%–40% of early-stage local ccRCC cases have evidence of relapse or metastasis even after surgery, as ccRCC shows limited or no responsiveness to traditional anticancer therapies, such as

2

Z. Lei et al. / Urologic Oncology: Seminars and Original Investigations ] (2017) ∎∎∎–∎∎∎

radiation, chemo-, or cytokine therapy [4–6]. Although molecular targeting approaches have been used in postoperative adjuvant therapy for early-stage ccRCC or as palliative treatment for advanced ccRCC, the overall survival rate among ccRCC patients is still low [7,8]. Therefore, better understanding of ccRCC molecular basis and identification of novel biomarkers and effective therapeutic targets are urgently needed. MicroRNAs (miRNAs) are a group of endogenously expressed, small (19–24 nucleotides) noncoding RNAs that negatively regulate gene expression at the posttranscriptional level by interacting with the 3′-untranslated region (3′-UTR) of their target mRNAs [9]. miRNAs play important roles in multiple biological processes, including cell proliferation, metabolic transformation, and apoptosis [10]. A growing body of evidence suggests that dysregulation of miRNA expression affects the initiation, progression, and metastasis of various human cancers, because miRNAs can act as oncogenes or tumor suppressor genes. Therefore, miRNAs can be used as a potential new therapeutic target in cancer [11,12]. Many studies have recently discovered that aberrant expression of miR-181a, a member of the miR-181 family, occurs in various human cancers, including human cervical squamous cell carcinoma, colon cancer, ALL (acute lymphoblastic leukemia), pancreatic cancer, and breast cancer [13–17]. However, a potential role of miR181a in ccRCC remains unknown. Kruppel-like factor 6 (KLF6, also known as COPEB or ZF9), a member of the Kruppel-like family of C2H2 zinc finger transcription factors, is involved in multiple cellular events [18]. KLF6 has been identified as a tumor suppressor gene, which is inactivated or down-regulated by somatic mutations, loss of heterozygosity, and promoter hypermethylation in many human cancers, such as hepatocellular carcinoma, colon, gastric, and prostate cancers [19–22]. However, a potential role of KLF6 in the regulation of ccRCC is not yet fully understood. In this study, we found that miR-181a was up-regulated in ccRCC tissues and ccRCC cell lines. The correlation between miR-181a expression and ccRCC progression was analyzed. The results demonstrated that miR-181a plays an important role in cell proliferation, cell cycle progression, and regulation of apoptosis in ccRCC by targeting the

tumor suppressor gene KLF6. Thus, miR-181a levels may be a potential prognostic biomarker and a therapeutic target in ccRCC patients. 2. Materials and methods 2.1. Patients and clinical tissue samples Samples of ccRCC tumors and adjacent normal tissues were obtained from 42 patients with ccRCC in the Urology Department of the Chinese People’s Liberation Army (PLA) General Hospital (Beijing, China). All specimens were snap-frozen in liquid nitrogen immediately after resection and stored at −80°C for subsequent RNA and protein extraction. Pathological diagnosis of ccRCC was confirmed by 2 senior pathologists. Tumor/node/metastasis (TNM) stages of the specimens were assigned according to the 2011 Union for International Cancer Control TNM classification guidelines. The classification of nuclear grade was performed according to Fuhrman nuclear grading system. This study was approved by the Ethics Committee of the Chinese PLA General Hospital, and written informed consent was obtained from all included patients. 2.2. Total RNA extraction and qRT-PCR Total RNA, including mRNA, was extracted from tissues and cells using TRIzol reagent (Invitrogen, Carlsbad, CA). Corresponding cDNA was synthesized by using a TransScript First-Strand cDNA Synthesis SuperMix Kit (TransGen Biotech, Beijing, China) according to the manufacturer’s instructions. miRNAs were reverse-transcribed using specific stem-loop RT-PCR. Expression levels of miR-181a were determined using SYBR Green (TransGen Biotech) and an Applied Biosystems 7,500 Detection System. Relative miRNA expression levels were normalized to that of small nucleolar RNA U6, whereas relative mRNA expression levels were normalized to the level of peptidylprolyl isomerase A mRNA by using the 2−ΔΔCT cycle threshold method. The primers are listed in Table 1.

Table 1 Real-time PCR primers Gene

Primer sequence

Hsa-miR-181a stem-loop RT primer Hsa-miR-181a forward primer Hsa-miR-181a reverse primer U6 forward primer U6 reverse primer KLF6 forward primer KLF6 reverse primer PPIA forward primer PPIA reverse primer

CTCACAGTACGTTGGTATCCTTGTGATGTTCGATGCCATATTGTACTGTGAGACTCACCG ACACTCCAGCTGGGTGGAACATTCAACGCTGT CTCACAGTACGTTGGTATCCTTGTG CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT CGGACGCACACAGGAGAAAA CGGTGTGCTTTCGGAAGTG ATGGTCAACCCCACCGTGT TCTGCTGTCTTTGGGACCTTGTC

Z. Lei et al. / Urologic Oncology: Seminars and Original Investigations ] (2017) ∎∎∎–∎∎∎

3

Fig. 1. Expression of miR-181a and KLF6 in ccRCC. (A) miR-181a is up-regulated in 42 ccRCC tissues compared with adjacent normal tissues. (B) The overexpressions of miR-181a in ccRCC cell lines 786-O, 769-P, CAKI-1, A498 compared with HKC. (C) KLF6 is significantly down-regulated in ccRCC tissues in mRNA level. (D) KLF6 mRNA expressions are negatively correlated with miR-181a levels (n ¼ 42, r2 ¼ 0.091). (E and F) IHC images of KLF6 show a lower positive percentage in ccRCC tissues compared with their paired normal tissues. (G and H) Western blot results showed KLF6 is downregulated in ccRCC in protein levels,which is consistent with alternations in mRNA levels. IHC ¼ immunohistochemistry. (Color version of the figure available online.)

4

Z. Lei et al. / Urologic Oncology: Seminars and Original Investigations ] (2017) ∎∎∎–∎∎∎

Table 2 The relationship of miR-181a with the clinicopathological features in patients with ccRCC Clinicopathological features Age o54 454 Sex Male Female BMI o25 425 Fuhrman tumor grade I–II III–IV Tumor size, cm o7 47 TNM staging I–II III–IV Tumor necrosis No Yes

N

miR-181a expression (mean ± SD)

17 25

0.0031 ± 0.0061 0.0029 ± 0.0047

24 18

0.0035 ± 0.0065 0.0022 ± 0.0027

16 26

0.0038 ± 0.0065 0.0024 ± 0.0042

26 16

0.0011 ± 0.0010 0.0061 ± 0.0074

25 17

0.0014 ± 0.0022 0.0053 ± 0.0072

31 11

0.0010 ± 0.0007 0.0084 ± 0.0081

20 22

0.0011 ± 0.0008 0.0047 ± 0.0067

P value 0.902

0.414

0.423

0.002

0.015

o0.001

0.023

2.5. miRNA target prediction and luciferase reporter assay TargetScan (http://genes.mit.edu/targetscan/), PicTar (http://pictar.mdc-berlin.de/), and miRanda (http://cbio. mskcc.org/cgi-bin/mirnaviewer/mirnaviewer.pl) were used to predict miRNAs that could potentially target KLF6 and identify possible binding regions. KLF6 3′-UTR, which contained miR-181a binding sites, was amplified by PCR using whole blood DNA as template. The PCR product was digested with Xho1/Not1 and inserted into psiCHECK-2. Then, the mutated plasmid was generated by Genewiz (Beijing, China). All constructs were verified by sequencing. HEK 293T cells at 60% confluence were seeded into 6-well plates and then transfected with the luciferase reporter gene constructs (WT and MUT) in combination with either miR-181a mimic (GenePharma) or negative control miR (miR-NC). Transfection was performed with Lipofectamine 2,000 (Invitrogen). Luciferase activity was measured using a Dual Luciferase Reporter Assay kit (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity in each transfected well. Activities of Firefly (F) and Renilla (R) luciferases were measured in 48 hour after transfection, and the relative luciferase activity was expressed as F/R ratio. All transfection experiments were conducted in triplicate and repeated independently 3 times.

2.3. Cell lines and cell culture 2.6. MTS assay and colony formation assay Human renal proximal tubular epithelial cell line HKC and ccRCC cell lines 786-O, 769-P, A-498, Caki1, and HEK 293T were purchased from the National Platform of Experimental Cell Resources for Sci-Tech in 2011 and preserved in our laboratory. For in vitro functional studies, 786-O and 769-P cells were cultured in Dulbecco’s modified Eagle’s medium (HyClone) or in minimum essential medium with Earle’s Balanced Salts (HyClone) supplemented with 10% fetal bovine serum (FBS; Gibco BRL, Grand Island, NY), penicillin (100 U/ml), and streptomycin (100 U/ml). HEK 293T cells were maintained in RPMI1640 with 10% FBS (Gibco). All cell lines were cultured at 37°C in an incubator in a humidified atmosphere of 95% air and 5% CO 2.

2.4. RNAi treatment miR-181a mimic, inhibitor, and corresponding negative control miR as well as KLF6 siRNA and negative control siRNA were synthesized by GenePharma (Shanghai, China). RCC cells were seeded in 6-well plates at a density of 1 × 105 cells/well and transfected using Lipofectamine 2,000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instruction. Transfection efficiency was evaluated in each experiment by qRT-PCR in 48 hour after transfection.

After transfection with miR-181a mimic, miR-181a inhibitor, or NC for 48 hour, 786-O and 769-P cells were seeded in 96-well plates (1,000 cells per well) and cultured in 0.1 mL of DMEM supplemented with 10% FBS at 37°C in an incubator in a humidified atmosphere of 95% air and 5% CO2. A 20 ml of MTS (Cell Titer 96 Aqueous One Solution Reagent; Promega) was added to the wells in 0, 24, 48, 72, and 96 hour after cell seeding and then incubated for 4 hour at 37°C. The absorbance was measured at 490 nm with a microplate reader. In 48 hours after transfection with miR-181a mimic, miR-181a inhibitor, KLF6 plasmid, or KLF6 siRNA, cells were seeded in 6-well plates (500 cells per well) and incubated for 2 weeks for the colony formation assay. The cells were then washed with phosphate buffered saline, fixed with 10% formalin, and stained with 0.5% crystal violet (Sigma). The assay was repeated in triplicate. 2.7. Cell cycle and apoptosis analyses Cell cycle staging and apoptosis were analyzed by flow cytometry. In 48 hour after transfection with miR-181a mimic, miR-181a inhibitor, or miR-181a NC, 786-O and 769-P renal cancer cells were trypsinized in chilled PBS, fixed in 70% cold ethanol for more than 2 hour, and then stained with propidium iodide (BD Biosciences, San Jose,

Z. Lei et al. / Urologic Oncology: Seminars and Original Investigations ] (2017) ∎∎∎–∎∎∎

5

Fig. 2. miR-181a inhibited KLF6 expression by directly targeting its 3′UTR. (A) The predicted 2 potential targeting sites of miR-181a in the 3′-UTR of KLF6. (B) Sequence alignment of binding sites for miR-181a in the 3′-UTR of KLF6 (KLF6–3′UTR-Wt) and the site mutagenesis design for the luciferase reporter assay (KLF6–3′UTR-Mut1, KLF6–3′UTR-Mut2, and KLF6–3′UTR-Mut3). (C) Luciferase reporter assay of human embryonic kidney (HEK) 293T cells showed decreased reporter activity after transfection of the wild-type KLF6 3′UTR reporter, the KLF6 3′UTR MUT construct has no effect on reporter activity. Renilla/firefly luciferase ratios were calculated and further normalized to the without miRNA group which was set as 1. Data represent means ± s.d. (D and E) qRT-PCR and WB analysises show that over-expression of miR-181a inhibites the expression of KLF6 in mRNA and protein levels in 786-O and 769-P cells. (Color version of the figure available online.)

CA). Cell apoptosis was identified by Annexin-V (BD Biosciences) and propidium iodide staining. The samples were analyzed with a FACS-Calibur Flow Cytometer (BD Biosciences) using CellQuest Pro software (BD Biosciences). 2.8. Western blotting Cells were harvested 48 hour after transfection and prepared for lysis in radioimmunoprecipitation assay buffer. Protein concentration was determined using the bicinchoninic acid assay. Separated proteins were transferred to polyvinylidene fluoride membrane (Millipore).The membranes were blocked with 5% fat-free milk powder at room temperature for 2 hour, then incubated with primary

antibodies against KLF6 (Santa Cruz, sc-632, USA) or β-actin (ZSGB-BIO, TA-09, China) at 4°C overnight followed by the incubation with the secondary antibody (Southern Biotech, USA) for 1 hour at room temperature. The membranes were developed using an ECL kit (Pierce, Rockford, IL and exposed to X-ray film to visualize the images. Protein expression levels were normalized to those of β-actin.

2.9. Immunohistochemistry A primary antibody against human KLF6 (1:100 dilution; Abcam, USA) was incubated with human ccRCC cancer tissues and corresponding normal tissues.

6

Z. Lei et al. / Urologic Oncology: Seminars and Original Investigations ] (2017) ∎∎∎–∎∎∎

Fig. 3. miR-181a regulated the proliferation of ccRCC cell lines through KLF6. (A and B) Folds change of miR-181a expression in 786-O cells with the transfection of miR-181a mimics and miR-181a inhibitor vs. their negative control (NC). (C) KLF6 mRNA level changes in 786-O cells with the miR-181a mimics and the miR-181a inhibitor transfection versus the negative control (NC). (D and E) Folds change of miR-181a expression in 769-P cells with the transfection of miR-181a mimics and miR-181a inhibitor vs. their negative control (NC). (F) KLF6 mRNA level changes in 769-P cells with the miR-181a mimics and the miR-181a inhibitor transfection vs. the negative control (NC). (G and H) Alteration in the mRNA and protein levels of KLF6 in 786-O cells 48 hours after transfection with KLF6 siRNA or KLF6 vector and their controls (Scr siRNA and empty vector). (I and J) MTS suggested that miR-181a mimics promoted the proliferation of 769-P and 786-O cells, whereas miR-181a inhibitor has the opposite effects. KLF6 siRNA had similar effect of miR-181a mimics, whereas reexpression of KLF6 counteracted the positive proliferative effects of miR-181a mimics in 786-O cells. (Color version of the figure available online.)

Z. Lei et al. / Urologic Oncology: Seminars and Original Investigations ] (2017) ∎∎∎–∎∎∎

Immunostaining for KLF6 protein was analyzed independently by 2 pathologists that were blind to the tissue type.

7

3. Results 3.1. Expression of miR-181a and KLF6 in ccRCC

2.10. Statistical analysis Statistical analysis was performed using SPSS 17.0 software (SPSS Inc., Chicago, IL). The 2-tailed Student’s t-test was used to analyze the difference between 2 groups. Spearman rank correlation analysis was used to identify the correlation between miR-181a expression level and clinicopathological parameters. Correlations between 2 variables were analyzed by linear regression. Data are presented as the mean ± standard deviation of at least three independent experiments. Differences between mean values were considered statistically significant if 2-tailed P o 0.05.

To understand the role of miR-181a in human ccRCC, we examined its expression level by using qRT-PCR in ccRCC samples and adjacent normal tissues obtained from 42 cancer patients. As shown in Fig. 1A, miR-181a level was significantly up-regulated in ccRCC tissues compared with its content in corresponding normal tissues (P o 0.001). Moreover, mir-181a expression was also up-regulated in 786-O, 769-P, CAKI-1, and A498 ccRCC cell lines compared to its level in HKC cells (Fig. 1B, P o 0.001). We then investigated correlations between miR-181a expression and clinicopathological features in patients with ccRCC (Table 2). We found that miR-181a

Fig. 4. miR-181a regulated the colony formation of ccRCC cell lines though KLF6. (A) miR-181a mimics promoted the colony formation and miR-181a inhibitor inhibited that in 769-P cells. (B) miR-181a mimics and KLF6 si promoted the colony formation and miR-181a inhibitor inhibited that in 786-O cells, however, reexpression of KLF6 antagonized the effects of miR-181a mimics. (Color version of the figure available online.)

8

Z. Lei et al. / Urologic Oncology: Seminars and Original Investigations ] (2017) ∎∎∎–∎∎∎

Fig. 5. miR-181a regulated the cell cycle progression in ccRCC 769-P cell line. Representative photographs of flow cytometric analysis of cell cycle distribution were used to show that miR-181a mimics promoted the G1-S transition and miR-181a inhibitor induced a significant accumulation of cells in G1phase and blocks G1-S entry in 769-P cells compared with NC group. (Color version of the figure available online.)

expression level significantly correlated with tumor size (P ¼ 0.015), tumor necrosis (P ¼ 0.023), Fuhrman grade (P ¼ 0.002), and TNM staging (P o 0.001), but not with age (P ¼ 0.092), sex (P ¼ 0.414), or body mass index (P ¼ 0.423). KLF6 expression was also analyzed at mRNA and protein levels by qRT-PCR and western blotting, respectively. As shown in Fig. 1C, KLF6 mRNA expression was significantly down-regulated in ccrRCC tissues compared to its level in matched normal tissues (P o 0.001). Expression of KLF6 protein was also down-regulated in ccRCC (Fig. 1G and H; P o 0.001). Immunohistochemistry results revealed that the number of KLF6-positive cells in ccRCC tissues was lower than in corresponding normal tissues (Fig. 1E and F; P o 0.001). Moreover, we also found that there was a negative correlation between miR-181a and KLF6 mRNA levels (Fig. 1D; r2 ¼ 0.091, P o 0.01). These results suggested that miR-181a may act as an oncogene, whereas KLF6 may be a tumor suppressor in ccRCC.

3.2. miR-181a inhibited KLF6 expression by targeting its 3′-UTR We used Target Scan (http://genes.mit.edu/targetscan/), PicTar (http://pictar.mdc-berlin.de/), and miRanda (http:// cbio.mskcc.org/cgi-bin/mirnaviewer/mirnaviewer.pl) to determine mRNA targets of mir-181a. All these programs predicted that KLF6 could be a target of miR-181a and revealed that miR-181a binding sites could localize to the

3′-UTR (Fig. 2A). To confirm that KLF6 is indeed a direct target of miR-181a, KLF6 3′-UTR containing putative miR181a binding sites was cloned into the psiCHECK-2 plasmid (KLF63′-UTR-WT). In addition, we also constructed reporter plasmids in which the 2 potential binding sites of miR-181a were mutated individually (MUT-1 and MUT-2) or together (MUT-3; Fig. 2B). Then, HEK 293T cells transfected with these constructs as well as with miR181a mimic or NC were examined in dual-luciferase assays. We observed that up-regulation of miR-181a strongly decreased luciferase activity of WT reporter group, whereas luciferase activity of MUT-1, MUT-2, and MUT-3, bearing mutated KLF6 3′-UTR, did not change (Fig. 2C). Next, we performed qRT-PCR and western blot experiments to examine if miR-181a affected expression of KLF6 mRNA and protein, respectively. As shown in Fig. 2D and E, KLF6 mRNA and protein levels were significantly decreased in 786-O and 769-P cells transfected with miR-181a mimics compared with the respective levels in NC group. These results suggested that miR-181a inhibited KLF6 expression by directly targeting the 3′-UTR sequence of the KLF6 gene.

3.3. miR-181a promotes cell proliferation and colony formation in ccRCC cell lines To investigate biological function of miR-181a in ccRCC, 780-O and 769-P cells were transfected with

Z. Lei et al. / Urologic Oncology: Seminars and Original Investigations ] (2017) ∎∎∎–∎∎∎

9

Fig. 6. miR-181a regulated the cell cycle progression in ccRCC 786-O cell line. Representative photographs of Flow cytometric analysis of cell cycle distribution were used to show that miR-181a mimics and KLF6 si promoted the G1-S transition and miR-181a inhibitor induced cell cycle arrest in 786-O cells. Reexpression of KLF6 partly abrogated the effect of miR-181a dependent G1-S transition in 786-O cells. (Color version of the figure available online.)

chemically synthesized miR-181a mimic or miR-181a inhibitor. Transfection efficiency was confirmed by qRTPCR (Fig. 3A, B, D, and E). We found miR-181a mimic decreased, whereas miR-181a inhibitor increased KLF6 mRNA level in 780-O and 769-P cells (Fig. 3C and F). MTS assays showed that proliferation rate of 780-O and 769-P cells transfected with miR-181a mimic was

significantly increased compared with that of cells in NC group. In contrast, proliferation of cells transfected with mir-181a inhibitor was significantly inhibited (Fig. 3I and G). Furthermore, the clone formation assay demonstrated that miR-181a mimic promoted clone formation processes, whereas miR-181a inhibitor decreased clonogenicity in in 786-O and 769-P cells (Fig. 4A and B).

Z. Lei et al. / Urologic Oncology: Seminars and Original Investigations ] (2017) ∎∎∎–∎∎∎

10

Table 3 miR-181a regulated the cell cycle progression in ccRCC 769-P cell line Group

miR-181a mimics

NC

miR-181a inhibitor

G1, % S, % G2, %

48.24 41.89 9.87

60.75 30.31 18.94

78.48 18.13 3.39

3.4. miR-181a promotes cell cycle progression and inhibits apoptosis in ccRCC cell lines Cell cycle analysis by flow cytometry showed that transfection with miR-181a mimic caused significant accumulation of 786-O and 769-P cells in the S-phase, whereas the proportion of cells in the G1 phase decreased. Transfection of cells with the mir-181a inhibitor led to the opposite result, as the number of cells in the S-phase decreased, whereas the proportion of treated cells in the G1phase increased in comparison with respective proportions of cells in NC group (Figs. 5 and 6; Tables 3 and 4). We also found that apoptosis rate in 786-O and 769-P cells transfected with miR-181a mimic was significantly lower than in NC cells. In contrast, transfection with miR-181a inhibitor promoted apoptosis in 786-O and 769-P cells (Figs. 7 and 8; Tables 5 and 6). These results suggested that miR-181a promoted cell cycle G1/S transition and inhibited apoptosis in ccRCC cells. 3.5. miR-181a exerts its biological effects via modulating KLF6 levels in ccRCC To verify whether oncogene effect of miR-181a was mediated through the modulation of KLF6 levels, we performed genetic rescue experiments in 786-O cells. We used KLF6 si-RNA to knockdown KLF6 expression and also constructed a KLF6 vector to enhance KLF6 levels. Efficiency of transfection was verified by qRT-PCR and western blotting. Exposure to KLF6 si-RNA decreased (P = 0.0013), whereas transfection with KLF6 vector increased (P = 0.006) KLF6 mRNA and protein levels in 786-O cells (Fig. 3G and H). We found that knockdown of KLF6 had effects on cell proliferation, colony formation, cell cycle progression, and cell apoptosis similar to those observed in 786-O cells transfected with miR-181a mimic (Figs. 3G, 4B, 6 and 8; Tables 4 and 6). Then, miR-181a and KLF6 vector were cotransfected in 786-O cells. We found that restored expression of KLF6 partly abrogated the Table 4 miR-181a regulated the cell cycle progression in ccRCC 786-O cell line Group miR181a mimics

NC

miRScr KLF6 miRmiR-181a 181a siRNA siRNA 181a þempty inhibitor þKLF6 vector

G1, % 47.42 S, % 42.38 G2, % 10.19

55.71 67.47 33.04 22.47 11.26 10.05

56.61 31.66 11.73

49.41 40.46 10.13

46.75 35.84 17.41

50.12 41.74 8.14

effect of miR-181a on cell proliferation, colony formation, cell cycle progression, and cell apoptosis in 786-O cells (Figs. 3G, 4B, 6 and 8; Tables 4 and 6). These results revealed that miR-181a acts as a tumor oncogene, whereas KLF6 may be a tumor suppressor in ccRCC. In addition, it is plausible that miR-181a regulates cell functions through its effect on KLF6 expression in ccRCC. Then, we explored potential molecular mechanisms whereby cell proliferation, apoptosis, and cell cycle progression could be affected by miR-181a in ccRCC. We transfected 786-O and 769-P cells with miR-181a mimic or NC and demonstrated by western blotting that up-regulation of miR-181a decreased protein levels of KLF6 and p21, whereas expression levels of EGFR, cyclin D1, CDK4, and Bcl-2 were significantly increased in miR-181a mimic group compared with those in NC group (Fig. 9). These results indicated possible signaling pathways that could mediate miR-181a effects on proliferation, apoptosis, and cell cycle progression.

4. Discussion Despite latest advancements in treatment options, ccRCC remains one of the most common causes of cancer-related deaths. Therefore, identification of relevant biomarkers is an urgent priority in efforts to improve RCC diagnosis, prognosis, and prediction of treatment response that would ultimately result in better patient outcomes. Recent advances have revealed that aberrant expression of cancer-specific miRNAs and their targets plays an important role in tumorigenesis of human malignancies, including ccRCC. The results of genome-wide expression profiling of mRNAs using microarray analysis of matched cancer tissue samples and their corresponding normal tissues have identified dozens of overexpressed and downregulated mRNAs between groups [23,24]. Recently, many studies have shown that dysregulation of miRNA levels, for example, up-regulated expression of miR-21 and miR-221 or downregulated expression of miR-141, caused profound effects on cell proliferation, cell cycle progression, apoptosis, and metastasis of ccRCC [25–27]. It is, therefore, plausible that deranged expression of many other miRNAs affects tumorigenesis and progression in ccRCC. Mir-181a, a member of the miR-181 family,has been well investigated in many human cancers.Previous studies have shown that abnormal expression of miR-181a was correlate with diverse biological functions, including proliferation, migration, invasion, and cell cycle progression [28]. Sun et al. [29] found that miR-181a was a hypoxiaregulated mRNA that was overexpressed in human chondrosarcoma. Authors found that hypoxia and transfection with HIF-1α increased miR-181a expression and also promoted the expression of VEGF mRNA and protein. Those results also suggested that miR-181a could be a critical factor in ccRCC tumorigenesis [30]. Zou et al. [31]

Z. Lei et al. / Urologic Oncology: Seminars and Original Investigations ] (2017) ∎∎∎–∎∎∎

11

Fig. 7. miR-181a inhibited the cell apoptosis in ccRCC 769-P cell line by KLF6. Representative photographs of flow cytometric analysis of cell apoptosis. Results showed that miR-181a mimics decreased and miR-181a inhibitor increased the total percentage of early apoptotic cells and late apoptotic/necrotic cells significantly compared with NC group in 769-P cells. (Color version of the figure available online.)

reported that up-regulated mRNA-181a promoted carcinogenesis in hepatitis B virus-related hepatocellular carcinoma by targeting E2F5. Furthermore, Azumi et al. [32] found that miR-181a induced sorafenib resistance of HCC cells through the down-regulation of RASSF1 expression. In addition, miR-181a has been reported to play oncogenic functions in several other cancers, including colorectal cancer, breast cancer, gastric cancer, multiple myeloma, and pancreatic cancer [33–37]. Verduci et al. [38] found that miR-181a enhanced G1/S transition and cell proliferation in pediatric acute myeloid leukemia by regulating EGR1 expression. Mi et al. [39] found that ectopic expression or silencing of miR-181a-5p, respectively, promoted or inhibited GC cell proliferation, colony formation and cell cycle transition, as well as enhanced or prevented the invasion, metastasis of GC cells and epithelial to mesenchymal transition of GC cells in vitro and in vivo by activating the RASSF6-regulated MAKP pathway in gastric cancer. However, the role of miR-181a in ccRCC has not been evaluated. For the first time, we demonstrate that miR-181a was upregulated in ccRCC tissues and cell lines. We also found that expression of miR-181a significantly correlated with tumor size, TNM staging, Fuhrman grade, and necrosis, but not with sex, age, or body mass index. These results suggest that miR-181a may act as a tumor-promoting gene in ccRCC and our results are consistent with the earlier studies.

However, it should be pointed out that the role of miR181a in human malignancies is still controversial and likely varies, depending on the tumor type and even cellular context. miR-181a is also regarded as a tumor suppressor in several other types of tumors. In nonsmall cell lung cancer (NSCLC), Cao et al. [40] found miR-181a-5p expression was downregulated and miR-181 attenuated tumor cell proliferation and migration through VCAM-1, predicting a potential way for counteracting cancer metastasis. miR181a was also found to be down-regulated in nonsmall-cell lung cancer and the extent of its down-regulation correlated directly with poor patient survival rate [41]. Lower level of miR-181a was also observed in oral squamous cell carcinoma, and the oncogene KRAS was suggested to be a target of miR-181a [42]. In chronic lymphocytic leukemia, downregulation of miR-181a is strongly associated with trisomy 12 and is a determinant of disease aggressiveness [43]. In line with that notion, the lower level of miR-181a in CLL (chronic lymphocytic leukemia) samples was associated with significant overexpression of pleomorphic adenoma gene 1 oncoprotein [44]. Apparent discrepancies in the roles attributed to miR-181a in human cancers are likely explained by variation of tumor types, distinct cellular contexts, and different target genes and affected signaling pathways. In our present study, we found that miR-181a overexpression promoted proliferation and G1/S transition apoptosis in ccRCC 786-O and 769-P cells, and inhibited their apoptosis. In our further experiments aimed at

Z. Lei et al. / Urologic Oncology: Seminars and Original Investigations ] (2017) ∎∎∎–∎∎∎

12

Fig. 8. miR-181a inhibited the cell apoptosis in ccRCC 786-O cell line by KLF6. Representative photographs of flow cytometric analysis of cell apoptosis were used to show that miR-181a mimics and KLF6 si decreased the total percentage of early apoptotic cells and late apoptotic/necrotic cells, whereas miR181a inhibitor showed the opposite effect in 786-O cells. Re-expression of KLF6 partly abrogated the effect of miR-181a dependent cell apoptosis inhibition. Data represent the mean ± SD. (Color version of the figure available online.)

Table 5 miR-181a inhibited the cell apoptosis in ccRCC 769-P cell line by KLF6 Group

miR-181a mimics

NC

miR-181a inhibitor

UL, % UR, % LL, % LR, %

2.94 2.54 93.45 1.05

1.55 3.86 85.59 9.00

2.53 10.01 79.67 7.78

identification of the mechanisms underlying miR-181a effects in ccRCC, we found that KLF6 was a direct target of miR-181a. We also found firstly that KLF6 was down-regulated in ccRCC tissues, and its level was negatively related to that of miR-181a. Up-regulation of miR-181a significantly repressed KLF6 expression at both mRNA and protein levels. The results of the luciferase reporter assay suggested that miR-181a could bind to the

Z. Lei et al. / Urologic Oncology: Seminars and Original Investigations ] (2017) ∎∎∎–∎∎∎

13

Table 6 miR-181a inhibited the cell apoptosis in ccRCC 786-O cell line by KLF6 Group

miR-181a mimics

NC

miR-181a inhibitor

Scr siRNA

KLF6 siRNA

miR-181a þKLF6

miR-181a þ empty vector

UL, % UR, % LL, % LR, %

2.18 2.36 92.30 3.16

1.84 6.96 84.13 7.08

6.86 13.28 71.77 8.08

3.77 3.74 89.34 3.16

4.59 5.49 83.84 6.08

1.54 9.01 83.68 5.57

1.81 3.62 92.32 2.24

target sequence of WT KLF6 3′-UTR but not of MUT KLF6 3′-UTR. Then, we performed functional rescue analysis of KLF6 in 786-O cells and found that overexpression of KLF6 reduced cell proliferation and induced apoptosis, which was similar to the effects observed following miR-181a knockdown. In contrast, KLF6 siRNA rescued the effects of miR-181a inhibitor on cell growth and apoptosis. In addition, restored expression of KLF6 in cells transfected with miR-181a mimic attenuated the tumor-promoting effect of miR-181a. These results suggest that miR-181a promotes tumor growth in ccRCC by directly targeting the tumor suppressor KLF6. KLF6 is an antitumor protein that belongs to the KLF zinc finger DNA-binding protein family. KLF6 has been regarded as an important tumor suppressor in various human cancers. Several studies have found that KLF6 is down-regulated in prostate cancer, colorectal cancer, and hepatocellular carcinoma, where its tumor suppressive properties are mediated through attenuated activation of the EGFR/Akt pathway or via p21-mediated expression of cyclin D1/CDK4 [45–47]. Cheng et al. [48] found that overexpression of KLF6 inhibited growth of RCC cell lines, up-regulated p21 in a p53-independent manner, and induced

cell apoptosis. In our study, we found that miR-181a decreased the expression of KLF6 and p21, but increased expression levels of EGFR, cyclin D1, CDK4, and Bcl-2. These observations were consistent with the results of previous studies and suggested potential mechanisms of miR-181a and KLF6 effects on biological functions of ccRCC cells. Gao et al. found that KLF6 downregulation promoted epithelial-mesenchymal transition and metastatic transformation and established the significance of KLF6-E2F1 axis activation in aggressive ccRCC, suggesting that KLF6 was a novel critical factor that drives human ccRCC invasion and metastasis [49]. However, precise roles of KLF6 in ccRCC and molecular mechanisms underlying its effects in cancer cells will require further studies. In conclusion, our present study demonstrated that miR-181a was up-regulated in ccRCC tissues and RCC cell lines. Exposure to miR-181a promoted cell proliferation, accelerated cell cycle transition, and inhibited apoptosis of ccRCC cells by targeting tumor suppressor KLF6. The present results reveal a novel molecular role of miR-181a in ccRCC tumorigenesis and indicate that miR-181a may be a potential therapeutic target for ccRCC treatment.

Fig. 9. Western blot analysis of EGFR, cell cycle and apoptosis protein expression in ccRCC cells. miR-181a mimics increased the protein expression levels of EGFR, cyclin D1, CDK4, and Bcl-2 whereas decreased the protein expression levels of KLF6 and p21 in 786-O and 769-P cells compared with NC group. Data represent the mean ± SD.

14

Z. Lei et al. / Urologic Oncology: Seminars and Original Investigations ] (2017) ∎∎∎–∎∎∎

References [1] Hsieh JJ, Purdue MP, Signoretti S, Swanton C, Albiges L, Schmidinger M, et al. Renal cell carcinoma. Nat Rev Dis Primers 2017;3:17009. [2] Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer J Clin 2013;63(1):11–30. [3] Rini BI, Campbell SC, Escudier B. Renal cell carcinoma. Lancet 2009 March 28;373(9669):1119–32. [4] Greef B, Eisen T. Medical treatment of renal cancer: new horizons. Br J Cancer 2016;115(5):505–16. [5] Siska PJ, Beckermann KE, Rathmell WK, Haake SM. Strategies to overcome therapeutic resistance in renal cell carcinoma. Urol Oncol 2017;35:102–10. [6] Ljungberg B, Bensalah K, Canfield S, Dabestani S, Hofmann F, Hora M, et al. EAU guidelines on renal cell carcinoma: 2014 update. Eur Urol 2015;67:913–24. [7] Linehan WM, Ricketts CJ. Kidney cancer in 2016: RCC—advances in targeted therapeutics and genomics. Nat Rev Urol 2017;14:76–8. [8] Oudard S, Vano Y. The role of rechallenge with targeted therapies in metastatic renal-cell carcinoma. Curr Opin Urol 2015;25:402–10. [9] Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004;116:281–97. [10] Carrington JC, Ambros V. Role of microRNAs in plant and animal development. Science 2003;301:336–8. [11] Rupaimoole R, Slack FJ. MicroRNA therapeutics: towards a new era for the management of cancer and other diseases. Nat Rev Drug Discov 2017;16:203–22. [12] Jafri MA, Al-Qahtani MH, Shay JW. Role of miRNAs in human cancer metastasis: implications for therapeutic intervention. Semin Cancer Biol 2017 Jun;44:117–31. [13] Jamali Z, Asl Aminabadi N, Attaran R, Pournagiazar F, Ghertasi Oskouei S, Ahmadpour F. MicroRNAs as prognostic molecular signatures in human head and neck squamous cell carcinoma: a systematic review and meta-analysis. Oral Oncol 2015;51:321–31, http: //dx.doi.org/10.1016/j.oraloncology.2015.01.008. Epub February 9, 2015. [14] Li Y, Kuscu C, Banach A, Zhang Q, Pulkoski-Gross A, Kim D, et al. miR-181a-5p inhibits cancer cell migration and angiogenesis via downregulation of matrix metalloproteinase-14. Cancer Res 2015;75: 2674–85. [15] Lyu X, Li J, Yun X, Huang R, Deng X, Wang Y, et al. miR-181a-5p, an inducer of Wnt-signaling, facilitates cell proliferation in acute lymphoblastic leukemia. Oncol Rep 2017;37:1469–76. [16] Zhang P, Guo Z, Hu R, He X, Jiao X, Zhu X. Interaction between microRNA-181a and TNFAIP1 regulates pancreatic cancer proliferation and migration. Tumour Biol 2015;36:9693–701. [17] Li Y, Kuscu C, Banach A, Zhang Q, Pulkoski-Gross A, Kim D, et al. miR-181a-5p inhibits cancer cell migration and angiogenesis via downregulation of matrix metalloproteinase-14. Cancer Res 2015;75:2674–85. [18] Tetreault MP, Yang Y, Katz JP. Krüppel-like factors in cancer. Nat Rev Cancer 2013;13:701–13. [19] Lu XJ, Shi Y, Chen JL, Ma S. Krüppel-like factors in hepatocellular carcinoma. Tumour Biol 2015;36:533–41. [20] Benzeno S, Narla G, Allina J, Cheng GZ, Reeves HL, Banck MS, Odin JA, et al. Cyclin-dependent kinase inhibition by the KLF6 tumor suppressor protein through interaction with cyclin D1. Cancer Res 2004;64:3885–91. [21] Sangodkar J1, Shi J, DiFeo A, Schwartz R, Bromberg R, Choudhri A. Functional role of the KLF6 tumour suppressor gene in gastric cancer. Eur J Cancer 2009;45:666–76. [22] Liu X, Gomez-Pinillos A, Loder C, Carrillo-de Santa Pau E, Qiao R, Unger PD, et al. KLF6 loss of function in human prostate cancer progression is implicated in resistance to androgen deprivation. Am J Pathol 2012;181:1007–16. [23] Yi Z, Fu Y, Zhao S, Zhang X, Ma C. Differential expression of miRNA patterns in renal cell carcinoma and nontumorous tissues. J Cancer Res Clin Oncol 2010;136:855–62.

[24] Juan D, Alexe G, Antes T, Liu H, Madabhushi A, Delisi C, Ganesan S, Bhanot G, Liou LS. Identification of a microRNA panel for clearcell kidney cancer. Urology 2010;75:835–41. [25] Gao Y, Ma X, Yao Y, Li H, Fan Y, Zhang Y, et al. miR-155 regulates the proliferation and invasion of clear cell renal cell carcinoma cells by targeting E2F2. Oncotarget 2016;7:20324–37. [26] Teixeira AL, Ferreira M, Silva J, Gomes M, Dias F, Santos JI, et al. Higher circulating expression levels of miR-221 associated with poor overall survival in renal cell carcinoma patients. Tumour Biol 2014;35:4057–66. [27] Chen X, Wang X, Ruan A, Han W, Zhao Y, Lu X, et al. miR-141 is a key regulator of renal cell carcinoma proliferation and metastasis by controlling EphA2 expression. Clin Cancer Res 2014;20:2617–30. [28] Seoudi AM, Lashine YA, Abdelaziz AI. MicroRNA-181a—a tale of discrepancies. Expert Rev Mol Med 2012;14:e5. [29] Sun X1, Wei L, Chen Q, Terek RM. MicroRNA regulates vascular endothelial growth factor expression in chondrosarcoma cells. Clin Orthop Relat Res 2015;473:907–13. [30] Shen Chuan, Kaelin William G Jr. The VHL/HIF axis in clear cell renal carcinoma. Semin Cancer Biol 2013;23:18–25. [31] Zou C, Li Y, Cao Y, Zhang J, Jiang J, Sheng Y, et al. Up-regulated MicroRNA-181a induces carcinogenesis in hepatitis B virus-related hepatocellular carcinoma by targeting E2F5. BMC Cancer 2014; 14:97. [32] Azumi J, Tsubota T, Sakabe T, Shiota G. miR-181a induces sorafenib resistance of hepatocellular carcinoma cells through downregulation of RASSF1 expression. Cancer Sci 2016;107:1256–62. [33] Ji D, Chen Z, Li M, Zhan T, Yao Y, Zhang Z, et al. MicroRNA-181a promotes tumor growth and liver metastasis in colorectal cancer by targeting the tumor suppressor WIF-1. Mol Cancer 2014;13:86. [34] Bisso A, Faleschini M, Zampa F, Capaci V, De Santa J, Santarpia L, et al. Oncogenic miR-181a/b affect the DNA damage response in aggressive breast cancer. Cell Cycle 2013;12:1679–87. [35] Mi Y, Zhang D, Jiang W, Weng J, Zhou C, Huang K, et al. miR-181a-5p promotes the progression of gastric cancer via RASSF6-mediated MAPK signalling activation. Cancer Lett 2017;389: 11–22. [36] Peng J, Thakur A, Zhang S, Dong Y, Wang X, Yuan R, et al. Expressions of miR-181a and miR-20a in RPMI8226 cell line and their potential as biomarkers for multiple myeloma. Tumour Biol 2015;36:8545–52. [37] Zhang P, Guo Z, Hu R, He X, Jiao X, Zhu X. Interaction between microRNA-181a and TNFAIP1 regulates pancreatic cancer proliferation and migration. Tumour Biol. 2015 Dec;36(12):9693–701. [38] Verduci L, Azzalin G, Gioiosa S, Carissimi C, Laudadio I, Fulci V, et al. microRNA-181a enhances cell proliferation in acute lymphoblastic leukemia by targeting EGR1. Leuk Res 2015;39:479–85. [39] Mi Y, Zhang D, Jiang W, Weng J, Zhou C, Huang K,, et al. miR181a-5p promotes the progression of gastric cancer via RASSF6mediated MAPK signalling activation. Cancer Lett. 2017 Mar 28;389:11–22. [40] Cao Y, Zhao D, Li P, Wang L, Qiao B, Qin X, et al. MicroRNA181a-5p impedes IL-17-induced nonsmall cell lung cancer proliferation and migration through targeting VCAM-1. Cell Physiol Biochem 2017;42:346–56. [41] Gao W, Yu Y, Cao H, Shen H, Li X, Pan S, Shu Y. Deregulated expression of miR-21, miR-143 and miR-181a in non small cell lung cancer is related to clinicopathologic characteristics or patient prognosis. Biomed Pharmacother 2010;64(6):399–408. [42] Shin KH1, Bae SD, Hong HS, Kim RH, Kang MK, Park NH. miR-181a shows tumor suppressive effect against oral squamous cell carcinoma cells by downregulating K-ras. Biochem Biophys Res Commun 2011;404:896–902. [43] Visone R, Rassenti LZ, Veronese A, Taccioli C, Costinean S, Aguda BD. Karyotype-specific microRNA signature in chronic lymphocytic leukemia. Blood 2009;114:3872–9.

Z. Lei et al. / Urologic Oncology: Seminars and Original Investigations ] (2017) ∎∎∎–∎∎∎ [44] Pallasch CP, Patz M, Park YJ, Hagist S, Eggle D, Claus R, et al. miRNA deregulation by epigenetic silencing disrupts suppression of the oncogene PLAG1 in chronic lymphocytic leukemia. Blood 2009;114:3255–64. [45] Narla G1, DiFeo A, Yao S, Banno A, Hod E, Reeves HL, et al. Targeted inhibition of the KLF6 splice variant, KLF6 SV1, suppresses prostate cancer cell growth and spread. Cancer Res 2005;65:5761–8. [46] Reeves HL1, Narla G, Ogunbiyi O, Haq AI, Katz A, Benzeno S, et al. Kruppel-like factor 6 (KLF6) is a tumor-suppressor gene frequently inactivated in colorectal cancer. Gastroenterology 2004;126:1090–103.

15

[47] Kremer-Tal S1, Reeves HL, Narla G, Thung SN, Schwartz M, Difeo A, et al. Frequent inactivation of the tumor suppressor Kruppel-like factor 6 (KLF6) in hepatocellular carcinoma. Hepatology 2004;40: 1047–52. [48] Cheng XF, Li D, Zhuang M, Chen ZY, Lu DX, Hattori T. Growth inhibitory effect of Krüppel-like factor 6 on human prostatic carcinoma and renal carcinoma cell lines. Tohoku J Exp Med 2008;216:35–45. [49] Gao Y, Li H, Ma X, Fan Y, Ni D, Zhang Y, et al. KLF6 suppresses metastasis of clear cell renal cell carcinoma via transcriptional repression of E2F1. Cancer Res 2017;77:330–42.