Upregulation of microRNA-22 contributes to myocardial ischemia-reperfusion injury by interfering with the mitochondrial function

Author’s Accepted Manuscript Upregulation of microRNA-22 contributes to myocardial ischemia-reperfusion injury by interfering with the mitochondrial function Jian-Kui Du, Bin-Hai Cong, Qing Yu, He Wang, Long Wang, Chang-Nan Wang, Xiao-Lu Tang, Jian-Qiang Lu, Xiao-Yan Zhu, Xin Ni www.elsevier.com

PII: DOI: Reference:

S0891-5849(16)30242-8 http://dx.doi.org/10.1016/j.freeradbiomed.2016.05.006 FRB12869

To appear in: Free Radical Biology and Medicine Received date: 29 January 2016 Revised date: 6 May 2016 Accepted date: 8 May 2016 Cite this article as: Jian-Kui Du, Bin-Hai Cong, Qing Yu, He Wang, Long Wang, Chang-Nan Wang, Xiao-Lu Tang, Jian-Qiang Lu, Xiao-Yan Zhu and Xin Ni, Upregulation of microRNA-22 contributes to myocardial ischemiareperfusion injury by interfering with the mitochondrial function, Free Radical Biology and Medicine, http://dx.doi.org/10.1016/j.freeradbiomed.2016.05.006 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Upregulation of microRNA-22 contributes to myocardial ischemia-reperfusion injury by interfering with the mitochondrial function

Jian-Kui Du1, Bin-Hai Cong1, Qing Yu1, He Wang1, Long Wang1, Chang-Nan Wang1, Xiao-Lu Tang1, Jian-Qiang Lu2, Xiao-Yan Zhu1*, Xin Ni1* 1

Department of Physiology and The Key Laboratory of Molecular Neurobiology of Ministry of Education, Second Military Medical University, Shanghai 200433, China 2 School of Kinesiology, The key Laboratory of Exercise and Health Sciences of Ministry of Education, Shanghai University of Sport, Shanghai 200438, China Running head: miR-22 contributes to myocardial I/R injury *Correspondence and Reprint Requests: Dr. Xin Ni, Department of Physiology, Second Military Medical University, 800 Xiangyin Road, Shanghai 200433, China, Tel and Fax: +86-21-81870978, e-mail: [email protected]; or Dr. Xiaoyan Zhu, Department of Physiology, Second Military Medical University, e-mail: [email protected]

Abstract

Mitochondrial oxidative damage is critically involved in cardiac ischemia reperfusion (I/R) injury. MicroRNA-22 (miR-22) has been predicted to potentially target sirtuin-1 (Sirt1) and peroxisome proliferator-activated receptor- coactivator-1α (PGC1α), both of which are known to provide protection against mitochondrial oxidative injury. The present study aims to investigate whether miR-22 is involved in the regulation of cardiac I/R injury by regulation of mitochondrial function. We found that miR-22 level was significantly increased in rat hearts subjected to I/R injury, as compared with the sham group. Intra-myocardial injection of 20 ug miR-22 inhibitor reduced I/R injury as evidenced by significant decreases in cardiac infarct size, serum lactate dehydrogenase (LDH) and creatine kinase (CK) levels and the number of apoptotic cardiomyocytes. H9c2

cardiomyocytes exposed to hypoxia/reoxygenation (H/R) insult exhibited an increase in miR-22 expression, which was blocked by reactive oxygen species (ROS) scavenger and p53 inhibitor. In addition, miR-22 inhibitor attenuated, whereas miR-22 mimic aggravated H/R-induced injury in H9c2 cardiomyocytes. MiR-22 inhibitor per se had no significant effect on cardiac mitochondrial function. Mitochondria from rat receiving miR-22 inhibitor 48 h before ischemia were found to have a significantly less mitochondrial superoxide production and greater mitochondrial membrane potential and ATP production as compared with rat receiving miR control. In H9c2 cardiomyocyte, it was found that miR-22 mimic aggravated, whilst miR-22 inhibitor significantly attenuated H/R-induced mitochondrial damage. By using real time PCR, western blot and dual-luciferase reporter gene analyses, we identified Sirt1 and PGC1α as miR-22 targets in cardiomyocytes. It was found that silencing of Sirt1 abolished the protective effect of miR-22 inhibitor against H/R-induced mitochondrial dysfunction and cell injury in cardiomyocytes. Taken together, our findings reveal a novel molecular mechanism for cardiac mitochondrial dysfunction during myocardial I/R injury at the miRNA level and demonstrate the therapeutic potential of miR-22 inhibition for acute myocardial I/R injury by maintaining cardiac mitochondrial function. Key Words: microRNA-22, cardiomyocyte, mitochondria, ischemia-reperfusion, Sirt1, PGC1α, p53

Introduction Ischemic heart disease with subsequent myocardial infarction and congestive heart failure is the leading cause of death in both developed and developing countries [1]. Current reperfusion therapies, including thrombolysis, coronary angioplasty, and coronary bypass surgery, remain the most effective strategy to rescue the ischemic myocardium [2,3]. However, myocardial reperfusion also

initiates oxidative damage through generation of reactive oxygen species (ROS). Formation of damaging ROS during myocardial ischemia/reperfusion (I/R) further enhances oxidative stress and promotes cardiomyocyte damage [3,4]. Heart function is highly dependent on energy availability. To meet their energy requirements for muscular contraction, cardiomyocytes have indeed abundant mitochondria, which are key organelles involved in myocardial I/R injury [5]. In addition to their role in generating energy, mitochondrial electron transport has also been recognized as a main source of ROS in cardiomyocytes [5,6]. In the myocardium exposed to I/R injury, generation of harmful mitochondrial ROS triggers mitochondrial oxidative damage, which further causes a series of changes in mitochondrial structure and function, such as decreased respiratory function and ATP supply, increased mitochondrial permeability, mitochondrial swelling, and the release of proapoptotic proteins [7-9]. The resulting mitochondrial dysfunction leads to impaired contractile function and cardiomyocytic apoptosis, both of which finally contribute to myocardial dysfunction [9]. Among many factors influencing cell response to myocardial ischemia/reperfusion injury, an ever increasing number of studies have concurred to highlight a fundamental role of microRNAs (miRs) [10,11]. For instance, miR-21 [12], miR-146a [13], and miR-499 [14] protect against myocardial I/R injury by preventing I/R-induced apoptotic and inflammatory signaling pathways. In contrast, some miRs, such as miR-29 [15] and miR-320 [16], promote myocardial I/R injury by targeting cardioprotective proteins. Our previous study has demonstrated that down-regulation of miR-22 links estrogens with the increase of cystathionine gamma-lyase, an important enzyme involved in myocardial antioxidant defense, thereby contributing to estrogenic cardioprotection against oxidative stress [17]. It is of interest that miR-22 is predicted to potentially target sirtuin-1 (Sirt1) and

peroxisome proliferator-activated receptor- coactivator-1α (PGC1α) [18,19], both of which are known to provide protection against mitochondrial oxidative injury [20,21]. However, whether miR-22 is involved in the regulation of cardiac I/R injury by regulation of mitochondrial function remains to be investigated. Therefore, the present study firstly clarified the protective effect of miR-22 inhibition against myocardial I/R injury by modulating mitochondrial oxidative damage both in vitro and in vivo. Furthermore, we identified Sirt1 and PGC1α as real targets for miR-22. The key role of Sirt1 in mediating the protective effects of miR-22 inhibition against I/R injury was finally determined in cardiomyocyte cultures in vitro. Methods Rat ischemia/reperfusion (I/R) model and determination of infarct size and the area at risk Male Sprague-Dawley rats (8-week-old) were obtained from Shanghai SLAC Laboratory Animal Co (Shanghai, China) and housed at controlled room temperature with free access to food and water under a natural day/night cycle. All animal protocols were approved by the Ethical Committee of Experimental Animals of Second Military Medical University. Rats were anesthetized and ventilated with a rodent ventilator ((Inspira®, Harvard Apparatus Ltd, Boston, MA). Myocardial ischemia was induced by passing a 6–0 silk suture beneath the left anterior descending artery at a point 1–2 mm inferior to the left auricle. The suture was tightened over a piece of PE-20 tubing (Becton, Dickinson, Sparks, MD) for 30 min and then released for 2 h [22]. The suture was then tightened again, and rats were intravenously injected with 2% Evans blue (Shenggong, Shanghai, China). The hearts were immediately excised and cut into 2-mm-thick slices parallel to the atrioventricular groove and were immerged into 10% paraformaldehyde in PBS (pH 7.4) for 2 h. The heart sections stained with Evans blue were photographed for analysis of the area at risk, which was

identified as the area not stained with a blue color of Evans blue in the heart sections. The slices were then incubated with 1% 2,3,5-triphenyltetrazolium chloride (TTC, Shenggong) in phosphate buffer (pH 7.4) at 37°C for 20 min. TTC was catalyzed by dehydrogenase enzymes to formazan, which is a red pigment and stains viable myocardium with dark red. The infarct area that does not contain dehydrogenase enzymes is not able to convert TTC into formazan and thus remains pale in color [22]. The area at risk and the infarct area were quantified using Image J. Infarct size was expressed as a ratio of the infarct area and the area at risk. Cell culture and hypoxia/reoxygenation (H/R) treatment

The H9c2 myocardial cell line was originally obtained from American Type Culture Collection and kindly provided by the Shanghai Institute for Biological Sciences. Cells were cultured in DMEM medium containing 10% FBS at 37°C in 5% CO2-95% air. To establish the H/R model, the culture medium was then changed to serum-free DMEM and placed into an anaerobic chamber that was purged with 94% N2, 5% CO2, and 1% O2 for 24 hours, followed by reoxygenation for 2 hours [17]. 3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT) assay Cell viability was evaluated by MTT assay based on the reduction of MTT (Sigma-Aldrich) by functional mitochondria to formazan, as described previously [23]. Lactate dehydrogenase (LDH) and creatine kinase (CK) activity A spectrophotometric kit (Roche Diagnostics) was used to assess LDH in supernatant of primary cultured cardiomyocytes and serum of rat. Serum CK activity was determined by an automatic analyzer using a commercial CK-NAC test kit (Roche Diagnostics). TUNEL assay Apoptotic cardiomyocytes in the border zone of the infarct area and H9c2 cells were detected by TdT-mediated dUTP nick-end labeling (TUNEL) technique using the One Step TUNEL Apoptosis

Assay Kit (Beyotime, Jiangsu, China) according to the manufacturer’s instructions. Hoechst 33258 (1 g/ml) staining was used to determine the number of nuclei. The TUNEL signals were observed with a fluorescence microscopy (Olympus, Japan). Cell apoptosis was determined as the ratio of the number of TUNEL-positive nuclei to that of Hoechst-positive nuclei [22]. Intra-myocardial injection of miR-22 inhibitor

MiR-22 inhibitor was designed and synthesized by GenePharma Corporation (Shanghai, China). The sequence of miR-22 inhibitor is as follows: 5’-ACAGUUCUUCAACUGGCAGCUU-3’. 20 ug of miR-22 inhibitor or control miRNA was diluted in 40 l in vivo–jetPEITM and 10% glucose mixture (1:1 vol/vol) and injected into the left ventricle apex and anterolateral wall at four different points (the similar points in different rats) using a 30-gauge needle. Forty eight hours after miR-22 inhibitor injection, rats were subjected to myocardial I/R [24]. RNA interference in vitro The siRNA for Sirt1 was designed and synthesized by GenePharma Corporation. The target sequences for Sirt1 siRNA is as follows: 5’-CCCUGUAAAGCUUUCAGAA-3’. Negative control siRNA was scrambled sequence without any specific target: 5’-TTCTCCGAACGTGTCACGT-3’. Transfection of siRNA in H9c2 cardiomyocytes was performed by using siPORT NeoFx transfection agent (Ambion, Austin, TX) according to the manufacturer’s instructions. Isolation of mitochondria Mitochondrial isolation was performed using Mitochondria Fractionation Kit (Beyotime) as previously described [25]. Briefly, myocardium samples were quickly removed and placed in chilled isolation media (0.25 M sucrose, 10mM Tris–HCl buffer, pH 7.4, 1mM EDTA, and 250 μg BSA/ml). The tissues were minced and washed with the isolation medium, and 10% (w/v) homogenates were

prepared. Nuclei and cell debris were sedimented by centrifugation at 600 g for 10 min and discarded. The supernatant was subjected to centrifugation at 10,000 g for 10 min. The resulting mitochondrial pellets were suspended in the isolation medium. Detection of mitochondrial superoxide production MitoSOX (Molecular Probes) is a cell-permeable probe that accumulates specifically in mitochondria and becomes fluorescent after oxidation by superoxide [26]. MitoSOX was dissolved in DMSO immediately before use, and then applied to H9c2 cells or isolated mitochondria at a final concentration of 5μM with DMSO diluted to less than 0.1%. After 30 min, the medium was replaced with 100 ul HEPES buffered saline (10mM HEPES, pH 7.4, 150 mM NaCl, 5 mM KCl, 1mM MgCl2, and 1.8mM CaCl2); then, red fluorescence was read at 485 nm excitation and 590 nm emission using a Synergy TM fluorescence plate reader (Bio-Tek Instruments) [25]. Assessment of mitochondrial membrane potential loss Mitochondrial membrane potential was detected with fluorescent probe JC-1 (Sigma-Aldrich), which exists predominantly in monomeric form in cells with depolarized mitochondria and displays fluorescent green [27]. Cells with polarized mitochondria predominantly contain JC-1 in aggregate form and show fluoresced red. Loading was done by incubating H9c2 cardiomyocytes or isolated mitochondria with 2 uM JC-1 for 15 min. After staining, the red fluorescent signals were excited at 530 nm and detected at 630 nm, and the green fluorescence was excited at 488 nm and detected at 530 nm using a SynergyTM fluorescence plate reader. Mitochondrial damage was assessed by examining mitochondrial membrane depolarization, which was indicated by the ratio of red and green [25]. Measurement of ATP concentration

Samples of H9c2 cardiomyocytes or isolated mitochondria were homogenized in a protein extraction solution (Pierce). The supernatant after centrifugation at 10,000 g for 10 min was subject to determination of ATP concentration, using an ATP bioluminescence assay (Beyotime). Light emitted from a luciferase-mediated reaction was measured by a tube luminometer (Tecan) [25]. Dual luciferase assay The wild-type 3’UTR and the miR-22 ‘seed’ mutant 3’UTR of Sirt1 and PGC1α were synthesized in vitro and cloned into the psi-CHECK2 luciferase reporter plasmid (Promega). H9c2 cells were co-transfected with psiCHECK-2 plasmid containing wild-type or mutant derivatives, along with the miRNA control or miR-22 mimic. Lysates were collected 24 h after transfection and luciferase activity measured by Dual luciferase reporter system (Promega). Real-Time RT-PCR Total RNA from heart tissue or cardiomyocytes was extracted by a TRIzol reagent (Invitrogen), and then 2ug RNA was reverse transcribed to generate cDNA by using superscript reverse Transcriptase (Invitrogen) with special stem-loop primer for miR-22 and oligodeoxythymidine for mRNAs. Quantitative real-time PCR was carried out using a MiniOpticon real-time PCR detection system (Bio-Rad Laboratories). The primer sequences for Sirt1 and PGC1α were designed based on cDNA sequences in GeneBank. The following primers were used: Sirt1 (accession number XM _006256146): sense 5’- GCAGGTTGCAGGAATCCA AA -3’ and anti-sense 5’- GGCAAGATG CTGTTGCAAAG-3’; PGC1α (accession number NM _ 031347): sense 5’ - GACATG TGCAGCCAAGACTC -3’ and anti-sense 5’ - TTCGCGGGCTCATTGTTGTA -3’. The reaction solution consisted of 2.0 µl diluted cDNA, 0.2 µM/L of each paired primer, 200 µM/L deoxynucleotide triphosphates, 1 U Taq DNA polymerase (Qiagen, Beijing, China), and 1 PCR buffer. SYBRGreen (Roche Ltd, Basel, Switzerland) was used as detection dye. The annealing

temperature was set at 58–62°C and amplification was set at 40 cycles. The temperature range to detect the melting temperature of the PCR product was set from 60 to 95°C. To determine the relative quantitation of gene expression, the comparative Ct (threshold cycle) method with arithmetic formulae (2-△△Ct) was used [17]. Messenger RNA levels were normalized relative to the housekeeping gene β-actin. Western blot analysis Proteins of rat heart tissues and H9c2 cardiomyocytes were lysed with cold RIPA lysis buffer (Beyotime). Protein load was 30 ug/lane in 10% SDS-PAGE and subsequently transferred to nitrocellulose membranes. The bolts were blocked with 5% skim milk powder in 0.1%Tris-buffered saline/Tween20 (TBST) for 2 h and incubated with antibodies against Sirt1 (Santa Cruz), PGC1α (Santa Cruz), p53 (Proteintech, Chicago, IL), or p21 (Santa Cruz) overnight at 4 °C at a dilution of 1:1000. Then, the membrane was incubated with a secondary horseradish peroxidase-conjugated antibody for 1 h at room temperature. Immunoreactive proteins were visualized using the enhanced chemiluminescence Westernblotting detection system (Santa Cruz). The chemiluminiscent signal from the membranes was quantified by a GeneGnome HR scanner using GeneTools software (SynGene). To control sampling errors, the ratio of band intensities to β-actin was obtained to quantify the relative protein expression level. Statistical analysis All data were expressed as means±SEM. For illustrative purposes, some results are presented as the mean percent control ± SEM. When comparing multiple groups, one-way ANOVA was performed and when significant (p<0.05), comparisons between each groups were conducted using the Student-Newman-Keuls test. SPSS 13.0 statistical software was used for data analysis. P<0.05 was considered statistically significant. Results

Up-regulation of miR-22 contributes to myocardial injury upon to I/R insult As shown in Fig.1A, miR-22 level was increased by 2.6 0.3-fold in rat hearts subjected to ischemia/reperfusion injury, as compared with the sham group. To examine whether miR-22 up-regulation contributed to myocardium ischemia/reperfusion injury, miR-22 inhibitor was delivered via intra-myocardial injection into the left ventricle myocardium two days before carrying on myocardial I/R surgery. As shown in Fig.1B&C, we found that infarct size was significantly reduced in I/R rats treated with miR-22 inhibitor, as compared with I/R rats treated with control miRs. Rat myocardium subjected to I/R injury showed a significant increase in the number of TUNEL-positive, apoptotic cells, which was decreased by miR-22 inhibitor treatment (Fig.1D&E). In addition, the elevated levels of serum LDH and CK in rats subjected to I/R injury were also decreased by miR-22 inhibitor treatment (Fig.1G&H). miR-22 inhibitor per se had no significant effect on serum LDH and CK levels, as well as cardiomyocyte apoptosis (Fig.1D-H). miR-22 inhibitor attenuates, whereas miR-22 mimic aggravates H/R-induced injury in cultured cardiomyocytes As shown in Fig.2A, miR-22 expression was also increased in H9c2 cardiomyocytes exposed to H/R insult, which simulates I/R injury in vivo [26]. We then examined the role of miR-22 up-regulation in H/R-induced cardiomyocytic injury. Both H/R and miR-22 mimic caused cell damage by showing that LDH release (Fig. 2B), and TUNEL-positive cardiomyocytes (Fig.2D&E) were increased whilst cell viability was decreased (Fig.2C). In addition, treatment with miR-22 mimic significantly aggravated H/R-induced cardiomyocytic injury by showing that the cell viability was significantly decreased whilst LDH release and TUNEL-positive cells were significantly increased in the cells transfected with miR-22 mimic compared with those transfected with control

miR (Fig.2B-E). In contrast, treatment with miR-22 inhibitor significantly attenuated cardiomyocyte injury induced by H/R or miR-22 mimic, as evidenced by increased cell survival as well as decreased LDH release and TUNEL-positive cells. Lin et al [28] recently demonstrate that transcription factor p53 plays a critical role in stimulating miR-22 transcription by binding to the promoter region on the miR-22 gene. Links between p53 and oxidative stress have been widely reported [29]. Thus, we then investigated whether p53 signaling pathway contributes to H/R-induced upregulation of miR-22. As shown in Fig.3A, H/R treatment led to significant increases in protein levels of p53 and its target gene p21, which was abolished by the ROS scavenger, NAC (1 mM). In addition, H/R-induced upregulation of miR-22 was blocked by both NAC and p53 inhibitor pifithrin-α (20 μM) (Fig.3B). Taken together, these findings suggest that upregulation of miR-22 in H9c2 cardiomyocytes exposed to H/R insult may be at least partly due to ROS-induced activation of p53 signaling pathway. miR-22 contributes to mitochondrial dysfunction induced by I/R in vivo and H/R in vitro Mitochondrial dysfunction contributes to hypoxia/reoxygenation-induced injury via a loss of metabolic capacity and by the production and release of toxic products [5]. Cardiac mitochondria were isolated from rat subjected to 30 min ischemia and 2 h reperfusion for assessment of biomarkers of mitochondrial dysfunction. As shown in Fig.4A-C, mitochondria isolated from I/R-operated rats were found to have a significant increase in mitochondrial superoxide production, as well as decreases in mitochondrial membrane potential and ATP production as compared with sham-operated animals. Mitochondria from rat receiving 20

g miR-22 inhibitor 24 h before

ischemia were found to have a significantly less mitochondrial superoxide production and greater mitochondrial membrane potential and ATP production as compared with I/R-operated rats receiving

miR control. MiR-22 inhibitor per se had no significant effect on cardiac mitochondrial function. In H9c2 cardiomyocytes, it was found that both hypoxia/reoxygenation and miR-22 mimic caused significant mitochondrial oxidative damage as evidenced by an increase in mitochondrial superoxide production, as well as significant decreases in mitochondrial membrane potential and ATP production (Fig.4D-F). In addition, treatment with miR-22 mimic significantly aggravated H/R-induced mitochondrial damage. In contrast, treatment with miR-22 inhibitor significantly attenuated mitochondrial damage induced by either H/R or miR-22 mimic, as evidenced by a decrease in mitochondrial superoxide production, as well as significant increases in mitochondrial membrane potential and ATP production. miR-22 suppresses Sirt1 and PGC1α expression in cardiomyocytes MiRs are known to negatively regulate the stability and translation of target protein-coding mRNAs at the 3’ untranslated region (UTR) [11]. In order to identify potential targets for miR-22, we used a consensus approach with three widely used types of software (miRanda, TargetScan, and PicTar) to perform the target prediction. After overlapping prediction results, Sirt1 and PGC1α, two critical factors involved in modulation of mitochondrial function, were selected to be putative miR-22 target genes. The mRNAs of both Sirt1 and PGC1α contain putative binding sites for miR-22 in its 3’-UTR, and each site is broadly conservative among mammals (Fig.5E&F). As shown in Fig.5A-D, transfection with miR-22 significantly decreased both mRNA and protein expression of Sirt1 and PGC1α in cardiomyocytes. To address whether Sirt1 and PGC1α were directly regulated by miR-22, we transfected Sirt1 and PGC1α 3’UTR luciferase reporter constructs together with miR-22 mimic into cardiomyocytes and observed a significant reduction in luciferase activity in contransfection with miR-22, compared with that in cells cotransfected with nontargeting miR control (Fig.5G&H). In

contrast, no reduction in luciferase activity was detected upon cotransfection of miR-22 when the putative miR-22 binding sequence in the Sirt1 and PGC1α 3’UTR luciferase reporter construct was mutated. These findings suggest that Sirt1 and PGC1α expression is suppressed in cardiomyocytes by miR-22 binding to response elements in their 3’UTR. Silencing of Sirt1 abolishes the protective effect of miR-22 inhibitor against H/R-induced mitochondrial dysfunction and cell injury in cardiomyocytes We then examined the effect of miR-22 on protein expression of Sirt1 and PGC1α in cardiomyocytes exposed to H/R injury. As shown in Fig.6, protein expression of both Sirt1 and PGC1α was significantly decreased in cardiomyocytes exposed to H/R. MiR-22 inhibitor not only increased expression of Sirt1 and PGC1α by itself, but also reversed the H/R-inhibited expression of Sirt1 and PGC1α. It was found that Sirt1 siRNA caused about 80% decrease in Sirt1 expression in cardiomyocytes. Moreover, Sirt1 siRNA abolished miR-22 inhibitor-induced up-regulation of Sirt1 expression in cardiomyocytes exposed to H/R. Notably, it was found that miR-22 inhibitor-induced PGC1α expression in H/R-treated cardiomyocytes was also significantly inhibited by Sirt1 siRNA. We next determined whether Sirt1 was involved in the protective effect of miR-22 inhibitor against H/R-induced mitochondrial dysfunction in cardiomyocytes. It was found that Sirt1 siRNA abolished the protective effect of miR-22 inhibitor against H/R-induced mitochondrial damage, as evidenced by an increase in mitochondrial superoxide production, and significant decreases in mitochondrial membrane potential and ATP production in cardiomyocytes (Fig.7). As shown in Fig.8, Sirt1 siRNA abolished the protective effect of miR-22 inhibitor against H/R-induced cell injury, as evidenced by decreased cell survival as well as increased LDH release and TUNEL-positive cells.

Discussion MiR-22 is a ubiquitously expressed microRNA that is highly expressed in striated muscle tissues including cardiac and skeletal muscles [30]. Deep sequencing analysis has shown that miR-22 is the most abundant miR in the heart [31]. More specifically, Huang et al demonstrate that cardiomyocytes contribute most of the miR-22 expression in the heart, suggesting the potential function of miR-22 in adult cardiomyocytes [18]. MiR-22 dysregulation in cardiac diseases has been documented in both experimental and clinical studies. Gurha et al [32] demonstrate that miR-22 expression is temporally induced by pathological stress during early phases of cardiac hypertrophy and remodeling. miR-22 expression is prominently up-regulated during cardiac aging and fibrosis [33]. In vitro studies also show that miR-22 is increased in cardiomyocytes treated by hypertrophic stimulus such as phenylephrine and angiotensin II [34]. Moreover, clinical study demonstrates the increased level of miR-22 in the sera of chronic systolic heart failure patients which show significant associations with some of the clinical and prognostic parameters such as elevated serum natriuretic peptide levels, a wide QRS, and dilatation of the left ventricle and left atrium [35]. Our pervious study has indicated that the level of miR-22 positively correlates to pro-oxidative biomarker malondialdehyde, whereas is negatively correlated to anti-oxidative biomarker such as reduced glutathione to glutathione disulfide ratio and total antioxidative capacity in myocardium of ovariectomized rats [17]. This finding was supported by the present study showing that miR-22 expression was significantly up-regulated in response to I/R-induced oxidative stress both in vivo and in vitro. It has been recently demonstrate that transcription factor p53 plays a critical role in stimulating miR-22 transcription by binding to the promoter region on the miR-22 gene [28]. Links between p53 and oxidative stress have been widely reported [29]. H/R treatment is known to increase p53

expression in cardiomyocytes [36,37]. In the present study, we found that the H/R-induced expression of p53 and its target gene p21 were significantly attenuated by the ROS scavenger. In addition, both ROS scavenger and p53 inhibitor pifithrin-α blocked H/R-induced upregulation of miR-22. Taken together, these findings suggest that upregulation of miR-22 in H9c2 cardiomyocytes exposed to H/R insult may be at least partly due to ROS-induced activation of p53 signaling pathway. There is a general consensus that miR-22 is required for the development of cardiomyocyte hypertrophy in response to various cardiac insults [38]. However, the data regarding the effect of miR-22 on cardiomyocyte survival are still conflicting. Two groups have reported that overexpression of miR-22, through intra-myocardial injection of either miR-22 mimic [39] or adenovirus expressing miR-22 [40], inhibits cardiomyocyte apoptosis after I/R injury. In contrast, Gurha et al [19] have demonstrated that cardiomyocyte-specific miR-22 transgenic mice exhibits enhanced myocardial apoptosis as compared with control mice, indicating that enforced miR-22 expression in heart is deleterious. In consistent with Gurha et al’s report, our study indicated that miR-22 inhibitor significantly attenuated I/R-induced myocardial injury as evidenced by an increase in cardiomyocyte viability and decreases in LDH release and cardiomyocyte apoptosis, suggesting that up-regulation of miR-22 expression in response to I/R injury might be harmful in heart. We noticed that although our and previous studies used the similar surgical technique for rat model of regional myocardial I/R and made ischemic for the same period of time (30 min), the features of myocardial injury were observed after different reperfusion time periods. We examined myocardial injury indexes after a short time period, 2 h of reperfusion which represented an early reperfusion injury, whereas previous studies observed after a longer time period, 12-24 h of reperfusion which

mainly represented delayed or sustained reperfusion injury [39,40]. Accumulating studies have shown that characteristics of I/R-induced myocardial injury were dependent on the duration of reperfusion time. For example, it is recognized that necrosis is confined to the early reperfusion period, while apoptosis is the main mechanism for the loss of tissue viability during the delayed reperfusion period [41]. It is possible therefore that the apparent discrepancy between our and previous results might be explained by the different procedures used. By using cardiomyocyte-specific miR-22 transgenic mice, Gurha et al [19] have shown that overexpression of miR-22 leads to cardiac contractile dysfunction and heart failure, meanwhile exhibits cardiac alterations in a series of transcripts associated with energy metabolism and mitochondrial function. However, a limitation of their studies is that they did not address whether overexpression of miR-22 is associated with ATP depletion or mitochondrial dysfunction. In the present study, we found that miR-22 inhibitor attenuated, whereas miR-22 mimic aggravated hypoxia/reoxygenation-induced mitochondrial oxidative damage in cardiomyocytes. In addition, miR-22 inhibitor also reversed the mitochondrial oxidative stress, loss of mitochondrial membrane potential and ATP content in rat heart tissues exposed to ischemia/reperfusion injury. Taken together, these findings demonstrate for the first time that up-regulation of miR-22 contributes to I/R-induced mitochondrial oxidative damage in cardiomyocytes. We further identified Sirt1 and PGC1α, both of which have been recognized to provide protection against mitochondrial oxidative injury, as critical targets of miR-22 in cardiomyocytes. Previous studies have documented that both Sirt1 and PGC1α play important roles in the control of mitochondrial function [42]. PGC1α is a key regulator of mitochondrial function through activation of mitochondrial biogenesis, respiration and energy metabolism [43]. Sirt1, a member of

the sirtuin family of class III histone deacetylases, is known to retard aging and protect various organisms from oxidative stress through deacetylation of transcription factors and cofactors including p53, PGC1α, and the FoxO family members [44]. Accumulating studies have shown that Sirt1 function together with PGC1α to exert protection against I/R-induced mitochondrial oxidative damage [20, 21, 45]. Sirt1 physically interacts with and deacetylates PGC1α at multiple lysine sites, consequently increasing PGC1α activity leading to the maintenance of mitochondrial function [42]. Our study demonstrated that cardiomyocytes exposed to H/R exhibited significant decreases in protein expression of both Sirt1 and PGC1α, which could be reversed by miR-22 inhibitor. Notably, Sirt1 knockdown abolished miR-22 inhibitor-induced PGC1α expression in H/R-treated cardiomyocytes. Moreover, the protective effect of miR-22 inhibitor against H/R-induced mitochondrial dysfunction and cell injury in cardiomyocytes was also abolished by silencing of Sirt1. Collectively, we suppose that PGC1α can be simultaneously regulated by two post-transcriptional pathways, miR-22-dependent inhibition and Sirt1-dependent activation. In cardiomyocytes treated by miR-22 inhibitor, loss of miR-22-dependent inhibition and up-regulation of Sirt1 result in increase of PGC1α expression. Thus, Sirt1 seems to be the key protein contributing to the miR-22 inhibitor-induced protection against H/R-induced cardiomyocyte injury. Previous studies have demonstrated that dysregulation of mitochondrial antioxidant enzymes contributes to the elevated levels of ROS and mitochondrial injury in cardiomyocytes exposed to H/R insult [46]. However, by using a consensus approach with three widely used types of software (miRanda, TargetScan, and PicTar), it was found that mitochondrial antioxidant enzymes are not included among the predicted miR-22 potential targets. The present study identified Sirt1 and PGC1α as critical targets of miR-22 in cardiomyocytes. Both Sirt1 and PGC1α have been recognized

to provide protection against mitochondrial oxidative injury in cardiovascular system through induction of mitochondrial antioxidant genes including Mn superoxide dismutase (MnSOD), catalase, peroxiredoxins 3 and 5 (Prx3, Prx5), thioredoxin 2 (Trx2), thioredoxin reductase 2 (TR2), and uncoupling protein 2 (UCP-2) [47-49]. Taken together, we speculate that the effect of miR-22 on induction of mitochondrial injury might not be attributed to directly target mitochondrial antioxidant genes. The possibility remains, however, that H/R induced upregulation of miR-22 might lead to suppression of mitochondrial antioxidant genes through targeting Sirt1 and PGC1α. Notably, Sirt1 has been found to control PGC1α expression in a variety of cell types [50-52], although little is known about the mechanism involved. In skeletal muscle cells, Amat et al [52] demonstrate that Sirt1 interacts with and deacetylates PGC1α, consequently increasing PGC1α activity on its own promoter through interactions with myogenic determining factor (MyoD). This study indicates a positive autoregulatory loop of Sirt1-dependent PGC1α expression in skeletal muscle. In addition, at the PGC1α promoter, there are binding sites for transcription factors myocyte enhancer factor 2 (MEF2), forkhead box class-O (FoxO), activating transcription factor 2 (ATF2), and cAMP response element–binding protein (CREB), all of which enhance PGC1α transcription [53]. Among these transcription factors, MEF2, FoxO family members, and CREB are known to be activated through Sirt1-mediated deacetylation [44,54,55]. Whether these transcription factors are involved in Sirt1-mediated PGC1α expression in cardiomyocytes merits further investigation. The presence of a nonfunctional area in myocardium resulting from I/R injury will increase mechanical loading in the surviving myocardium, which induces the global histopathological changes named ventricular remodeling, including cardiac hypertrophy and fibrosis [56]. It is generally accepted that adverse remodeling has a significant impact on global cardiac dysfunction

after myocardial I/R injury. Previous studies have shown that miR-22 per se is sufficient to induce cardiomyocyte hypertrophy [18]. However, the role of miR-22 in cardiac fibrosis remains controversial. Jazbutyte et al [33] show that miR-22 upregulation during cardiac aging leads to increased cellular chemotactic migration in cardiac fibroblasts, which may contribute to miR-22 dependent cardiac fibrosis during aging. In contrast, it has been demonstrated that miR-22 deficient mice exhibits exacerbated cardiac fibrosis induced by isoproterenol, calcineurin overexpression or pressure overload [18, 32]. These findings suggest the context-specific role of miR-22 in modulating cardiac fibrosis. In the present study, we demonstrated that miR-22 inhibitor could mediate acute protection against myocardial ischemia/reperfusion injury. A limitation is that we don’t observe whether miR-22 inhibitor has an impact on chronic ventricular remodeling and cardiac dysfunction after myocardial I/R injury, which merits future investigation. In summary, the present study suggests that upregulation of miR-22 may contribute to I/R-induced mitochondrial oxidative damage and cell injury through targeting Sirt1 and PGC1α in cardiomyocytes. Our findings reveal a novel molecular mechanism for cardiac mitochondrial dysfunction during myocardial I/R injury at the miRNA level and demonstrate the therapeutic potential of miR-22 inhibition for acute myocardial I/R injury by maintaining cardiac mitochondrial function. Acknowledgements This work was supported by Major State Basic Research Program of China (No.2013CB967404), National Natural Science Foundation of China (No.31571227, No.31171120, No. 31271241, No. 31271270). Conflict of interest The authors state no conflict of interest.

Reference [1] Pagidipati, N. J.; Gaziano, T. A. Estimating deaths from cardiovascular disease: a review of global methodologies of mortality measurement. Circulation 127:749-756; 2013. [2] Giugliano, R. P.; Braunwald, E. Selecting the best reperfusion strategy in ST-elevation myocardial infarction: it's all a matter of time. Circulation 108:2828-2830; 2003. [3] Raedschelders, K.; Ansley, D. M.; Chen, D. D. The cellular and molecular origin of reactive oxygen species generation during myocardial ischemia and reperfusion. Pharmacology & therapeutics 133:230-255; 2012. [4] Dhalla, N. S.; Elmoselhi, A. B.; Hata, T.; Makino, N. Status of myocardial antioxidants in ischemia-reperfusion injury. Cardiovascular research 47:446-456; 2000. [5] Chen, Y. R.; Zweier, J. L. Cardiac mitochondria and reactive oxygen species generation. Circulation research 114:524-537; 2014. [6] Sugamura, K.; Keaney, J. F., Jr. Reactive oxygen species in cardiovascular disease. Free radical biology & medicine 51:978-992; 2011. [7] Baines, C. P. The mitochondrial permeability transition pore and ischemia-reperfusion injury. Basic research in cardiology 104:181-188; 2009. [8] Shintani-Ishida, K.; Inui, M.; Yoshida, K. Ischemia-reperfusion induces myocardial infarction through mitochondrial Ca(2)(+) overload. Journal of molecular and cellular cardiology 53:233-239; 2012. [9] Lesnefsky, E. J.; Moghaddas, S.; Tandler, B.; Kerner, J.; Hoppel, C. L. Mitochondrial dysfunction in cardiac disease: ischemia--reperfusion, aging, and heart failure. Journal of molecular and cellular cardiology 33:1065-1089; 2001. [10] Greco, S.; Gaetano, C.; Martelli, F. HypoxamiR regulation and function in ischemic cardiovascular diseases. Antioxidants & redox signaling 21:1202-1219; 2014. [11] Ye, Y.; Perez-Polo, J. R.; Qian, J.; Birnbaum, Y. The role of microRNA in modulating myocardial ischemia-reperfusion injury. Physiological genomics 43:534-542; 2011. [12] Cheng, Y.; Zhu, P.; Yang, J.; Liu, X.; Dong, S.; Wang, X.; Chun, B.; Zhuang, J.; Zhang, C. Ischaemic preconditioning-regulated miR-21 protects heart against ischaemia/reperfusion injury via anti-apoptosis through its target PDCD4. Cardiovascular research 87:431-439; 2010. [13] Wang, X.; Ha, T.; Liu, L.; Zou, J.; Zhang, X.; Kalbfleisch, J.; Gao, X.; Williams, D.; Li, C. Increased expression of microRNA-146a decreases myocardial ischaemia/reperfusion injury. Cardiovascular research 97:432-442; 2013. [14] Wang, J. X.; Jiao, J. Q.; Li, Q.; Long, B.; Wang, K.; Liu, J. P.; Li, Y. R.; Li, P. F. miR-499 regulates mitochondrial dynamics by targeting calcineurin and dynamin-related protein-1. Nature medicine 17:71-78; 2011. [15] Ye, Y.; Hu, Z.; Lin, Y.; Zhang, C.; Perez-Polo, J. R. Downregulation of microRNA-29 by antisense inhibitors and a PPAR-gamma agonist protects against myocardial ischaemia-reperfusion injury. Cardiovascular research 87:535-544; 2010. [16]Ren, X. P.; Wu, J.; Wang, X.; Sartor, M. A.; Qian, J.; Jones, K.; Nicolaou, P.; Pritchard, T. J.; Fan, G. C. MicroRNA-320 is involved in the regulation of cardiac ischemia/reperfusion injury by targeting heat-shock protein 20. Circulation 119:2357-2366; 2009. [17] Wang, L.; Tang, Z. P.; Zhao, W.; Cong, B. H.; Lu, J. Q.; Tang, X. L.; Li, X. H.; Zhu, X. Y.; Ni, X. MiR-22/Sp-1 Links Estrogens With the Up-Regulation of Cystathionine gamma-Lyase in

Myocardium, Which Contributes to Estrogenic Cardioprotection Against Oxidative Stress. Endocrinology 156:2124-2137; 2015. [18] Huang, Z. P.; Chen, J.; Seok, H. Y.; Zhang, Z.; Kataoka, M.; Hu, X.; Wang, D. Z. MicroRNA-22 regulates cardiac hypertrophy and remodeling in response to stress. Circulation research 112:1234-1243; 2013. [19] Gurha, P.; Wang, T.; Larimore, A. H.; Sassi, Y.; Abreu-Goodger, C.; Ramirez, M. O.; Reddy, A. K.; Engelhardt, S.; Taffet, G. E.; Wehrens, X. H.; Entman, M. L.; Rodriguez, A. microRNA-22 promotes heart failure through coordinate suppression of PPAR/ERR-nuclear hormone receptor transcription. PloS one 8:e75882; 2013. [20] Hsu, C. P.; Zhai, P.; Yamamoto, T.; Maejima, Y.; Matsushima, S.; Hariharan, N.; Shao, D.; Takagi, H.; Oka, S.; Sadoshima, J. Silent information regulator 1 protects the heart from ischemia/reperfusion. Circulation 122:2170-2182; 2010. [21] Yang, Y.; Duan, W.; Lin, Y.; Yi, W.; Liang, Z.; Yan, J.; Wang, N.; Deng, C.; Zhang, S.; Li, Y.; Chen, W.; Yu, S.; Yi, D.; Jin, Z. SIRT1 activation by curcumin pretreatment attenuates mitochondrial oxidative damage induced by myocardial ischemia reperfusion injury. Free radical biology & medicine 65:667-679; 2013. [22] Yao, L. L.; Huang, X. W.; Wang, Y. G.; Cao, Y. X.; Zhang, C. C.; Zhu, Y. C. Hydrogen sulfide protects cardiomyocytes from hypoxia/reoxygenation-induced apoptosis by preventing GSK-3beta-dependent opening of mPTP. American journal of physiology. Heart and circulatory physiology 298:H1310-1319; 2010. [23] Zhu, X. Y.; Liu, S. J.; Liu, Y. J.; Wang, S.; Ni, X. Glucocorticoids suppress cystathionine gamma-lyase expression and H2S production in lipopolysaccharide-treated macrophages. Cellular and molecular life sciences : CMLS 67:1119-1132; 2010. [24] Ji, L.; Zhang, X.; Liu, W.; Huang, Q.; Yang, W.; Fu, F.; Ma, H.; Su, H.; Wang, H.; Wang, J.; Zhang, H.; Gao, F. AMPK-regulated and Akt-dependent enhancement of glucose uptake is essential in ischemic preconditioning-alleviated reperfusion injury. PloS one 8:e69910; 2013. [25] Wang, C. N.; Duan, G. L.; Liu, Y. J.; Yu, Q.; Tang, X. L.; Zhao, W.; Li, X. H.; Zhu, X. Y.; Ni, X. Overproduction of nitric oxide by endothelial cells and macrophages contributes to mitochondrial oxidative stress in adrenocortical cells and adrenal insufficiency during endotoxemia. Free radical biology & medicine 83:31-40; 2015. [26] Vincent, A. M.; Kato, K.; McLean, L. L.; Soules, M. E.; Feldman, E. L. Sensory neurons and schwann cells respond to oxidative stress by increasing antioxidant defense mechanisms. Antioxidants & redox signaling 11:425-438; 2009. [27] Murugan, R. S.; Priyadarsini, R. V.; Ramalingam, K.; Hara, Y.; Karunagaran, D.; Nagini, S. Intrinsic apoptosis and NF-kappaB signaling are potential molecular targets for chemoprevention by black tea polyphenols in HepG2 cells in vitro and in a rat hepatocarcinogenesis model in vivo. Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association 48:3281-3287; 2010. [28] Lin, J.; Huo, R.; Xiao, L.; Zhu, X.; Xie, J.; Sun, S.; He, Y.; Zhang, J.; Sun, Y.; Zhou, Z.; Wu, P.; Shen, B.; Li, D.; Li, N. A novel p53/microRNA-22/Cyr61 axis in synovial cells regulates inflammation in rheumatoid arthritis. Arthritis & rheumatology 66:49-59; 2014. [29] Vurusaner, B.; Poli, G.; Basaga, H. Tumor suppressor genes and ROS: complex networks of interactions. Free radical biology & medicine 52:7-18; 2012. [30] Christodoulou, F.; Raible, F.; Tomer, R.; Simakov, O.; Trachana, K.; Klaus, S.; Snyman, H.;

Hannon, G. J.; Bork, P.; Arendt, D. Ancient animal microRNAs and the evolution of tissue identity. Nature 463:1084-1088; 2010. [31] Hu, Y.; Matkovich, S. J.; Hecker, P. A.; Zhang, Y.; Edwards, J. R.; Dorn, G. W., 2nd. Epitranscriptional orchestration of genetic reprogramming is an emergent property of stress-regulated cardiac microRNAs. Proceedings of the National Academy of Sciences of the United States of America 109:19864-19869; 2012. [32] Gurha, P.; Abreu-Goodger, C.; Wang, T.; Ramirez, M. O.; Drumond, A. L.; van Dongen, S.; Chen, Y.; Bartonicek, N.; Enright, A. J.; Lee, B.; Kelm, R. J., Jr.; Reddy, A. K.; Taffet, G. E.; Bradley, A.; Wehrens, X. H.; Entman, M. L.; Rodriguez, A. Targeted deletion of microRNA-22 promotes stress-induced cardiac dilation and contractile dysfunction. Circulation 125:2751-2761; 2012. [33] Jazbutyte, V.; Fiedler, J.; Kneitz, S.; Galuppo, P.; Just, A.; Holzmann, A.; Bauersachs, J.; Thum, T. MicroRNA-22 increases senescence and activates cardiac fibroblasts in the aging heart. Age 35:747-762; 2013. [34] Xu, X. D.; Song, X. W.; Li, Q.; Wang, G. K.; Jing, Q.; Qin, Y. W. Attenuation of microRNA-22 derepressed PTEN to effectively protect rat cardiomyocytes from hypertrophy. Journal of cellular physiology 227:1391-1398; 2012. [35] Goren, Y.; Kushnir, M.; Zafrir, B.; Tabak, S.; Lewis, B. S.; Amir, O. Serum levels of microRNAs in patients with heart failure. European journal of heart failure 14:147-154; 2012. [36] Li, Y.; Liu, X.; Rong, F. PUMA mediates the apoptotic signal of hypoxia/reoxygenation in cardiomyocytes through mitochondrial pathway. Shock 35:579-584; 2011. [37] Forini, F.; Kusmic, C.; Nicolini, G.; Mariani, L.; Zucchi, R.; Matteucci, M.; Iervasi, G.; Pitto, L. Triiodothyronine prevents cardiac ischemia/reperfusion mitochondrial impairment and cell loss by regulating miR30a/p53 axis. Endocrinology 155:4581-4590; 2014. [38] Huang, Z. P.; Wang, D. Z. miR-22 in cardiac remodeling and disease. Trends in cardiovascular medicine 24:267-272; 2014. [39] Chen, Z.; Qi, Y.; Gao, C. Cardiac myocyte-protective effect of microRNA-22 during ischemia and reperfusion through disrupting the caveolin-3/eNOS signaling. International journal of clinical and experimental pathology 8:4614-4626; 2015. [40] Yang, J.; Chen, L.; Yang, J.; Ding, J.; Li, S.; Wu, H.; Zhang, J.; Fan, Z.; Dong, W.; Li, X. MicroRNA-22 targeting CBP protects against myocardial ischemia-reperfusion injury through anti-apoptosis in rats. Molecular biology reports 41:555-561; 2014. [41] Zhang, J. G.; Ghosh, S.; Ockleford, C. D.; Galinanes, M. Characterization of an in vitro model for the study of the short and prolonged effects of myocardial ischaemia and reperfusion in man. Clinical science (London, England : 1979) 99:443-453; 2000. [42] Gerhart-Hines, Z.; Rodgers, J. T.; Bare, O.; Lerin, C.; Kim, S. H.; Mostoslavsky, R.; Alt, F. W.; Wu, Z.; Puigserver, P. Metabolic control of muscle mitochondrial function and fatty acid oxidation through SIRT1/PGC-1alpha. The EMBO journal 26:1913-1923; 2007. [43] Villena, J. A. New insights into PGC-1 coactivators: redefining their role in the regulation of mitochondrial function and beyond. The FEBS journal 282:647-672; 2015. [44] Winnik, S.; Auwerx, J.; Sinclair, D. A.; Matter, C. M. Protective effects of sirtuins in cardiovascular diseases: from bench to bedside. European heart journal 36:3404-3412; 2015. [45] Funk, J. A.; Schnellmann, R. G. Accelerated recovery of renal mitochondrial and tubule homeostasis with SIRT1/PGC-1alpha activation following ischemia-reperfusion injury. Toxicology and applied pharmacology 273:345-354; 2013.

[46] Bartz, R. R.; Suliman, H. B.; Piantadosi, C. A. Redox mechanisms of cardiomyocyte mitochondrial protection. Frontiers in physiology 6:291; 2015. [47] Danz, E. D.; Skramsted, J.; Henry, N.; Bennett, J. A.; Keller, R. S. Resveratrol prevents doxorubicin cardiotoxicity through mitochondrial stabilization and the Sirt1 pathway. Free radical biology & medicine 46:1589-1597; 2009. [48] Olmos, Y.; Sanchez-Gomez, F. J.; Wild, B.; Garcia-Quintans, N.; Cabezudo, S.; Lamas, S.; Monsalve, M. SirT1 regulation of antioxidant genes is dependent on the formation of a FoxO3a/PGC-1alpha complex. Antioxidants & redox signaling 19:1507-1521; 2013. [49]Alcendor, R. R.; Gao, S.; Zhai, P.; Zablocki, D.; Holle, E.; Yu, X.; Tian, B.; Wagner, T.; Vatner, S. F.; Sadoshima, J. Sirt1 regulates aging and resistance to oxidative stress in the heart. Circulation research 100:1512-1521; 2007. [50] El-Khamisy, S. F.; Saifi, G. M.; Weinfeld, M.; Johansson, F.; Helleday, T.; Lupski, J. R.; Caldecott, K. W. Defective DNA single-strand break repair in spinocerebellar ataxia with axonal neuropathy-1. Nature 434:108-113; 2005. [51] Lagouge, M.; Argmann, C.; Gerhart-Hines, Z.; Meziane, H.; Lerin, C.; Daussin, F.; Messadeq, N.; Milne, J.; Lambert, P.; Elliott, P.; Geny, B.; Laakso, M.; Puigserver, P.; Auwerx, J. Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC-1alpha. Cell 127:1109-1122; 2006. [52] Amat, R.; Planavila, A.; Chen, S. L.; Iglesias, R.; Giralt, M.; Villarroya, F. SIRT1 controls the transcription of the peroxisome proliferator-activated receptor-gamma Co-activator-1alpha (PGC-1alpha) gene in skeletal muscle through the PGC-1alpha autoregulatory loop and interaction with MyoD. The Journal of biological chemistry 284:21872-21880; 2009. [53] Fernandez-Marcos, P. J.; Auwerx, J. Regulation of PGC-1alpha, a nodal regulator of mitochondrial biogenesis. The American journal of clinical nutrition 93:884S-890; 2011. [54] Zhao, X.; Sternsdorf, T.; Bolger, T. A.; Evans, R. M.; Yao, T. P. Regulation of MEF2 by histone deacetylase 4- and SIRT1 deacetylase-mediated lysine modifications. Molecular and cellular biology 25:8456-8464; 2005. [55] Qiang, L.; Lin, H. V.; Kim-Muller, J. Y.; Welch, C. L.; Gu, W.; Accili, D. Proatherogenic abnormalities of lipid metabolism in SirT1 transgenic mice are mediated through Creb deacetylation. Cell metabolism 14:758-767; 2011. [56] Smiley, D.; Smith, M. A.; Carreira, V.; Jiang, M.; Koch, S. E.; Kelley, M.; Rubinstein, J.; Jones, W. K.; Tranter, M. Increased fibrosis and progression to heart failure in MRL mice following ischemia/reperfusion injury. Cardiovascular pathology : the official journal of the Society for Cardiovascular Pathology 23:327-334; 2014.

Figure Legend: Figure1. Upregulation of miR-22 contributes to myocardial injury upon to I/R insult. A, rats were subjected to myocardial ischemia for 30 min followed by reperfusion for 2 h. MiR-22

expression in myocardium was assessed by Quantitative real-time RT-PCR. B-G, 20 ug miR control or miR-22 inhibitor was delivered via intra-myocardial injection into the left ventricle myocardium. Forty eight hours later, rats were subjected to myocardial I/R. The area at risk and infarct size were determined by Evans blue and TTC staining. Representative photograph (B) and bar graph (C) showed the effect of miR-22 inhibitor on reducing infarct size in the rat model of myocardial I/R. D, representative TUNEL-stained cardiomyocytes in the myocardium slices. Green color is TUNEL staining representing apoptotic cells; Blue color is the cell nucleus stained by Hochest32258. E, The apoptotic cell number (%) is shown as a ratio of the number of apoptotic cells to the total cell number. F, serum LDH level. G, serum CK level. All bar graphs represent means

SEM (n=7). ** P<0.01 vs

sham; ## P<0.01vs I/R + miR control; $$ P<0.01 vs sham + miR control. Figure2. MiR-22 inhibitor attenuates, whereas miR-22 mimic aggravates H/R-induced injury in cultured cardiomyocytes. A, H9c2 were cultured in normoxia or hypoxia for 24 h (94% N2,5% CO2,1% O2) followed by reoxygenation for 2 h. MiR-22 expression in cardiomyocytes was assessed by Quantitative real-time RT-PCR . B-E, H9c2 were transfected with miR control, miR-22 mimic and/or miR-22 inhibitor (200 nM). Twenty four hours later, cells were exposed to H/R treatment. B, supernatant LDH concentration. C, overall cell viability was assessed by MTT. D, the apoptotic cell number (%) is shown as a ratio of the number of apoptotic cells to the total cell number. E, representative TUNEL-stained H9c2 cells. Red color is TUNEL staining representing apoptotic cells; Blue color is the cell nucleus stained by Hochest32258. All bar graphs represent means SEM (n=4). ** P<0.01 vs normoxia; ## P<0.01 vs normoxia + miR control; $$ P<0.01 vs H/R + miR control. Figure 3. H/R-induced upregulation of miR-22 is blocked by ROS scavenger and p53 inhibitor. A, H9c2 were treated with vehicle or 1mM NAC, then cultured in normoxia or hypoxia for 24 h (94%

N2,5% CO2,1% O2) followed by reoxygenation for 2 h. Protein levels of p53 and p21 were determined by western blot analysis. B, H9c2 were treated with vehicle, 1mM NAC or 20 uM p53 inhibitor pifithrin-α, then cultured in normoxia or hypoxia for 24 h (94% N2,5% CO2,1% O2) followed by reoxygenation for 2 h. MiR-22 expression was assessed by Quantitative real-time RT-PCR. All bar graphs represent means SEM (n=4). * P<0.05, ** P<0.01 vs normoxia; # P<0.05, ## P<0.01 vs H/R. Figure 4. miR-22 contributes to mitochondrial dysfunction induced by I/R in vivo and H/R in vitro. A-C, 20 ug miR control or miR-22 inhibitor was delivered via intra-myocardial injection into the left ventricle myocardium. Forty eight hours later, rats were subjected to myocardial ischemia for 30 min followed by reperfusion for 2 h. Mitochondria were isolated for determination of mitochondrial superoxide production (A), mitochondrial membrane potential loss (B), and mitochondria ATP production (C) (n=7). D-F, H9c2 were transfected with miR control, miR-22 mimic and/or miR-22 inhibitor (200 nM). Twenty four hours later, cells were cultured in normoxia or hypoxia for 24 h (94% N2,5% CO2,1% O2), followed by reoxygenation for 2 h. Cells were then used for determination of mitochondrial superoxide production (D), mitochondrial membrane potential loss (E), and mitochondrial ATP production (F) (n=4). All bar graphs represent means SEM. ** P<0.01 vs sham + miR control; # P<0.05, ## P<0.01 vs I/R + miR control; $$ P<0.01 vs normoxia+ miR control; && P<0.01 vs H/R+ miR control. Figure 5. miR-22 suppresses Sirt1 and PGC1α expression in cardiomyocytes. A-D, H9c2 were transfected with miR control or miR-22 mimic (200 nM) for 24 h. Quantitative real-time RT-PCR and Western blot analysis were used to determine Sirt1 (A&B), PGC1α (C&D) mRNA and protein expression in cardiomyocytes, respectively. E-F, Sirt1 and PGC1α contain highly conserved

miR-22-mRNA interaction motifs within their 3’UTRs, and the sequences of the wild type and mutant 3’UTR of Sirt1, PGC1α for luciferase reporter assay were shown, respectively. G-H, H9c2 cotransfected with 0.4ug wild-type (WT) or mutant Sirt1 (G) or PGC1α (H) 3’UTR reporter plasmids in the presence of miR control or miR22 mimic (200 nM). Twenty four hours later, luciferase activity was measured using dual luciferase assay. All bar graphs represent means SEM (n=4). **P<0.01 vs miR control. Figure 6. Silencing of Sirt1 abolishes the stimulatory effect of miR-22 inhibitor on H/R-induced downregulation of both Sirt1 and PGC1α in cardiomyocytes. H9c2 were transfected with control siRNA or Sirt1 siRNA. Twenty four hours later, cells were transfected with miR control or miR-22 inhibitor (200 nM) for another 24 hours. H9c2 were then cultured in normoxia or hypoxia for 24 h (94% N2, 5% CO2, 1% O2), followed by reoxygenation for 2 h. Sirt1 (A) and PGC1α (B) protein expression were determined by western blot analysis. All bar graphs represent means

SEM (n=4). *

P<0.05, ** P<0.01 vs normoxia + miR control + control siRNA; # P<0.05, ## P<0.01 vs H/R+ miR control + control siRNA; $$ P<0.01 vs H/R + miR-22 inhibitor + control siRNA. Figure 7.

Silencing of Sirt1 abolishes the protective effect of miR-22 inhibitor against

H/R-induced mitochondrial dysfunction in cardiomyocytes. H9c2 cardiomyocytes were transfected with control siRNA or Sirt1 siRNA (100 nM) for 24 h. Twenty four hours later, cells were transfected with miR control or miR-22 inhibitor (200 nM) for another 24 hours. Then, cells were cultured in normoxia or hypoxia for 24 h (94% N2, 5% CO2, 1% O2), followed by reoxygenation for 2 h. Cells were finally collected and used for determination of mitochondrial superoxide production (A), mitochondrial membrane potential loss (B), and mitochondrial ATP production (C). All bar graphs represent means

SEM (n=4). ** P<0.01 vs normoxia + miR control + control siRNA; ##

P<0.01 vs H/R + miR control + control siRNA; $$ P<0.01 vs H/R+ miR-22 inhibitor + control siRNA. Figure 8. Silencing of Sirt1 abolishes the protective effect of miR-22 inhibitor against H/R-induced cell injury in cardiomyocytes. H9c2 were transfected with control siRNA or Sirt1 siRNA (100 nM). Twenty four hours later, cells were transfected with miR control or miR-22 inhibitor (200 nM) for another 24 hours. H9c2 cells were then cultured in normoxia or hypoxia (94% N2, 5% CO2, 1% O2) for 24 h, followed by reoxygenation for 2 h. A, representative TUNEL-stained H9c2 cells. Red color is TUNEL staining representing apoptotic cells; Blue color is the cell nucleus stained by Hochest32258. B, the apoptotic cell number (%) is shown as a ratio of the number of apoptotic cells to the total cell number. C, supernatant LDH concentration. D, overall cell viability was assessed by MTT. All bar graphs represent means

SEM (n=4). ** P<0.01vs normoxia + miR

control + control siRNA; # P<0.05, ## P<0.01 vs H/R + miR control + control siRNA. $$ P<0.01 vs H/R + miR 22 inhibitor + control siRNA.

List of figures: Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Graphical abstract:

Highlights 

Upregulation of miR-22 contributes to myocardial I/R injury.



MiR-22 causes mitochondrial dysfunction and cell injury by targeting Sirt1/ PGC1α.



H/R-induced upregulation of miR-22 may be due to ROS-induced activation of p53.



The therapeutic potential of miR-22 inhibition for acute myocardial I/R injury.