mTOR pathway in mice with rheumatoid arthritis

International Immunopharmacology 79 (2020) 106067

Contents lists available at ScienceDirect

International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp

Up-regulation of miR-365 promotes the apoptosis and restrains proliferation of synoviocytes through downregulation of IGF1 and the inactivation of the PI3K/AKT/mTOR pathway in mice with rheumatoid arthritis

T

Xiaojun Wanga,1, Sha Gongb,1, Dan Puc, Nan Huc, Yanhua Wangc, Ping Fanc, Jing Zhangc, ⁎ Xiaohong Luc, a b c

Department of Hematology and Rheumatology, AnKang Hospital of Traditional Chinese Medicine, AnKang, Shaanxi 725000, China Department of Hematology, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, Shaanxi 710061, China Department of Rheumatology, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, Shaanxi 710061, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Rheumatoid arthritis MicroRNA-365 IGF1 PI3K/AKT/mTOR pathway Synoviocytes Apoptosis

Background: There is growing evidence of the ability of microRNAs (miRs) in rheumatoid arthritis (RA), thus our objective was to discuss the impact of miR-365 on the apoptosis and proliferation of synoviocytes in mice with RA by targeting IGF1 and mediating the PI3K/AKT/mTOR pathway. Methods: RA model mice was induced by type II collagen and freund’s adjuvant. The successfully modeled mice were injected with normal saline, miR-365 mimics, miR-365 inhibitors or their controls. TUNEL assay was adopted to detect apoptosis in synovial tissues, and expression of IL-1β and IL-6 in serum and synovial tissues was measured by ELISA and RT-qPCR. Mouse synoviocytes were isolated and cultured in vitro and identified by experiments. Cells were transfected with miR-365 mimics, IGF1 siRNA, or their controls to verify the role of miR365 and IGF1 in cell vitality, proliferation and apoptosis of synoviocytes. Results: Upregulation of miR-365 increased the number of TUNEL positive cells, depressed arthritis index, X-ray imaging score, and the expression of IL-1β and IL-6. High expression of miR-365 and low expression of IGF1 restrained the proliferation and facilitated apoptosis of synoviocytes. MiR-365 inhibited the expression of IGF1 and inhibited the activation of the PI3K/AKT/mTOR pathway. Conclusion: Our study presents that up-regulation of miR-365 drives on apoptosis and restrains proliferation of synoviocytes in RA through downregulation of IGF1 and the inhibition of the PI3K/AKT/mTOR pathway. Thus, miR-365 may be a potential candidate for treatment of RA.

1. Introduction As a chronic systematics autoimmune disease, rheumatoid arthritis (RA) is characterized as synovial hyperplasia and joint destruction mediated by inflammatory cytokines [1]. On the basis of the statistics of World Health Organization, RA’s global incidence accounts for 0.5–1% of the total population, as well as the disability rate is 61.3% over the course of 15 years [2]. Evidence has shown that innate various cells, gene variants, environmental risk factors and immune system could contribute to the risk of RA [3]. Patients with RA often experience stiffness, fatigue and chronic joint pain, work disorders, health-related quality of life impairment, disability and premature death [4]. The intensity of RA is determined using a disease activity score. In this scale,

pain intensity rate in clinical examination (physical assessment) and erythrocyte sedimentation rate (ESR) were used [5]. At the terminal stage of the disease, the only remedy for joint injury in RA is replacing the damaged joint through surgical or joint fusion [6]. Therefore, seeking for an effective and safe strategy for RA is the focus of this study. MicroRNAs (miRNAs) are responsible for monitoring gene expression through the 3′untranslated region (3′UTR) of the target mRNAs [7]. A previous study has reported that in plasma or serum of RA patients, a group of miRNAs in peripheral blood raised and take part in the pathogenesis of RA [8]. Located in chromosome region 16p13.12, miR365 has been found in colon cancer, pancreatic cancer and lung cancer [9–11], which is deemed to be an inhibitor of many kinds of cancers

⁎

Corresponding author at: Department of Rheumatology, The First Affiliated Hospital of Xi’an Jiaotong University, 277 Yanta West Road, Xi’an, Shaanxi 710061, China. E-mail address: [email protected] (X. Lu). 1 They are co-first authors. https://doi.org/10.1016/j.intimp.2019.106067 Received 17 July 2019; Received in revised form 11 October 2019; Accepted 18 November 2019 1567-5769/ © 2019 Elsevier B.V. All rights reserved.

International Immunopharmacology 79 (2020) 106067

X. Wang, et al.

inhibitors NC and miR-365 inhibitors were packed and composed by Shanghai Genechem Co., Ltd. (Shanghai, China).

[12]. It has been suggested previously that miR-15b can inhibit the proliferation of chondrocytes by targeting type-1 insulin like growth factor (IGF1) [13]. IGF-1 has great effects on bone growth and remodeling by advancing the synthesis and repressing the degradation of extracellular matrix. It can promote the replication of osteoblasts and the production of type I collagen, the main bone matrix component, and inhibit the degradation of bone collagen stimulated by cytokines by specific collagenase [14]. There is an article finding that hippocampal inflammation affects IGF1 receptor signal transduction and contributes to the neurosequelae of RA [15]. Also, a recent study has provided a proof that many different miRNAs expression can serve a role in adapting to a particular training regimen by the regulation of the IGF1/ the phosphatidylinositol 3-kinase (PI3K)/Protein kinase B (AKT)/ mammalian target of rapamycin (mTOR) axis [16]. PI3K/AKT/mTOR signaling pathway takes part in the occurrence and growth of various inflammation [17]. Another study has verified that metformin suppressed proliferation of fibroblast-like synoviocytes in RA by means of IGF-IR/PI3K/AKT/mTOR pathway [18]. Thus, the objective of this study was to examine the impact of miR-365 targeting IGF1-mediated PI3K/AKT/mTOR pathway on the apoptosis and joint function of synoviocytes in mice with RA.

2.3. Inflammatory score of mice Arthritis symptoms were evaluated on the 7th day after tail vein injection in each group. The evaluation of arthritis symptoms included the measurement of paw thickness and the score of arthritis. Arthritis grading system: normal, 0 point; mild but definite redness and inflammation of wrist or ankle, 1 point; moderate redness and inflammation of wrist or ankle, 2 points; severe redness of the whole claw including toes, 3 points; the greatest degree of redness and swelling involving multiple joints and limbs, 4 points. The scores of four paws were added to the total score of arthritis in mice. 2.4. Evaluation of synovial imaging Two mice in each group were randomly selected for imaging evaluation of double hindfoot films. Coronal imaging was performed on micro-CT with a resolution of 30 μm, a visual field of 54.6 mm × 27.4 mm, with a thickness of 29.86 μm, a interval of 29.86 μm and a scan time of 28 min and 18 s. Inveon Acquisition Workplace software was used for image processing. Radiologic score standards: 0 point: no bone damage; 1 point: tissue enlargement; 2 points: joint erosion; 3 points: bone erosion and osteophyte formation. Each mouse was examined by imaging examination of double hindfoot. The total imaging score of double hindfoot was the total imaging score of the mouse.

2. Materials and methods 2.1. Ethics statement All animal experiments were in line with the Guide for the Care and Use of Laboratory Animal by International Committees of The First Affiliated Hospital of Xi’an Jiaotong University.

2.5. Synovial tissue extraction and preparation 2.2. Animal experiment grouping and modeling After imaging evaluation of mice in each group, 1% pentobarbital sodium (0.5 mL) was injected into the abdominal cavity of mice, and blood samples were taken from carotid artery. All mice were euthanized within 3 min. The abdomen of the euthanized mice was placed horizontally in the operation tray, the posterior limbs were sterilized, the thigh skin and muscle were cut open with aseptic surgical instruments, and then replaced a set of aseptic instruments to remove the muscles, blood vessels, nerves and fascia attached to the joint. The knee joint of lower extremity was exposed, the whole joint was cut off with large scissors, and some of the synovial tissues were washed with aseptic phosphate buffered saline (PBS) at 4 °C. The synovial tissue of the joint was immersed in 4% paraformaldehyde, then embedded in paraffin and sliced, with the thickness of 5 μm, and the specimens were stained with hematoxylin-eosin (HE). The other part of synovial tissues were selected for examination by an electron microscope, reverse transcription quantitative polymerase chain reaction (RT-qPCR), western blot analysis, as well as the isolation and culture of synoviocytes. The blood was set aside for enzyme-linked immunosorbent assay (ELISA).

Seventy specific pathogen free (SPF) BALB/c mice (Beijing Vital River Laboratory Animal Technology Co., Ltd, Beijing, China; half male and half female), weighting between 15 g and 20 g with 6 weeks of age, were housed in quiet, well-ventilated and clean cages for 1 week. The cage environment was set at 25 ± 2 °C with normal circadian rhythm of water and food intake. Sixty mice were used for RA modeling as follows: Type II collagen (10 mg, Sigma-Aldrich Chemical Company, St Louis, MO, USA) was dissolved in 5 mL 0.1 mol/L acetic acid solution, and the solution was fully dissolved to be Solution A with a concentration of 2 mg/mL by repeated agitation. Solution B with a concentration of 2 mg/mL was made from 5 mL Freund’s Adjuvant (SigmaAldrich Chemical Company, St Louis, MO, USA) and 10 mg Bacille Calmette-Guérin vaccine (BGG, Guangzhou Liantai Biotech Co., Ltd, Guangzhou, China). The two solutions of A and B were mixed and repeatedly pumped with a syringe, so that the mixture was fully emulsified to form a paste-like white emulsion (wherein the concentration of type II collagen and BCG is 1 mg/mL) and was immediately used. The emulsion prepared from the solution A and B was injected subcutaneously at the root of the tail of the mouse, each of which was injected with 0.1 mL. The same drug was injected once every day and have a continuous injection for 7 days, then the same drug was injected in the abdominal cavity for one time at the 8th day, respectively, to enhance the effect of the drug [19]. All mice were operated on a sterile operating table with a sterile device. After the completion of the model establishment, 2 w of the modeled mice continued to be raised to facilitate the full establishment of the RA model. There were 10 mice in the normal group, and then the successful modeled mice were randomly grouped: RA group (injected with 0.1 mL physiological saline), mimics negative control (NC) group (injected with 0.1 mL miR-365 mimics NC), miR-365 mimics group (injected with 0.1 mL miR-365 mimics), inhibitors NC group (injected with 0.1 mL miR-365 inhibitors NC), and miR-365 inhibitors group (injected with 0.1 mL miR-365 inhibitors). After 2 weeks of feeding, the mice were injected intravenously, and the samples were gathered after 7 days. Mimics NC, miR-365 mimics,

2.6. HE staining The paraffin sections prepared by each group of mice were dewaxed and soaked in distilled water, then stained in hematoxylin solution for 10 min, and separated in acid water and ammonia water for 10 s each, then immersed in 70% alcohol and 90% alcohol for 10 min, respectively. Finally, the sections were soaked and dyed in alcohol eosin solution for 3 min. After dehydration with anhydrous alcohol, xylene clearance, and neutral resin sealing, the sections were finally observed by a microscope (Leica, Germany). 2.7. Observation with transmission electron microscopy The synovial tissues of mice was cut into small pieces of 1 mm3. The synovial tissues were fixed with 2.5% glutaraldehyde fixation solution for 3 h by glutaraldehyde-osmitic acid double fixation method. After 2

International Immunopharmacology 79 (2020) 106067

X. Wang, et al.

full washing with buffer, the tissues were fixed with 1% osmitic acid solution for 2 h, dehydrated with gradient acetone, replaced with propylene oxide, embedded with Epon812 epoxy resin and located with ultramicrocut (thickness of 50 nm) by an ultramicrotome, and dyed with lead citrate. Finally, a transmission electron microscope (H-7650, Hitachi, Japan) was utilized to observe the ultrastructure of synovial tissues of mice.

dropped at 37 °C for 1 h, and streptavidin–biotin-peroxidase complex (SABC) was dripped at 37 °C for 30 min. The cells were developed by DAB, rinsed with running tap water for 20 min, and dehydrated with the gradient alcohol. The number of positive cells was observed under a light microscope after xylene clearance and neutral gum sealing.

2.8. Terminal deoxynu-cleotidyl trans/erase (TDT)-mediated dUTP-biotin nick end-labeling (TUNEL) staining

The logarithmic phase synoviocytes were divided into blank group (normal synoviocytes without any transfection), RA group (RA synoviocytes without any treatment), mimics NC (RA synoviocytes transfected with miR-365 mimics NC), miR-365 mimics group (RA synoviocytes transfected with miR-365 mimics), siRNA-NC group (RA synoviocytes transfected with IGF1 NC interference plasmid), IGF1 siRNA group (RA synoviocytes transfected with IGF1 interference plasmid), miR-365 mimics + overexpression (OE)-NC group (RA synoviocytes transfected miR-365 mimics and IGF1 NC overexpression plasmid), and miR-365 mimics + OE-IGF1 group (RA synoviocytes transfected miR-365 mimics and IGF1 overexpression plasmid). Cells were transfected obedience to Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA) specifications. Mimics NC, miR-365 mimics, siRNANC, and IGF1 siRNA were purchased from Shanghai Sangon Biotechnology Co. Ltd. (Shanghai, China).

2.11. Cell grouping

The paraffin embedded knee sections of mice in each group were stained according to TUNEL cell apoptosis in situ detection kit (070711, Nanjing Keygen Biotech CO., LTD, Nanjing, China). The tissue sections were dewaxed with xylene, hydrated with gradient ethanol, and reacted with protein K working solution for 20 min. After PBS washing, the sealing solution was closed for 10 min. The pretreated samples were dripped with 50 μL TdT enzyme reaction solution, and the glass was coated at 37 °C to avoid light for 60 min. Streptavidin-horseradish peroxidase (HRP) working solution (50 μL) was added, the glass was coated at 37 °C to avoid light (30 min), and then 50 μL diaminobenzidine (DAB) working solution was added, the color reaction was carried out, and then observed under an optical microscope. No TdT enzyme was added as an NC. The number of apoptotic cells was observed and reckoned under a microscope, and the apoptosis index (AI) was calculated under a light microscope, each section counted 10 visual fields, each visual field listed 100 cells. AI = apoptotic positive cells/ the total number of cells × 100%.

2.12. 3-(4,5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay The synoviocytes were taken out from the incubator, and the original culture medium was discarded. The synoviocytes suspension (2 × 109 L−1) was prepared with RPMI-1640 culture medium containing 15% FBS, and added to the 96-well culture plate with 100 μL per well, and placed in a 37 °C, 5% CO2 incubator for 24 h. The new culture solution (100 μL) was added after cell adherence. Continued to culture for 6 h, the solution was added with 5 g L−1 MTT solution (10 μL), and then cultured for 6 h, with the supernatant discarded. Afterwards, dimethyl sulfoxide (120 μL) was added, and the absorbance (A) value of each well was taken at 490 nm by the microplate reader, and the result was expressed by means of the mean of the three parallel wells.

2.9. ELISA The expression of IL-1β and IL-6 in serum of mice was checked by ELISA. The collected blood was taken out and the serum was taken after centrifugation. The ELISA kit used in the experiment was purchased from R&D Systems (Minneapolis, MN, USA). The specific steps were as follows: First, the standard curve was established, 8 wells were designed, 100 μL sample diluent was increased to each well, and the eighth well was a blank control. The sample was then added, and the reaction plate was fully mixed and hatched at 37 °C for 2 h. Then the reaction plate was fully cleaned, the primary antibody working solution was supplemented into each well, and the reaction plate was fully mixed and evenly incubated at 37 °C for 1 h. The plate was cleaned again, then the substrate working solution was added to each well and incubated at 37 °C for 5–10 min. One drop of termination solution was added to each well, the absorbance value was measured by a microplate reader, the standard curve was obtained, and the concentration to be measured was calculated.

2.13. 5-Ethynyl-2′-deoxyuridine (EdU) assay The proliferation of synoviocytes was tested by EdU kit which was purchased from Guangzhou RiboBio Co., Ltd. (Guangdong, China), and the EdU solution was diluted in the proportion of 1:1000. The cells were inoculated in 96-well plates, 100 μL EdU solution was added, hatched at 37 °C for 4 h, with the medium abandoned. Next, the cells were washed twice × 5 min by PBS, fixed with 100 μL 4% paraformaldehyde for 20 min, and then added with Apollo staining reaction solution and reacted avoided light. After cleaning, 4′,6-diamidino-2-phenylindole 2hci (DAPI) was added to stain for 30 min, then cells were recorded under a fluorescence microscope (Leica, Germany).

2.10. Synoviocytes culture and identification in vitro The synovial tissues were washed with calcium-free and magnesium-free D-Hanks solution for three times, then was cut into pieces about 1–2 mm3 and adipose tissue was removed. The synovial tissues were put into the 25 cm2 culture bottle, detached with 2% type I collagenase for 4 h, centrifuged at 1200 r/min for 10 min, then detached with 0.25% trypsin for 30 min, and filtered with 200-mesh nylon net. The cells precipitated with RPMI-1640 medium comprising 10% fetal bovine serum (FBS) were re-suspended and fostered in a 5% CO2 incubator, and 2–3 passages of cells were taken for the experiment. Synoviocytes (2–3 passage) were prepared into 1 × 106 L−1 cell suspension, and the suspension was cultured in 6 wells, the cold methanol was fixed for 15 min, the PBS was used for cleaning, and 3% H2O2 was dropped into inactivate endogenous enzyme for 15 min. After the sheep serum was sealed for 20 min, the primary antibody, rabbit anti-Vimentin was added and incubated overnight at 4 °C, and then washed with PBS. Next, goat anti-rabbit secondary antibody was

2.14. Flow cytometry The synoviocytes of each group of mice was collected, the suspended synoviocytes were mixed after detached with trypsin. Cells were collected after centrifugation, cleaned with pre-cooled PBS at 4 °C, and centrifuged at 1000 r/min for 5 min. Cell concentration (200 μL) was adjusted to 106 cells/mL, and cells were rinsed with 1 mL precooled PBS and then centrifuged. After the cells were resuspended, 2 μL of Annexin-V-FITC (20 μg/mL) was added, placed on ice avoiding light for 15 min, and then transferred to a flow-type detection tube. Subsequently, 300 μL of PBS was added, each sample was added with 1 μL PI (50 μg/mL) before putted into the machine, and detected on the machine within 30 min. 3

International Immunopharmacology 79 (2020) 106067

X. Wang, et al.

2.15. Hoechst 33258 staining

2.17. Western blot assay

The fibroblast-like synoviocytes in the logarithmic growth phase were detached, and 5 × 106 cells were inoculated in 6-well plates, incubated at 37 °C with 5% CO2, the cells were then treated with the above-mentioned grouping. The original culture solution was discarded, and the cells were fixed with paraformaldehyde (4%) for 10 min. Discarding the fixing liquid after the fixation was completed, and then Hoechst 33258 (final concentration of 5 mg/L) was dropped into cells for light avoidance staining with 30 min, followed by washing and sealing. The fluorescence microscope was employed for observing and recording.

The total proteins of synoviocytes tissues and cells in each group were extracted. The protein concentration was gauged by bicinchoninic acid kit (Beyotime Institute of Biotechnology, Shanghai, China), and then the sample was counted. Polyacrylamide electrophoresis (10%) (Boster Biological Technology Co. Ltd., Wuhan, Hubei, China) was used to isolate the protein, and 5% bovine serum albumin was sealed for 1 h. Primary antibody against IGF1 (1:500), p-PI3K (1:1000), PI3K (1:1000), p-AKT (1:1000), AKT (1:10000), p-mTOR (1:1000), mTOR (1:1000), p21 (1:1000), CyclinD1 (1:200), Bax (1:1000), Bcl-2 (1:2000), and Caspase-3 (1:500) (all from Abcam Inc., Cambridge, MA, USA) were hatched overnight at 4 °C. Next, the corresponding secondary antibody was incubated for 1 h, followed by washing and chemiluminescence reagent development. GAPDH (1:1000 dilution, Millipore company, Massachusetts, USA) was selected as an internal reference. The gray value was analyzed using Image J.

2.16. RT-qPCR The total RNA of synovial tissues were extracted by one-step method of TrizoL (Invitrogen, Carlsbad, CA, USA). NanoDrop2000 (Thermo Fisher Scientific, Massachusetts, USA) was used to determine the optical density (OD) value and RNA concentration by ultraviolet spectrophotometry. In the light of the specifications of reverse transcription kit (DRR047S, Takara Biotechnology Ltd., Dalian, China), the sample RNA was transformed into cDNA. The cDNA obtained was diluted with 65 μL diethy pyrocarbonate (DEPC) and fully mixed. PCR was verified by realtime PCR instrument (ABI 7900) and PCR primers were devised and composed by Invitrogen (Carlsbad, California, USA) (Table 1). MiR-365 used U6 as an internal parameter while glyceraldehyde phosphate dehydrogenase (GAPDH) as an internal parameter of IGF1, PI3K, AKT, mTOR, p21, cyclinD1, Bax, Bcl-2, Caspase-3, IL-1β and IL-6. The data were analyzed by 2-ΔΔCt method.

2.18. Luciferase activity assay The binding site between miR-365 and IGF1 3′UTR were forecasted by bioinformatics software http://www.targetscan.org. IGF1 3′UTR promoter region sequence containing miR-365 binding site was composed and then inserted into pMIR-REPORT™ Luciferase vector plasmid (Ambion, Company, Austin, TX, USA) to construct IGF1 3′UTR wild type plasmid (IGF1-WT). In the light of the plasmid, IGF1 3′UTR mutant type plasmid (IGF1-MUT) was constructed. The logarithmic cells were inoculated into 96-well plates. When the cell density was about 70%, Lipofectamine 2000 was used for cell transfection. IGF1-WT and IGF1MUT were mingled with mimics NC and miR-365 mimics (GenePharma Ltd., Shanghai, China), respectively. The cells were gathered and lysed 48 h after transfection, and luciferase activity was tested with luciferase detection kit (BioVision, San Francisco, CA, USA) by a luminometer (Glomax20/20, Promega, Madison, Wisconsin, USA).

Table 1 Primer sequence. Gene

Sequence (5′ → 3′)

miR-365

F: CGTAATGCCCCTAAAAAT R: GTGCAGGGTCCGAGGT

2.19. Statistical analysis

U6

F: CGCTTCGGCAGCACATATAC R: AAATATGGAACGCT-TCACGA

IGF1

F: CACCTCAGACAGGCATTG R: GCTGGGCACGGATAGA

PI3K

F: CACTCAGCCCATCTATTTCCAG R: TCTTGGATCTTCACCTTCAGC

AKT

F: GACTGACACCAGGTATTTCGATGA R: CTCCGCTCACTGTCCACACA

All data were analyzed by SPSS 21.0 software (IBM SPSS Statistics, Chicago, IL, USA). The measurement data were indicated as mean ± standard deviation. Comparisons between two groups were conducted by t-test, while comparisons among multiple groups were assessed by one-way analysis of variance (ANOVA). The least significant difference method (LSD-t) was adopted for the pairwise comparison. P value < 0.05 was indicative of statistically significant difference.

mTOR

F: TGCTCAAAGTAGCTTGTGCTGAA R: CAGTCATATGGTTTAATAACTTCTTTGGA

p21

F: CTGTCTTGCACTCTGGTGTCTGA R: CCAATCTGCGCTTGGAGTGA

CyclinD1

F: TCCTGCTACCGCACAACG R: GACCAGCCTCTTCCTCCAC

Bax

F: TGCAGAGGATGATTGCTGAC R: GAGGACTCCAGCCACAAAGA

Bcl-2

F: CGCCTCTTCACCTTTCAGCATTG R: CATCTCCAGCATCCCACTGTAG

Caspase-3

F: GACTAGCTTCTTCAGAGGCGA R: ATTCCGTTGCCACCTTCCTG

IL-1β

F: AAAAAAGCCTCGTGCTGTCG R: GTCGTTGCTTGGTTCTCCTTG

IL-6

F: GAGGATACCACTCCCAACAGACC R: AAGTGCATCATCGTTGTTCATACA

GAPDH

F: ACCACAGTCCATGCCATCAC R: GTGAGGGAGATGCTCAGTGT

3. Results 3.1. MiR-365 expression decreased in synovial tissues of RA mice RT-qPCR tested the expression of miR-365 in synovial tissues of each group, the results demonstrated that in relation to the normal group, miR-365 expression reduced in the RA group (P < 0.05). Compared to the mimics NC group, miR-365 expression heightened in the miR-365 mimics group (P < 0.05). By comparison to the inhibitors NC group, miR-365 expression degraded in the miR-365 inhibitor group (P < 0.05) (Fig. 1A). 3.2. MiR-365 upregulation decreases inflammatory score and X-ray imaging score By observing the arthritis inflammatory score of mice in each group, it revealed that (Fig. 1B) compared with the normal group, the other groups showed different degrees of redness and swelling, and there were more common in the interphalangeal joint, ankle joint of the hindlimb and implicated the forelimb. The arthritis inflammatory score in the miR-365 mimics group was the lowest, and the highest, in the

Note: F, forward; R, reverse; miR-365, microRNA-365; IL-1β, Interleukin-1β; IL-6, Interleukin-6; GAPDH, glyceraldehyde phosphate dehydrogenase. 4

International Immunopharmacology 79 (2020) 106067

X. Wang, et al.

Fig. 1. MiR-365 expression decreased in synovial tissues of RA mice and high expression of miR-365 reduces inflammatory score and X-ray imaging score. A: miR365 expression in synovial tissues of each group. B: Arthritis inflammatory score of mice in each group. C: X-ray evaluation of mice in each group. Measurement data were depicted as mean ± standard deviation, and comparisons among multiple groups were assessed by one-way analysis of variance followed by LSD-t test. N = 10, *P < 0.05 vs. the mimics NC group. #P < 0.05 vs. the inhibitors NC group.

proliferation reduced, and a little neutrophils and lymphocytes infiltrated. There was no obvious tissue edema and synoviocytes proliferation, and no obvious pannus formation. A little cellular fibrosis and fibrous exudation was found, and no obvious collagen fiber deposition. In the miR-365 inhibitor group, the local inflammation of knee joint was further aggravated, accompanied by a great deal of monocytes proliferation and neutrophil and lymphocytes infiltration, tissue edema and synoviocytes proliferation, and the formation of plenty of pannus. There were plenty of cellular fibrosis and fibrous exudation in synovial tissues, accompanied by the deposition of massive collagen fibers. The synovial tissues of mice in each group were observed by a transmission electron microscope (Fig. 2B). It suggested that in the normal group, developed Golgi apparatus and phagocytic vesicles of different sizes, abundant rough endoplasmic reticulum, a small number of vacuoles and mitochondria, but no swelling of mitochondria and clear boundary were found. In the RA group, the Golgi apparatus, mitochondria and vacuoles in synoviocytes enhanced, at the same time, Golgi bodies became smaller and severely curled, and mitochondria swelled, the crest process was destroyed or disappeared, the rough endoplasmic reticulum was abnormally rich and pool-like, the ribosome was scattered in groups, and the number of mitochondria and dense bodies was also increased. The morphology and structure of synovial tissues in the RA group, mimics NC group and inhibitors NC group were alike. No obvious Golgi apparatus and mitochondria, Golgi apparatus became smaller, curl degree was not obvious, a small amount of mitochondria swelled and crest destruction was mild in the miR-365 mimics group. The number of vacuoles decreased, no obvious rough endoplasmic reticulum was found, and a small amount of ribosomes were scattered. In the miR-365 inhibitor group, the Golgi apparatus,

miR-365 inhibitor group, there was statistically significant difference relative to corresponding NC group (P < 0.05). The inflammatory score in the RA group, mimics NC group and inhibitors NC group presented the same trend without significant difference (P > 0.05). The results suggested that miR-365 had a certain inhibitory effect on RA. By analyzing the imaging evaluation of each group of mice, it showed that (Fig. 1C) by comparison with the normal group, there were different layers of soft tissue swelling, bone destruction and synoviocytes hyperplasia in the other groups. There was no distinct difference in imaging scores among the RA group, mimics NC group and inhibitors NC group (P > 0.05). In relation to the mimics NC group, the imaging score of the miR-365 mimics group was decreased (P < 0.05), and compared with the inhibitors NC group, the imaging score of the miR365 inhibitor group was raised (P < 0.05). 3.3. Pathological changes in synovial tissues of mice in each group After HE staining, the obtained findings revealed that (Fig. 2A) the synovial tissues of the normal group were uniformly stained, the synoviocytes were evenly distributed and arranged regularly, and there was no local inflammatory cell infiltration and pannus formation. In the RA group, the local inflammatory reaction was obvious, monocytes proliferated, and neutrophils and lymphocytes infiltrated. There were edema, synoviocytes proliferation and pannus formation in part of tissues. There appeared cellular fibrosis and fibrous exudation in synovial tissue, and a deposition of collagen fibers. The morphology and structure of synovial tissues in the RA group, mimics NC group and inhibitors NC group were similar. The local inflammatory reaction of knee joint in the miR-365 mimics group was alleviated, monocytes

Fig. 2. The structural changes of the synovial tissue of each group of mice. A: HE staining (×100) of synovial tissues of mice in each group. B: Electron microscopic observation (×12,000) of synovial tissues of mice in each group. 5

International Immunopharmacology 79 (2020) 106067

X. Wang, et al.

Fig. 3. The number of TUNEL positive cells added when miR-365 was elevated in mouse synovial tissue. A: TUNEL staining showed positive expression of apoptotic cells in synovial tissue. B: Quantification results in Figure A. C: Bax, Bcl-2 and caspase-3 mRNA expression detected by RT-qPCR. D: Bax, Bcl-2 and caspase-3 protein expression tested by western blot assay. E: Quantification results of Bax, Bcl-2 and caspase-3 protein expression. Measurement data were depicted as mean ± standard deviation, and comparisons among multiple groups were assessed by one-way analysis of variance followed by LSD-t test. N = 10, *P < 0.05 vs. the normal group. #P < 0.05 vs. the mimics NC group. &P < 0.05 vs. the inhibitors NC group.

Fig. 4. The expression of IL-1β and IL-6 in serum and synovial tissues in RA was depressed by miR-365 overexpression. A: Expression of IL-1β in the serum of each group of mice. B: Expression of IL-6 in the serum of each group of mice. C: The mRNA expression of IL-1β and IL-6 in the synovial tissues of each group of mice. Measurement data were depicted as mean ± standard deviation, and comparisons among multiple groups were assessed by one-way analysis of variance followed by LSD-t test. N = 10, *P < 0.05 vs. the normal group. #P < 0.05 vs. the mimics NC group. &P < 0.05 vs. the inhibitors NC group.

the mimics NC group and the inhibitors NC group relative to that the RA group (P > 0.05). By comparison with the mimics NC group, TUNEL positive cells in synovial tissues of the miR-365 mimics group increased (P < 0.05). Compared to the inhibitors NC group, TUNEL positive cells in synovial tissues of the miR-365 inhibitor group decreased (P < 0.05). It was presented that in relation to the normal group, Bax and caspase-3 expression reduced while Bcl-2 expression raised in the RA group (all P < 0.05). In contrast to the mimics NC group, Bax and caspase-3 expression enhanced while Bcl-2 expression declined in the miR-365 mimics group (all P < 0.05). By comparison with the inhibitors NC group, Bax and caspase-3 expression decreased while Bcl-2 expression elevated in the miR-365 inhibitor group (all P < 0.05) (Fig. 3C–E).

mitochondria, and vacuoles increased, Golgi bodies became smaller, curl became worse, a large number of mitochondria swelled, crest destruction was obvious, ribosomes scattered, as well as the number of mitochondria and dense bodies increased further, accompanied by a large number of rough endoplasmic reticulum. 3.4. Upregulation of miR-365 elevates the number of TUNEL positive cells in RA Cell apoptosis in synovial tissue of mice in each group was tested by TNUEL assay, and the results of which suggested that (Fig. 3A and B) the number of TUNEL positive cells in synovial tissue of the RA group was lower than that of normal group (P < 0.05). There was no distinct difference in the amount of TUNEL positive cells in synovial tissues in 6

International Immunopharmacology 79 (2020) 106067

X. Wang, et al.

Fig. 5. Identification of synoviocytes. A: The synoviocytes were observed under a light microscope (×200). B: Vimentin expression in the cytoplasm of synoviocytes.

The expression of p21 and CyclinD1 in the mimics NC group, siRNA-NC group and miR-365 mimics + OE-IGF1 group were not changed compared to the RA group (P > 0.05). The expression of CyclinD1 in the miR-365 mimics group degraded and the p21 raised compared with the mimics NC group (P < 0.05). In the IGF1 siRNA group, the expression of CyclinD1 was lower than in the siRNA-NC group, but the expression of p21 was higher (P < 0.05). By comparison with the miR-365 mimics + OE-NC group, CyclinD1 expression in the miR-365 mimics + OE-IGF1 group enhanced while p21 depressed (P < 0.05).

3.5. Overexpression of miR-365 declines IL-1β and IL-6 expression in serum and synovial tissues of RA By ELISA and RT-qPCR, IL-1β and IL-6 expression of mice in each group was verified, and the results presented that (Fig. 4A–C) compared to the normal group, the expression of IL-1β and IL-6 was raised in serum and synovial tissues in the RA group (P < 0.05). There was no distinct difference in the expression of IL-1β and IL-6 in serum and synovial tissues in the mimics NC group and the inhibitors NC group compared with the RA group (P > 0.05). By comparison with the mimics NC group, the expression of IL-1β and IL-6 in the miR-365 mimics group was degraded (P < 0.05). Compared to the inhibitors NC group, the expression of IL-1β and IL-6 in the miR-365 inhibitor group was heightened (P < 0.05).

3.8. Knockdown IGF1 and highly-expressed miR-365 promote apoptosis of synoviocytes Flow cytometry was adopted to verify the apoptosis of synoviocytes. It was revealed that (Fig. 7A and B) the apoptosis rate in the RA group was lower, and in the blank group, the rate was higher (P < 0.05). Compared with the RA group, there was no distinct difference in apoptosis rate among the mimics NC group, siRNA-NC group and miR365 mimics + OE-IGF1 group (P > 0.05). The apoptosis rate of the miR-365 mimics group was increased relative to that in the mimics NC group (P < 0.05). In the IGF1 siRNA group, the apoptosis rate was increased compared to the siRNA-NC group (P < 0.05). In the miR-365 mimics + OE-IGF1 group, apoptosis rate was lower than that in in the miR-365 mimics + OE-NC group (P < 0.05). As shown in Fig. 7C of Hoechst 33258 staining, in the RA group, synoviocytes had the changes of apoptosis, there appeared aggregation of nuclear chromatin, fragmentation of nucleus, and concentration of cytoplasm. There was no distinct difference in the apoptotic morphology of the mimics NC group, siRNA-NC group and the miR-365 mimics + OE-IGF1 group. Obvious nuclear chromatin aggregation, a large number of nuclear fragmentation and cytoplasm concentration were found in the miR-365 mimics group. Compared with the siRNANC group, the synoviocytes in the IGF1 siRNA group had a large number of aggregation of nuclear chromatin, fragmentation of nucleus, and concentration of cytoplasm. Compared to the miR-365 mimics + OE-NC group, the synoviocytes of the miR-365 mimics + OEIGF1 had no obvious nuclear chromatin accumulation, it appeared a small amount of nuclear fragmentation and cytoplasm concentration. The expression of Bax, caspase-3 and Bcl-2 protein in the synoviocytes was tested by RT-qPCR and western blot analysis. It was discovered that (Fig. 7D–F) in the RA group, the expression of Bcl-2 was higher while Bax and caspase-3 expression was lower than the blank group (all P < 0.05). It was no distinct difference among the expression of Bax, caspase-3 and Bcl-2 among the RA group, mimics NC group and siRNA-NC group (all P > 0.05). The expression of Bax and caspase-3 raised and Bcl-2 expression degraded in the miR-365 mimics group than that of the mimics NC group (all P < 0.05). Compared to

3.6. Identification of synoviocytes Through the identification of the synoviocytes of each group of mice, it displayed that (Fig. 5) the synoviocytes were mainly fusiform fibroblast-like synoviocytes after 2–3 passages in vitro. Under the light microscope, the cells of the two-stage cells were elongated, the ends were connected with the adjacent cells and interwoven into a net, and the nucleus was oval in the center of the cells, and the cells were thin, transparent and arranged with local directivity. Vimentin was a characteristic protein of mesoderm cells for the identification of synoviocytes. 3.7. High expression of miR-365 and poor expression of IGF1 inhibit synoviocytes proliferation The proliferation of synoviocytes in each group was tested by EdU and MTT assays. The obtained findings revealed that (Fig. 6A and B) the proliferation rate and cell viability of synoviocytes in the RA group were increased than those in the blank group (P < 0.05). Compared to the RA group, there was no obvious difference in proliferation rate and cell viability of synoviocytes among the mimics NC group, siRNA-NC group and miR-365 mimics + OE-IGF1 group (P > 0.05). Compared to the mimics NC group, the proliferation rate and cell viability of synoviocytes in the miR-365 mimics group decreased (P < 0.05). The proliferation rate and cell viability of synoviocytes in the IGF1 siRNA group was lower than in the siRNA-NC group (P < 0.05), while which in the miR-365 mimics + OE-IGF1 group was higher than in the miR365 mimics + OE-NC group (P < 0.05). The expression of p21 and CyclinD1 in synoviocytes of mice were tested by RT-qPCR and western blot assay. It suggested that (Fig. 6C–E) compared to the blank group, the expression of CyclinD1 in the RA group increased, while the expression of p21 decreased (P < 0.05). 7

International Immunopharmacology 79 (2020) 106067

X. Wang, et al.

Fig. 6. High expression miR-365 and low expression of IGF1 inhibited the proliferation of synoviocytes. A: Proliferation of synoviocytes in each group was detected by EdU assay. B: The OD value of synoviocytes was verified by MTT assay. C: The mRNA expression of CyclinD1 and p21 in synoviocytes was detected by RT-qPCR. D: Protein band of CyclinD1 and p21 protein in synoviocytes tested by western blot assay. E: Quantification results of CyclinD1 and p21 protein expression in Figure D. Measurement data were depicted as mean ± standard deviation, and comparisons among multiple groups were assessed by one-way analysis of variance followed by LSD-t test. N = 10, *P < 0.05 vs. blank group. #P < 0.05 vs. mimics NC group. &P < 0.05 vs. siRNA-NC group. +P < 0.05 vs. miR-365 mimics + OE-NC group.

with the RA group (P > 0.05). Compared with the mimics NC group, miR-365 expression in the miR-365 mimics group increased (P < 0.05). There was no distinct difference in miR-365 expression between the IGF1 siRNA group and the siRNA-NC group as well as between the miR-365 mimics + OE-IGF1 group and the miR-365 mimics + OE-NC group (P > 0.05). RT-qPCR and western blot analysis was utilized to verify the expression of related factors in the PI3K/AKT/mTOR signaling pathway (Fig. 8B and C). IGF1, PI3K, AKT and mTOR mRNA expression, IGF1 protein expression as well as the levels of p-PI3K/PI3K, p-AKT/AKT and p-mTOR/mTOR were also increased in the RA group compared with that of the blank group (all P < 0.05). Compared to the RA group, there was no distinct change in the mRNA expression of IGF1, PI3K, AKT and mTOR, IGF1 protein expression as well as the levels of p-PI3K/

the siRNA-NC group, the expression of Bax and caspase-3 elevated in the IGF1 siRNA group, while the expression of Bcl-2 decreased (all P < 0.05). By comparison with the miR-365 mimics + OE-NC group, the expression of Bax and caspase-3 reduced and the expression of Bcl-2 advanced in the miR-365 mimics + OE-IGF1 group. 3.9. Overexpression of miR-365 restrains IGF1 expression and inactivates PI3K/AKT/mTOR pathway MiR-365 expression in synoviocytes of mice was verified by RTqPCR. It demonstrated that (Fig. 8A) the expression of miR-365 in the RA group was lower, while it has higher expression in the blank group (P < 0.05). There was no distinct difference in the expression of miR365 between the mimics NC group and siRNA-NC group in contrast 8

International Immunopharmacology 79 (2020) 106067

X. Wang, et al.

Fig. 7. High expression of miR-365 and low expression of IGF1 promoted synoviocytes apoptosis. A: Flow cytometry was adopted to detect the apoptosis of synoviocytes. B: The apoptosis rate of synoviocytes in mice in each group. C: Hoechst 33258 staining (×100) tested apoptosis of synoviocytes. D: The mRNA expression of Bax, Bcl-2 and caspase-3 protein in synoviocytes of mice was detected by RT-qPCR. E: Protein bands of Bax, Bcl-2 and caspase-3 protein in synoviocytes of mice was verified by western blot assay. F: Quantification results of Bax, Bcl-2 and caspase-3 protein expression in Figure E. Measurement data were depicted as mean ± standard deviation, and comparisons among multiple groups were assessed by one-way analysis of variance followed by LSD-t test. N = 10, *P < 0.05 vs. blank group. #P < 0.05 vs. mimics NC group. &P < 0.05 vs. siRNA-NC group. +P < 0.05 vs. miR-365 mimics + OE-NC group.

p-mTOR/mTOR enhanced in the miR-365 mimics + OE-IGF1 group (all P < 0.05).

PI3K, p-AKT/AKT and p-mTOR/mTOR in the mimics NC group, siRNANC group and the miR-365 mimics + OE-IGF1 group (all P > 0.05). The mRNA expression of IGF1, PI3K, AKT and mTOR, IGF1 protein expression as well as the levels of p-PI3K/PI3K, p-AKT/AKT and pmTOR/mTOR declined in the miR-365 mimics group and the IGF1 siRNA group relative to the mimics NC group and the siRNA-NC group (all P < 0.05). By comparison with the miR-365 mimics + OE-NC group, the mRNA expression of IGF1, PI3K, AKT and mTOR, IGF1 protein expression as well as the levels of p-PI3K/PI3K, p-AKT/AKT and

3.10. IGF1 is a target gene of miR-365 The target sites of IGF1 binding to corresponding miR-365 were determined by online prediction software Target Scan. The sequence of 3′UTR of IGF1 mRNA combined with miR-365 (Fig. 8D). At the same time, the luciferase activity of cells co-transfected with miR-365 mimics 9

International Immunopharmacology 79 (2020) 106067

X. Wang, et al.

Fig. 8. MiR-365 suppresses the expression of IGF1 and inactivates the PI3K/AKT/mTOR pathway. A: The expression of miR-365, IGF1 and related proteins in the PI3K/AKT/mTOR pathway in synoviocytes was detected by RT-qPCR. B: Protein bands of IGF1, p-PI3K, PI3K, p-AKT, AKT, p-mTOR and mTOR in synoviocytes of mice in western blot assay. C: Quantification results of Figure B. D: Target Scan predicted the target site of IGF1 binding to the corresponding miR-365. E: Detection of binding site between miR-365 and IGF1 by dual luciferase reporter gene assay. Data represented the standard deviation of the mean value of three independent experiments, and comparisons among multiple groups were assessed by one-way analysis of variance followed by LSD-t test. N = 10, *P < 0.05 vs. blank group or Wt + NC group. #P < 0.05 vs. mimics NC group. &P < 0.05 vs. siRNA-NC group. +P < 0.05 vs. miR-365 mimics + OE-NC group.

regulation of serum IL-6 expression in active pulmonary tuberculosis patients, which means that miR-365 may monitor the immune response and occurrence of active pulmonary tuberculosis through IL-6 [27]. In addition, we have revealed that high expression of miR-365 and low expression of IGF1 inhibit the proliferation of synoviocytes and promote apoptosis. In vitro, upregulating miR-365 boosted the expression of smooth muscle specific genes and suppressed the proliferation and migration of venous smooth muscle cells [28]. It has been suggested previously that the overexpression of miR-365 suppressed the proliferation of cholangiocarcinoma cells and advanced apoptosis in vitro [29]. Moreover, miR-365 can repress the growth and advance apoptosis of melanoma cells through targeting BCL2 and CyclinD1 [30]. The inflammation of the hippocampus affects the signal conduction of the IGF1 receptor, and can be used for the treatment of the neurosequela of RA [15,31]. Because its synthesis is inhibited by inflammation, IGF-1 is reduced in RA and juvenile idiopathic arthritis [32]. The study also showed that increasing miR-365 decreased IGF1 expression to suppress the activation of the PI3K/AKT/mTOR pathway. A important finding was that overexpression miR-135b and activating PI3K/AKT/mTOR signaling pathway could mitigate hypoxia-induced human umbilical vein endothelial cells injury [33]. Another study has verified that IGF1 plays a role in human ovarian cancer cells by activating the PI3K/AKT/mTOR signaling pathway as well as subsequent transcriptional suppressors, snails and nasal plugs. In addition, we also suggested that PI3K/AKT/mTOR signaling pathway conducts IGF1 inducing ovarian cancer cell proliferation [34]. Furthermore, IGF1 is found to be the direct target gene of miR-495, and AKT was revealed to be modulated by miR-495/IGF-1 signaling [35]. Also, a recent study has provided a proof that many different miRNAs can adapt to specific training programs by adjusting the IGF1/PI3K/AKT/mTOR axis [16]. It has been revealed that miR-365a-3p is able to mediate the PI3K/AKT signaling pathway through increasing p-AKT (Ser473) to induce growth and metastasis in laryngeal squamous cell carcinoma [36]. Another study purported that miR-365 suppressed invasion, migration and

and Wt-miR-365/IGF1 or Mut-miR-365/IGF1 recombinant plasmid reported that (Fig. 8E) miR-365 mimics had no obvious effect on luciferase activity of Mut-miR-365/IGF1 plasmid (P > 0.05), but reduced luciferase activity of Wt-miR-365/IGF1 plasmid (P < 0.05). 4. Discussion RA is a chronic inflammatory disease featured by excessive inflammation at the joint, which leads to stiffness, swelling and constant pain [20]. Genes, infection, gender, environment, even dietary components are revealed to be participate in the beginning and development of RA [8]. The low levels of IGF1 induced by smoking may sustain abnormal T-cell formation in the early stage of arthritis, support bone remodeling and joint progressive injury in patients with significant arthritis, and support early cardiovascular death in RA [21]. Besides, PI3K/AKT/mTOR pathway has been found to improve testicular injury and destroy spermatogenesis in RA with the treatment of drugs [22]. As the influence of miR-365 in RA remains to be excavated, the objective of our study was to talk over the effect of miR-365 targeting IGF1mediated PI3K/AKT/mTOR pathway on synoviocytes in mice with RA. In this study, it was found that up-regulation of miR-365 reduces inflammatory score and X-ray imaging score. Consistent with our study, a study utilizing a xenograft model reported that high expression of miR-365 can inhibit tumor growth in ovarian cancer via inhibiting wnt5a [23]. Our study also presented that high expression of miR-365 elevated the number of TUNEL positive cells and degraded the levels of IL-1β and IL-6 significantly. Similarly, a previous study has proved that the overexpression of miR-365 is able to decline IL-1β, TNF-α, and IL18 expression [24]. Also, another study has displayed that overexpression of miR-365 repressed HIF-2α expression induced by IL-1β in human articular cartilage cells [25]. It is reported that the expression of IL-6 in coronary plaques, monocytes and serum was up-regulated, while miR-365 was lowly expressed [26]. Other study also proved that there is a relationship between the down-regulation of miR-365 and the up10

International Immunopharmacology 79 (2020) 106067

X. Wang, et al.

proliferation of glioma via regulating PIK3R3/AKT/mTOR signaling pathway [37]. In conclusion, our study provides evidence that overexpression of miR-365 is involved in RA by suppressing IGF1-mediated PI3K/AKT/ mTOR pathway, repressing the proliferation and boosting the apoptosis of synoviocytes. This paper provides a new idea for further study the pathogenesis of RA. The results of this paper can be further verified by expanding the sample size.

Cyclin D1 and Bcl-2, Carcinogenesis 33 (1) (2012) 220–225. [10] S. Hamada, et al., MiR-365 induces gemcitabine resistance in pancreatic cancer cells by targeting the adaptor protein SHC1 and pro-apoptotic regulator BAX, Cell. Signal. 26 (2) (2014) 179–185. [11] S.M. Kang, H.J. Lee, J.Y. Cho, MicroRNA-365 regulates NKX2-1, a key mediator of lung cancer, Cancer Lett. 335 (2) (2013) 487–494. [12] Q. Han, et al., Altered expression of microRNA-365 is related to the occurrence and development of non-small-cell lung cancer by inhibiting TRIM25 expression, J. Cell. Physiol. (2019). [13] P. Cao, et al., MiR-15b is a key regulator of proliferation and apoptosis of chondrocytes from patients with condylar hyperplasia by targeting IGF1, IGF1R and BCL2, Osteoarthritis Cartilage 27 (2) (2019) 336–346. [14] A. Szeremeta, et al., The association between insulin-like growth factor 1 (IGF-1), IGF-binding proteins (IGFBPs), and the carboxyterminal propeptide of type I procollagen (PICP) in pre- and postmenopausal women with rheumatoid arthritis, Scand. J. Rheumatol. 46 (3) (2017) 171–179. [15] K.M.E. Andersson, et al., Inflammation in the hippocampus affects IGF1 receptor signaling and contributes to neurological sequelae in rheumatoid arthritis, Proc. Natl. Acad. Sci. U S A 115 (51) (2018) E12063–E12072. [16] D. Domanska-Senderowska, et al., MicroRNA profile and adaptive response to exercise training: a review, Int. J. Sports Med. 40 (4) (2019) 227–235. [17] K. Liu, et al., miR-125 regulates PI3K/Akt/mTOR signaling pathway in rheumatoid arthritis rats via PARP2, Biosci. Rep. 39 (1) (2019). [18] K. Chen, et al., Metformin inhibits the proliferation of rheumatoid arthritis fibroblast-like synoviocytes through IGF-IR/PI3K/AKT/m-TOR pathway, Biomed. Pharmacother. 115 (2019) 108875. [19] D.D. Brand, K.A. Latham, E.F. Rosloniec, Collagen-induced arthritis, Nat. Protoc. 2 (5) (2007) 1269–1275. [20] A. Pentecost, et al., Immunomodulatory nanodiamond aggregate-based platform for the treatment of rheumatoid arthritis, Regen. Biomater. 6 (3) (2019) 163–174. [21] M.C. Erlandsson, et al., Smoking functions as a negative regulator of IGF1 and impairs adipokine network in patients with rheumatoid arthritis, Mediators Inflamm. 2016 (2016) 3082820. [22] A.H. Eid, et al., Venlafaxine and carvedilol ameliorate testicular impairment and disrupted spermatogenesis in rheumatoid arthritis by targeting AMPK/ERK and PI3K/AKT/mTOR pathways, Toxicol. Appl. Pharmacol. 364 (2019) 83–96. [23] Y. Wang, et al., MicroRNA-365 inhibits ovarian cancer progression by targeting Wnt5a, Am. J. Cancer Res. 7 (5) (2017) 1096–1106. [24] X.P. Wu, et al., MicroRNA-365 alleviates morphine analgesic tolerance via the inactivation of the ERK/CREB signaling pathway by negatively targeting beta-arrestin2, J. Biomed. Sci. 25 (1) (2018) 10. [25] H.S. Hwang, et al., MicroRNA-365 regulates IL-1beta-induced catabolic factor expression by targeting HIF-2alpha in primary chondrocytes, Sci. Rep. 7 (1) (2017) 17889. [26] B. Lin, et al., MiR-365 participates in coronary atherosclerosis through regulating IL-6, Eur. Rev. Med. Pharmacol. Sci. 20 (24) (2016) 5186–5192. [27] Q. Song, et al., MicroRNA-365 in macrophages regulates Mycobacterium tuberculosis-induced active pulmonary tuberculosis via interleukin-6, Int. J. Clin. Exp. Med. 8 (9) (2015) 15458–15465. [28] B.J. Cao, et al., MicroRNA-365 promotes the contractile phenotype of venous smooth muscle cells and inhibits neointimal formation in rat vein grafts, IUBMB Life 71 (7) (2019) 908–916. [29] L. Chen, X. Huang, X. Chen, MiR-365 suppresses cholangiocarcinoma cell proliferation and induces apoptosis by targeting E2F2, Oncol. Res. (2018). [30] Y. Zhu, X. Wen, P. Zhao, MicroRNA-365 inhibits cell growth and promotes apoptosis in melanoma by targeting BCL2 and Cyclin D1 (CCND1), Med. Sci. Monit. 24 (2018) 3679–3692. [31] A. Hurbin, et al., Cooperation of amphiregulin and insulin-like growth factor-1 inhibits Bax- and Bad-mediated apoptosis via a protein kinase C-dependent pathway in non-small cell lung cancer cells, J. Biol. Chem. 280 (20) (2005) 19757–19767. [32] P. Sarzi-Puttini, et al., Anti-TNF antibody treatment improves glucocorticoid induced insulin-like growth factor 1 (IGF1) resistance without influencing myoglobin and IGF1 binding proteins 1 and 3, Ann. Rheum. Dis. 65 (3) (2006) 301–305. [33] S. Wei, H. Wang, Ligustrazine promoted hypoxia-treated cell growth by upregulation of miR-135b in human umbilical vein endothelial cells, Exp. Mol. Pathol. 106 (2019) 102–108. [34] M.T. Lau, P.C. Leung, The PI3K/Akt/mTOR signaling pathway mediates insulin-like growth factor 1-induced E-cadherin down-regulation and cell proliferation in ovarian cancer cells, Cancer Lett. 326 (2) (2012) 191–198. [35] Y. Wang, et al., MiR-495/IGF-1/AKT signaling as a novel axis is involved in the epithelial-to-mesenchymal transition of oral squamous cell carcinoma, J. Oral Maxillofac. Surg. 77 (5) (2019) 1009–1021. [36] J. Geng, et al., MicroRNA-365a-3p promotes tumor growth and metastasis in laryngeal squamous cell carcinoma, Oncol. Rep. 35 (4) (2016) 2017–2026. [37] Y. Zhu, et al., MicroRNA-365 inhibits proliferation, migration and invasion of glioma by targeting PIK3R3, Oncol. Rep 37 (4) (2017) 2185–2192.

Ethical statement All animal experiments were in line with the Guide for the Care and Use of Laboratory Animal by International Committees of The First Affiliated Hospital of Xi’sn Jiaotong University. CRediT authorship contribution statement Xiaojun Wang: Conceptualization, Methodology. Sha Gong: Data curation, Investigation, Methodology. Dan Pu: Visualization. Nan Hu: Investigation, Project administration, Visualization. Yanhua Wang: Data curation, Resources, Validation. Ping Fan: Resources, Writing original draft. Jing Zhang: Formal analysis, Software, Supervision, Writing - original draft. Xiaohong Lu: Formal analysis, Project administration, Supervision, Validation, Writing - review & editing. Declaration of Competing Interest The authors declare that they have no conflicts of interest. Acknowledgement We would like to acknowledge the reviewers for their helpful comments on this paper. Appendix A. Supplementary material Supplementary data to this article can be found online at https:// doi.org/10.1016/j.intimp.2019.106067. References [1] A. Singh, R. Misra, A. Aggarwal, Baseline adenosine receptor mRNA expression in blood as predictor of response to methotrexate therapy in patients with rheumatoid arthritis, Rheumatol. Int. 39 (8) (2019) 1431–1438. [2] Q. Zhang, et al., Comparison of therapeutic effects of different mesenchymal stem cells on rheumatoid arthritis in mice, PeerJ 7 (2019) e7023. [3] J. Zhou, et al., Exploration of the serum metabolite signature in patients with rheumatoid arthritis using gas chromatography-mass spectrometry, J. Pharm. Biomed. Anal. 127 (2016) 60–67. [4] J.M. Davis 3rd, Rheumatoid arthritis: a severe disease that preventive approaches would greatly benefit, Clin. Ther. (2019). [5] M. Mousavi, et al., Comparison of the effect of disease: modifying antirheumatic drugs alone or in combination with biologic drugs in the outcome of patients with rheumatoid arthritis, Adv. Biomed. Res. 8 (2019) 32. [6] M. Pena, et al., Orthopaedic surgery trend in rheumatoid arthritis – results of the national registry of hospitalised patients (CMBD) over a 17 year period (1999–2015). TREND-AR study, J. Rheumatol. (2019). [7] W. Zhao, et al., MicroRNA-147 negatively regulates expression of toll-like receptor7 in rat macrophages and attenuates pristane induced rheumatoid arthritis in rats, Am. J. Transl. Res. 11 (4) (2019) 2219–2231. [8] X. Liu, et al., Circulating microRNA-23b as a new biomarker for rheumatoid arthritis, Gene (2019). [9] J. Nie, et al., microRNA-365, down-regulated in colon cancer, inhibits cell cycle progression and promotes apoptosis of colon cancer cells by probably targeting

11