Up-regulation of type II adenylyl cyclase mRNA in kindling model of epilepsy in rats

Neuroscience Letters 282 (2000) 173±176 www.elsevier.com/locate/neulet

Up-regulation of type II adenylyl cyclase mRNA in kindling model of epilepsy in rats Hiroto Iwasa a,*, Shuichi Kikuchi b, Seiichiro Mine c, Hiro Miyagishima a, Katsuo Sugita d, Toshio Sato a, Shuji Hasegawa e a

Department of Neuropsychiatry, School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670, Japan Division of Drug Dependence and Psychotropic Drug Clinical Research, National Institute of Mental Health, Chiba, Japan c Department of Neurosurgery, School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670, Japan d Department of Clinical Medicine, School of Education, Chiba University, 1-33 Yayoi-ho, Inage-ku, Chiba 263-8522, Japan e Chiba City Institute of Health, Chiba, Japan

b

Received 4 January 2000; received in revised form 4 February 2000; accepted 4 February 2000

Abstract The expression level of type II adenylyl cyclase mRNA (ACII) was analyzed by northern blotting in amygdaloid kindled rats. Remarkable increases in ACII mRNA were observed in the bilateral cerebral cortex and hippocampus at 24 h after the last generalized seizure. The elevated expression level in the hippocampus persisted for 4 weeks on the stimulated side. There were no changes in expression level in single-stimulated and partially-kindled states. These results suggest that the involvement of ACII might have an effect on the mechanisms of seizure generalization and the maintenance of persistent epileptogenesis rather than on the acquisition process. q 2000 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Epilepsy; Type II Adenylyl Cyclase; G proteins; Cerebral cortex; Hippocampus; Kindling; Seizure; Transmembrane signaling

Adenylyl cyclase (AC) is considered to be a transmembrane enzyme that catalyzes the formation of cAMP, one of the important intracellular second messengers. Several different subtypes of Gs-stimulated adenylyl cyclase have been isolated, as they possess distinct functional properties and patterns of distribution in the brain region [9]. Especially, type II adenylyl cyclase (ACII) exhibits an interesting range of regulatory features. The enzyme is stimulated by Gsa , and is inhibited by Gia [13]. Furthermore, it has been demonstrated that ACII is abundant in the brain, and a strong expression of ACII mRNA was seen in the hippocampal region and cerebral cortex [3]. Although several recent studies support the viewpoint that the induction of epileptic phenomena might be related to the functional imbalance between G protein subclasses, such as Gs and Gi family [2,5,6,7], involvement of the G protein-coupled effector system has not been elucidated. Therefore, we examined the expression level of mRNA of ACII, an important G protein-coupled effector, in the hippocampus and cerebral cortex of the amygdaloid kindling * Corresponding author. Tel.: 181-43-226-2149; fax: 181-43226-2150. E-mail address: [email protected] (H. Iwasa)

model, an experimental model of epilepsy characterized by a progressive increase in seizure susceptibility [4], to explore the possible contribution of the adenylyl cyclase system in the neurobiological basis of epilepsy. Thirty-two adult male Sprague±Dawley rats (Charles River, Japan) weighing 300±350 g were used. Rats were anesthetized with pentobarbital (50 mg/kg i.p.). A stainless steel bipolar stimulation-recording electrode was stereotaxically implanted into the left basolateral nucleus of the amygdala (ABL) according to the stereotaxic coordinates of Pellegrino et al. [12] 1.2 mm posterior from the bregma, 4.5 mm lateral from the midline, and 8.4 mm below the dura mater. After a recovery period of 10 days, rats underwent kindling stimulation to the left ABL once daily, consisting of 2 s, 50 Hz biphasic square pulses at the intensity of the afterdischarge (AD) threshold. The development of behavioral seizures was classi®ed using the criteria of Racine [14]. The rats were divided into ®ve groups. K-I (n ˆ 6) and KII (n ˆ 7) groups were stimulated until at least ten class-5 generalized seizures had occurred. Animals in the partially kindled group (K-P, n ˆ 6) received daily kindling stimulations until a class 1±2 partial seizure was induced. Kindled animals were sacri®ced at 24 h for the K-I group and 4

0304-3940/00/$ - see front matter q 2000 Elsevier Science Ireland Ltd. All rights reserved. PII: S03 04 - 394 0( 0 0) 00 89 7- 1

174

H. Iwasa et al. / Neuroscience Letters 282 (2000) 173±176

weeks for the K-II group after the last generalized seizure. The K-P group was analyzed at 24 h after the last stimulation. Rats in the K-S group (n ˆ 6) were administered only one stimulation by the same parameters as for kindling. Rats in the control group (n ˆ 7) were only implanted with electrodes in the same manner but were not stimulated. All animals were treated according to the NIH guideline for the Care and Use of Laboratory Animals. The brain was quickly removed and the bilateral cerebral cortex (front-temporal region) and hippocampus (entire hippocampus) were dissected en bloc on an ice-cold plate in a cold room at 48C. Samples were immediately frozen in liquid nitrogen and stored at 2808C until use. We examined the changes of expression levels of mRNA of ACII in each group by northern blot analysis. All analyses were performed individually. Northern blotting was performed according to the method previously described [7,15]. The probe of ACII was designed and synthesized according to a previous study [3]. The sequence oligonucleotide probe was TCTTTCCAAATGCCTGGTCTCTGAAACAGGACCTGGCTGT (bases 2352±2391). The amounts of labeled ACII mRNA and b actin mRNA hybridized to the probes were determined by quantitative densitometry of the autoradiograms using Fujix BAS2000 (Fuji, Japan). For numerical analysis, the intensity of ACII mRNA probe for each group was normalized as its respective b actin mRNA value. The values of radioactivity relative to b actin mRNA was expressed as percentage changes when compared with the mean value of the control group. Statistical analyses were done using one-way ANOVA followed by SheffeÂ's post-hoc test for evaluating the data of the expression levels of ACII mRNA. AD duration at the last seizure were 60.8 ^ 5.4 s (mean value ^ SEM) in K-I, 62.4 ^ 6.2 s in the K-II group and 8.4 ^ 2.2 s in the K-P group. In the K-S group, three to six spike discharges were observed on EEG, but no behavioral changes were induced. Animals in the K-P group exhibited mouth and facial movement such as chewing and head

nodding, which were rated as class 1 or 2 seizures after 3.8 ^ 2.2 stimulations. All rats in K-I and K-II groups experienced ten stable consecutive generalized clonic convulsions rated as class 5 seizures. There were no signi®cant differences, when analyzed by Student's unpaired ttest, in AD duration and the numbers of stimulations between K-I and K-II groups. Animals in the sham-operated control groups showed no electroencephalographic or behavioral changes. Fig. 1A (cerebral cortex) and Fig. 1B (hippocampus) show the autoradiograms of hybridization using the speci®c oligonucleotide probes for ACII in each group. Transcripts by hybridization were observed at a size of 4.1 kb, corresponding to the size determined for ACII mRNA in the rat brain. The densitometric intensity of labeling was elevated pronouncedly on the both sides of the cerebral cortex and hippocampus in the K-I group (Fig. 1A), and increased intensity of bands was also observed on both sides of the hippocampus in the K-II group (Fig. 1B). The ACII mRNA levels of the respective groups were quantitated densitometrically and are shown in Fig. 2A,B. The levels were signi®cantly increased by 50.1 ^ 11.2% on the left (stimulated) side and by 47.2 ^ 10.1% on the right (unstimulated) side of the cerebral cortex of the K-I group (Fig. 2A). A remarkable increase in the expression level was also observed in the bilateral hippocampus increased by 40.7 ^ 9.8% on the left side, 35.2 ^ 6.8% on the right side of the K-I group and in the left hippocampus of the K-II group by 36.7 ^ 5.8%. A slight, but not statistically signi®cant increase was observed on both sides of the cerebral cortex and in the right hippocampus in the K-II group (Fig. 2B). No signi®cant changes in expression levels were found on either brain region in the sham-operated control, K-S or K-P groups. The expression level of ACII mRNA was increased signi®cantly on both sides of the cerebral cortex and hippocampus at 24 h after the last generalized seizure. Since there

Fig. 1. (A) Representative result of hybridization of ACII mRNA in the cerebral cortex relative to b actin mRNA on the same blot. (B) Representative result of hybridization of ACII mRNAs in the hippocampus of each group. The animals in the K-I and K-II groups were analyzed at 24 h and 4 weeks after ten consecutive generalized seizures, respectively. The K-S and K-P groups were analyzed at 24 h after the last stimulation. Arrows indicate the sizes of the transcript (kilobases) in each group. L, stimulated side; R, unstimulated side.

H. Iwasa et al. / Neuroscience Letters 282 (2000) 173±176

175

Fig. 2. Changes in the expression level of ACII-encoding mRNA transcripts in the cerebral cortex (A) and hippocampus (B) obtained from densitometric analysis. The quanti®cation of radioactivity relative to b actin mRNA was expressed as percentage changes when compared with the mean value of the control group. Histograms show the mean ^ SEM of six rats in each group. Experiments were done in triplicate. Statistical analysis was done by one-way ANOVA, and SheffeÂ's post-hoc test was performed to determine differences between each kindled group and control. *P , 0:05.

were no changes in the expression level of ACII mRNA in the single-stimulated condition, these ®ndings suggest that the increase of ACII mRNA was not due to high-frequency electrical stimulation per se. As no notable changes in expression level were observed in the partially-kindled state, these changes might have an impact on the induction mechanisms of the generalized seizure rather than on the basic mechanisms of the acquisition process of epileptogenesis. This increase continued for 4 weeks after the last generalized seizure on the stimulated side of the hippocampus, while the expression levels on the unstimulated side of the hippocampus and both sides of the cerebral cortex were not remarkable. Since a previous report showed a signi®cant reduction of the paired pulse inhibition in the hippocampus ipsilateral to the stimulated side for a month after completion of amygdaloid kindling [10], the long-lasting increase of hippocampal ACII mRNA levels on the stimulated side might re¯ect the persistent diminution of inhibitory mechanisms in the kindled brain. On the other hands, it has been reported that kindling of limbic structures induces neuronal cell loss in the hippocampus after the induction of repeated generalized convulsions [16]. Since recurrent convulsions were induced in animals in the fully-kindled groups (K-I and K-II), the present results of the expression level of ACII mRNA might be affected by such neuropathological changes. Several researches suggest that the AC level in the brain may be concerned with the induction of convulsions and may modulate seizure susceptibility. A recent study showed that carbamazepine, within a clinically therapeutic range, exerts signi®cant inhibitory effects on AC activity and

also has an inhibitory effect on accumulation of cAMP in pertussis-toxin-treated cells [1]. Chronic treatment with electroconvulsive shock has demonstrated the acceleration of GppNHp (GTP analogue)-activated AC activity [11]. Furthermore, kindled animals that developed a generalized seizure showed signi®cant elevation in the levels of both cAMP and cGMP [17]. AC can play an important role in determining the routing of signals to the cAMP pathway, and impaired AC activity might play an important role in seizure induction mechanisms by its regulatory effects on the accumulation of cyclic nucleotides. As up-regulation in the ACII mRNA level might be related to the increase in the activity of this enzyme, this increase might have a facilitatory effect on the kindling phenomenon or seizure generation. We have already reported remarkable increases in the expression levels of a subunit mRNAs of Gs and Gi2 in the amygdaloid kindling model [7]. Further, it has also been demonstrated long-lasting attenuation of b -agonist induced speci®c GTP binding ability in the hippocampus and cerebral cortex of amygdaloid kindled rats [5,8]. As these ®ndings suggest that dysfunction in G protein-linked transduction system might play an important role in the kindled brain, the increase of ACII mRNA might re¯ect a post-translational compensatory up-regulation to the impairment in signal transduction that occurred at the step of b -adrenergic receptor-Gs protein-ACII coupling. Although further studies of the diversity of the regulatory features including other types of adenylyl cyclase and changes in enzymatic activities are needed, a possible molecular mechanism underlying the changes in ACII may be related to impairment in the trans-

176

H. Iwasa et al. / Neuroscience Letters 282 (2000) 173±176

duction system by G protein-effector coupling. Since these changes might be associated with both the mechanisms of seizure induction and the persistent changes of seizure susceptibility, precise investigation of the adenylyl cyclase system might facilitate interpretation of the basic mechanisms of epilepsies and could present a potential target for a new therapeutic paradigm. This study was supported in part by a grant-in-aid for Scienti®c Research from the Japanese Ministry of Education, Science and Culture (08457248) and the Japan Epilepsy Research Foundation. We thank Ms Hitomi Sengoku for excellent preparation of the manuscript. [1] Chen, G., Pan, B., Hawver, D.B., Wright, C.B., Potter, W.Z. and Manji, H.K., Attenuation of cyclic AMP production by carbamazepine. J. Neurochem., 67 (1996) 2079±2086. [2] Defelipe, J., Marco, P., Sola, R.G., SaÂnchez-BlaÂzquez, P. and GarzoÂn, J., Local changes in GTP-binding protein immunoreactivities in human epiletogenic neocortex. Exp. Brain Res., 119 (1998) 153±158. [3] Furuyama, T., Inagaki, S. and Takagi, H., Distribution of type II adenylyl cyclase mRNA in the rat brain. Mol. Brain Res., 19 (1993) 165±170. [4] Goddard, G.V., McIntyer, D.C. and Leech, C.K., A permanent change in brain function resulting from electrical stimulation. Exp. Neurol., 25 (1969) 295±330. [5] Iwasa, H., Hasegawa, S. and Kikuchi, S., Kindling-induced changes of [ 3H]GTP binding in the cerebral cortical membrane. Jpn. J. Psychiatry Neurol., 42 (1991) 542±544. [6] Iwasa, H., Hasegawa, S., Kikuchi, S., Watanabe, K. and Sato, T., Amygdaloid kindling elicits persistent changes in pertussis toxin-catalyzed ADP-ribosylation. Epilepsia, 35 (1994) 855±860. [7] Iwasa, H., Kikuchi, S., Watanabe, H. and Hasegawa, S.,

[8]

[9] [10]

[11]

[12] [13] [14] [15] [16] [17]

Altered expression levels of G protein subclass mRNAs in various seizure stages of the kindling model. Brain Res., 818 (1999) 570±574. Iwasa, H., Kikuchi, S., Mine, S., Sugita, K., Miyagishima, K. and Hasegawa, S., Functional signi®cance of stimulatory GTP binding protein in hippocampus is associated with kindling-elicited epileptogenesis. Psychiatry Clin. Neurosci., 54 (2000) in press. Iyengar, R., Molecular and functional diversity of mammalian Gs-stimulated adenylyl cyclases. FASEB J., 7 (1993) 768±775. Kapur, J., Michelson, H.B., Buterbaugh, G.G. and Lothman, E.W., Evidence for a chronic loss of inhibition in the hippocampus after kindling: electrophysiological studies. Epilepsy Res., 4 (1989) 90±99. Ozawa, H. and Rasenick, M.M., Chronic electroconvulsive treatment augments coupling of the GTP-binding Gs to the catalytic moiety of adenylate cyclase in a manner similar to that seen with chronic antidepressant drugs. J. Neurochem., 56 (1991) 330±338. Pellegrino, L.J.A., Pellegrino, S. and Cushman, A.J., A Stereotaxic Atlas of the Rat Brain, 2nd edn., Plenum, New York, 1979. Pieroni, J.P., Jacobowitz, O., Chen, J. and Iyengar, R., Signal recognition and integration by Gs -stimulated adenylyl cyclases. Curr. Opin. Neurobiol., 3 (1993) 345±351. Racine, R.J., Modi®cation of seizure activity by electrical stimulation II. Motor seizure. Electroenceph., clin. Neurophysiol., 32 (1972) 281±294. Sambrook, J., Fritch, E.F. and Maniatis, T., Molecular Coning, 7. Extraction, Puri®cation and Analysis of Messenger RNA from Eukariotic Cells, 2nd edn., 1989. Sutula, T.P., Reactive changes in epilepsy: cell death and axon sprouting induced by kindling. Epilepsy Res., 10 (1991) 62±70. Wasterlain, C.G. and Farber, D.B., Cyclic nucleotide response of the hippocampal formation to septal stimulation in naive and kindled rats. J. Neurochem., 47 (1986) 185±190.