Uptake of leptin and albumin via separate pathways in proximal tubule cells

The International Journal of Biochemistry & Cell Biology 79 (2016) 194–198

Contents lists available at ScienceDirect

The International Journal of Biochemistry & Cell Biology journal homepage: www.elsevier.com/locate/biocel

Short communication

Uptake of leptin and albumin via separate pathways in proximal tubule cells Jessica F. Briffa a,b , Esther Grinfeld a , Philip Poronnik c , Andrew J. McAinch a , Deanne H. Hryciw a,b,∗ a

Centre For Chronic Disease, College of Health and Biomedicine, Victoria University, St. Albans, VIC 3021, Australia Department of Physiology, The University of Melbourne, Parkville, Melbourne, VIC 3010, Australia c School of Medical Sciences, The Bosch Institute, The University of Sydney, NSW 2006, Australia b

a r t i c l e

i n f o

Article history: Received 4 May 2016 Received in revised form 15 August 2016 Accepted 29 August 2016 Available online 1 September 2016 Keywords: Leptin Albumin Proximal tubule Megalin NHERF2

a b s t r a c t The adipokine leptin and oncotic protein albumin are endocytosed in the proximal tubule via the scavenger receptor megalin. Leptin reduces megalin expression and activates cell signalling pathways that upregulate fibrotic protein expression. The aim of this study was to investigate if leptin uptake in proximal tubule cells was via the albumin-megalin endocytic complex. In immortalised proximal tubule Opossum kidney cells (OK) fluorescent leptin and albumin co-localised following 5 min exposure, however there was no co-localisation at 10, 20 and 30 min exposure. In OK cells, acute exposure to leptin for 2 h did not alter NHE3, ClC-5, NHERF1 and NHERF2 mRNA. However, acute leptin exposure increased NHERF2 protein expression in proximal tubule cells. In OK cells, immunoprecipitation experimentation indicated leptin did not bind to ClC-5. Leptin uptake in OK cells was enhanced by bafilomycin and ammonium chloride treatment, demonstrating that uptake was not dependent on lysosomal pH. Thus, it is likely that two pools of megalin exist in proximal tubule cells to facilitate separate uptake of leptin and albumin by endocytosis. © 2016 Published by Elsevier Ltd.

1. Introduction Obesity is a major risk factor for the development of chronic kidney disease, which may lead to dialysis and ultimately end stage renal failure (Li et al., 2007). In animal models and humans, obesity alters the kidney leading to glomerular hypertrophy, thickening of the glomerular basement membrane, mesangial matrix expansion (Santo et al., 2004), renal inflammation and tubular fibrosis (Nagai et al., 2005). Current studies investigating the link between kidney disease and obesity have focused on the adipokine, leptin (Johnson et al., 1992), with plasma leptin concentrations reflecting the degree of adiposity. In healthy individuals, the concentration of leptin in the plasma in vivo is approximately 5.48 ng/ml, with pathophysiolog-

Abbreviations: AMPK-5 , adenosine monophosphate-activated protein kinase; ClC-5, chloride channel-5; NHE3, sodium hydrogen exchanger 3; NHERF, sodium hydrogen exchanger regulatory factor; OK, opossum kidney; TGF␤1, transforming growth factor ␤1. ∗ Corresponding author at: Department of Physiology, The University of Melbourne, Parkville, Melbourne, VIC 3010, Australia. E-mail address: [email protected] (D.H. Hryciw). http://dx.doi.org/10.1016/j.biocel.2016.08.031 1357-2725/© 2016 Published by Elsevier Ltd.

ical levels between 5 and 40 times higher (Maffei et al., 1995; Oka et al., 2007). Leptin is completely cleared from the filtrate by the scavenger receptor megalin in the proximal tubule (Cumin et al., 1997; Johnson et al., 1992). Megalin is responsible for the endocytosis of a number of low molecular weight proteins from the glomerular filtrate, including albumin. Megalin facilitates albumin endocytosis via a complex containing the Na+ –H+ exchanger (NHE) 3 (Biemesderfer et al., 2001), the Na+ /H+ Exchange Regulator Factor (NHERF) 1 (Eknoyan, 2007), the chloride channel (ClC)-5 and NHERF2 (Campbell and White, 2008). Once internalised, albumin is believed to be degraded by the lysosomal pathway (Christensen and Birn, 2002). Recent research has also established that albumin can be transcytosed via the neonatal Fc receptor (FcRn), which sorts albumin from the early endosomes to the transcytotic pathway (Tenten et al., 2013). Recently, we have demonstrated that acute exposure to leptin decreases megalin expression in Opossum Kidney (OK) proximal tubule cells via a 5 adenosine monophosphate-activated protein kinase (AMPK) mediated pathway (Briffa et al., 2015b). Despite the reduction in megalin, albumin endocytosis is unaltered until cells are exposed to supraphysiological concentrations of leptin (Briffa et al., 2015b). This suggests that albumin endocytosis in the presence of leptin is not limited by the availability of megalin.

J.F. Briffa et al. / The International Journal of Biochemistry & Cell Biology 79 (2016) 194–198

Therefore, the aim of this study is to investigate if leptin and albumin are internalised into the tubular cells via the same megalin-mediated macromolecular complex. Our hypothesis is that leptin will be associated with a complex containing albumin, ClC-5, NHERF2 and megalin in proximal tubule cells.

195

2. Materials and methods

to housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). ‘Real – time’ PCR reactions were run for 50 cycles of 95 ◦ C for 15 s and 60 ◦ C for 60 s. Relative changes in mRNA abundance was quantified using the 2−CT method as previously detailed (Ryberg et al., 2007) and reported in arbitrary units (normalised to GAPDH). CT values for GAPDH were not altered by leptin treatment (data not shown).

2.1. Cell culture

2.4. Protein extraction and western blot analysis

The opossum kidney (OK) cells were maintained in DMEM/Ham’s F-12 (DMEM/F-12) media supplemented with 10% fetal bovine serum, penicillin/streptomycin and incubated at 37 ◦ C in 5% CO2 . For experimental protocols, OK cells were seeded at confluence and grown for 5 days. Two days prior to experimentation, cells were incubated in DMEM/F-12 with 5 mM glucose medium lacking serum (containing no albumin: minus media). For each experiment n ≥ 3 independent experiments.

OK proximal tubule cells were serum starved for 2 days in minus media (Hryciw et al., 2006, 2004a), then treated with human recombinant leptin (ProSpec; New Jersey, USA) for 2 h at 0.05, 0.10, 0.25 and 0.50 ␮g/ml concentrations. Protein was isolated as described previously (Briffa et al., 2015b). Briefly, following treatment, the cells were lysed with IP lysis buffer (10 mM Tris–HCl, 150 mM NaCl, 1% NP-40; with the pH adjusted to 7.5) supplemented with a Complete Mini Protease Inhibitor Cocktail (Roche; NSW, Australia) and Halt Phosphatase Inhibitor Cocktail (ThermoScientific; Victoria, Australia). Equal aliquots (50 ␮g of protein) from each treatment then underwent Western blotting. Aliquots (50 ␮g) of the protein samples were separated on a 4–15% SDS-PAGE gel and transferred onto a nitrocellulose membrane. Membranes were probed with antibodies against ClC-5, NHE3, NHERF1 and NHERF2 (Santa Cruz Biotechnology, Texas, USA) as described (He et al., 2008). All Western blot data was quantified densitometrically using Image J software.

2.2. Confocal Previous research has demonstrated that megalin binds to both leptin (Briffa et al., 2015c) and albumin in the proximal tubule (Cui et al., 1996) and that albumin is internalised into vesicles (Zhai et al., 2000) following 2 min exposure (Devuyst et al., 1999). We therefore investigated if albumin and leptin co-localise. OK proximal tubule cells were serum starved for 48 h in minus media, then treated with 0.05 ␮g/ml human recombinant leptin (ProSpec; New Jersey, USA) and 50 ␮g/ml Texas Red albumin (TR-albumin: Molecular Probes; Oregon, USA) for 5, 10, 20 and 30 min. Following treatment cells were fixed with 4% paraformaldehyde (Sigma-Aldrich; Sydney, Australia) and blocked with goat serum (Sigma-Aldrich; Sydney, Australia). Cells were then treated with leptin antibody, followed by goat anti-rabbit conjugated to fluorescein isothiocyanate (FITC) (Sigma-Aldrich; Sydney, Australia). Cells were then mounted using FluroSave (Merck Millipore; Victoria, Australia) and analyzed by confocal microscopy using the Zeiss LSM Pascal (NSW, Australia). 2.3. ‘Real – time’ polymerase chain reaction (PCR) OK cells were serum starved for 2 days in minus media (Hryciw et al., 2004a), then treated with human recombinant leptin (ProSpec; New Jersey, USA) for 2 h at 0.05, 0.10, 0.25 and 0.50 ␮g/ml concentrations (Briffa et al., 2015b). RNA was isolated from OK cells using the TRIzol method (Cornall et al., 2011). Briefly, the RNA was DNase treated, first strand cDNA was then generated from 0.5 ␮g of template RNA using the commercially available iScriptTM cDNA synthesis kit (Bio-Rad Laboratories, Hercules, USA) using random hexamers and oligo dTs as described previously (Ryberg et al., 2007). ‘Real – time’ PCR was conducted using MyiQTM single colour ‘real-time’ PCR detection system (BioRad Laboratories, Hercules, CA) with iQTM SYBR Green Supermix (Bio-Rad Laboratories, Hercules, USA) as the fluorescent agent. Forward and reverse oligonucleotide primers for the genes of interest were designed using OligoPerfectTM Suite (Invitrogen, Melbourne, Australia). Primer sequences: NHE3 F: 5 GGAGGCCACCAACTATGAAG 3 and R: 5 TCAGGGGAGAACACAGGATT 3 , ClC-5 F: 5 TGTCCCGAGAGTCACAAAGA 3 and R: 5 ATGATGGACGTGCTCACAAC 3 , NHERF1 F: 5 AGATCTGCCTCCAGCGATAC 3 and R: 5 CCAGGGAGATGTTGAAGTCC 3 , NHERF2 F: 5 TGGCTCTCCTGCTTCTCTCT 3 and R: 5 TCCTCCTGTGCCTTGATTCT 3 . Selective gene homology was confirmed using BLAST analysis (National Centre for Biotechnology Information, Bethesda, USA). To compensate for variations in RNA input amounts and reverse transcriptase efficiency mRNA abundance of the genes of interest were normalised

2.5. Immunoprecipitation Immunoprecipitation was performed as described previously (Briffa et al., 2015b). OK cells were seeded onto 175 cm2 flasks and grown to confluence, and then serum starved for 48 h. The cells were treated with either control (phosphate buffered saline: PBS) or human recombinant leptin (ProSpec; New Jersey, USA) for 15 min at 0.05 or 0.50 ␮g/ml. Protein was then isolated from OK cells using immunoprecipitation (IP) lysis buffer (10 mM Tris-HCl, 150 mM NaCl, 5% NP-40 with the pH adjusted to 7.5) supplemented with a Complete Mini Protease Inhibitor Cocktail (Roche; NSW, Australia). IPs were performed on one mg protein from each treatment. Cells were incubated overnight at 4 ◦ C with no antibody, Normal Rabbit IgG (Merck Millipore; Victoria, Australia) or Leptin antibody (ThermoScientific; Victoria, Australia) with end-to-end rotation. The next day 50 ␮l pre-cleared Protein G Agarose (ThermoFisher Scientific; Victoria, Australia) was added to each treatment and inverted with end-to-end rotation at 4 ◦ C for 5 h. The eppendorf tubes were then centrifuged and the supernatant was discarded, and the beads were washed with IP lysis buffer. 50 ␮l Laemmli Sample Buffer was then added to each treatment, and heated to 100 ◦ C for 10 min. The treatments were then centrifuged and equal aliquots (10 ␮l) of each treatment were analyzed by Western blot, as described previously, and probed for ClC-5. 2.6. FITC-leptin endocytosis Confluent monolayers of OK cells in 48 well plates were incubated in minus media for 48 h. Cells were pre-treated for 1 h with 0.1 ␮M bafilomycin, 20 mM ammonium choloride or 2 ␮M latrunculin (Gekle et al., 1995). Monolayers were washed in HEPESRinger buffer (122.5 mM NaCl, 5.4 mM KCl, 1.2 mM CaCl2 , 0.8 mM MgCl2 , 0.8 mM Na2 HPO4 , 0.2 mM NaH2 PO4 , 5.5 mM glucose, 10 mM HEPES; pH 7.4) and incubated with 0.05 ␮g/ml FITC leptin plus the inhibitors, for 30 min. Cells were washed in HEPES-Ringer buffer (pH 7.4) and lysed with MOPS buffer (20 mM MOPS with 0.1% v/v Triton X-100) (Hryciw et al., 2004b). Fluorescence was determined

196

J.F. Briffa et al. / The International Journal of Biochemistry & Cell Biology 79 (2016) 194–198

in cell lysates using spectrophotometry and standardized to protein concentration. 2.7. Statistical analysis

Table 1 Exposure to elevated leptin does not alter NHE3, ClC-5, NHERF1 or NHERF2 mRNAisolated from OK cells exposed to leptin (0.05 ␮g to 0.5 ␮g/ml) for 2 h. mRNA concentrations are expressed as arbitrary units (normalised to glyceraldehyde 3phosphate dehydrogenase). Leptin (␮g/ml) NHE3

All statistical analyses were conducted using PASW statistics version 18 (SPSS Inc., Chicago, USA). All data is reported as mean ± SEM. Statistical significance was accepted at P < 0.05.

0 0.05 0.1 0.25 0.5

0.014 ± 0.021 0.018 ± 0.021 0.024 ± 0.023 0.026 ± 0.021 0.032 ± 0.031

ClC-5 0.037 ± 0.012 0.022 ± 0.013 0.032 ± 0.004 0.031 ± 0.011 0.026 ± 0.012

NHERF1 0.057 ± 0.021 0.053 ± 0.021 0.038 ± 0.012 0.065 ± 0.022 0.058 ± 0.022

NHERF2 0.011 ± 0.002 0.012 ± 0.001 0.008 ± 0.003 0.018 ± 0.007 0.011 ± 0.003

3. Results 3.1. Leptin co-localises with albumin in OK cells following short-term, but not long-term exposure In OK cells, it is well established that albumin is internalised into vesicles (Zhai et al., 2000) following 2 min exposure (Devuyst et al., 1999). To add to this, we have demonstrated that co-treatment with leptin and albumin for 5 min resulted in co-localisation of the two in OK proximal tubule cells (arrow: Fig. 1). Following 10 min treatment, albumin and leptin were no longer co-localised. The lack of co-localisation also occurred following 20 and 30 min of treatment (Fig. 1, n = 4). These data show that albumin and leptin co-localise only during the initial phase of endocytosis but not the latter stages.

3.2. Acute leptin exposure does not alter mRNA concentrations of ClC-5, NHE3, NHERF1 or NHERF2, but does increase NHERF2 protein To further characterise the pathway responsible for leptin uptake, we characterised the effects elevated leptin exposure has on expression of the albumin complex. We have previously shown that megalin protein (and not mRNA) is downregulated following acute exposure to leptin (Briffa et al., 2015b). Here we extended these findings and demonstrate acute leptin exposure did not alter ClC-5, NHE3, NHERF1 or NHERF2 mRNA (Table 1, n = 8). However NHERF2 protein was significantly increased in OK cells in response to acute leptin exposure at all concentrations (0.05, 0.10, 0.25 and 0.50 ␮g/ml; Fig. 2A and B, n = 4). Thus, the megalin associated transporters ClC-5 and NHE3, in addition to the microvillus scaffold, NHERF1, are not altered in response to leptin exposure. 3.3. Leptin does not bind to ClC-5 Leptin binds to megalin (Briffa et al., 2015b) and megalin binds to ClC-5 (Hryciw et al., 2012b). However, IP with anti-leptin antibody and probing with an anti-ClC-5 antibody did not identify an interaction between ClC-5 and leptin in proximal tubule cells (Fig. 3A, n = 3). Thus the interaction between megalin and leptin occurs independently of ClC-5. 3.4. Leptin uptake is not dependent on lysosomal pH in proximal tubule cells Albumin endocytosis is dependent on the pH of the endosomal pathway (Gekle et al., 1995). To modulate lysosomal pH, we treated cells with ammonium chloride and bafilomycin. Both ammonium chloride and bafilomycin significantly increased leptin uptake by the OK cell (Fig. 3B, n = 8). However, treatment with latrunculin, an inhibitor of actin polymerization, did not significantly alter leptin endocytosis (Fig. 3B, n = 8). Thus uptake of leptin may be enhanced via a reduction in lysosomal activity in OK cells. 4. Discussion

Fig. 1. Leptin and albumin co-localise in OK cells following short term (5 min) but not long term (> 5 min) exposure. OK cells exposed to TR-albumin (red) and leptin (green) for 5 min, areas of co-localisation (yellow) can be identified (arrow merged panel). OK cells exposed to TR-albumin (red) and leptin (green) for 10, 20 and 30 min respectively, have limited areas of co-localisation (yellow) (n = 4). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Both leptin and albumin are endocytosed by megalin. This study describes a co-localisation between leptin and albumin initially (5 min), but a loss of co-localisation in the latter stages of endocytosis. Our previous study showed that exposure of proximal tubule cells to elevated concentrations of leptin decreased megalin expression but did not alter albumin endocytosis (Briffa et al., 2015a). To add to this, our novel data demonstrate that exposure to elevated leptin increases NHERF2 protein expression. This suggests that the increased NHERF2 may facilitate the maintenance of albumin endocytosis, despite a reduction in megalin expression. Finally, we have demonstrated that leptin uptake occurs independently of ClC-5, and that uptake is not likely to lead to degradation in the lysosomal pathway.

J.F. Briffa et al. / The International Journal of Biochemistry & Cell Biology 79 (2016) 194–198

Fig. 2. Exposure to elevated leptin increases NHERF2 expression. Protein was isolated from OK cells exposed to leptin (0.05 ␮g to 0.5 ␮g/ml) for 2 h. Western blot analysis (A) and densitometry (B) indicated that protein from members of the endocytic complex were unaltered compared to OK cells treated with vehicle, specifically NHE3, ClC-5 and NHERF1 protein. However, leptin significantly increased NHERF2 protein in OK cells (n = 4).

In previous studies we have developed a model in which albumin endocytosis is modulated by the assembly of a macromolecular complex (Hryciw et al., 2012a). This complex includes NHERF2 bound to megalin and ClC-5 (Hryciw et al., 2012a) as well as other accessory proteins. In this study, we demonstrated that leptin and ClC-5 do not bind, suggesting that interaction between megalin and leptin occurs via a ClC-5 independent pathway. A previous study has determined that ClC-5 does not interact with megalin in the thyroid (Maritzen et al., 2006), which suggests that there must be pools of megalin dependent and independent of ClC-5 in some epithelia. At this time the exact pathway(s) responsible for leptin processing in the proximal tubule remains to be resolved. Alternative pathways for leptin transport have previously been demonstrated in epithelial intestinal cells in vitro (Cammisotto et al., 2010, 2007). In the intestine, leptin transport is via a transcytotic pathway mediated by the leptin receptor to deliver leptin intact to the basolateral membrane (Cammisotto et al., 2010, 2007). Therefore, in the proximal tubule, if leptin is transcytosed and retrieved intact by megalin, this would lead to an increased delivery of leptin to the peritubular network in obesity. Consequently the reduction in leptin clearance by the kidney would maintain the elevated circulating concentrations of leptin in obesity. In addition, previous research

197

Fig. 3. Leptin uptake in OK cells is via a ClC-5 independent pathway. A. Immunoprecipitation with anti-leptin antibody, and probing with an anti-ClC-5 antibody failed to identify an interaction between leptin and ClC-5 (n = 3). B. Leptin endocytosis using FITC-leptin demonstrated that leptin uptake was significantly increased in cells pre-treated with bafilomycin and ammonium chloride, but not with latrunculin (n = 8).

in thyrocytes has demonstrated that an alternative megalin ligand, thyroglobulin, is internalised via transcytosis (Marinó et al., 2001). Specifically, megalin-mediated uptake of thyroglobulin via transcytosis releases thyroglobulin from the basolateral membrane is dependent on vesicle pH, with inhibition of uptake occurring when cells are treated with chloroquinine and ammonium chloride (Marino et al., 2003). We demonstrate here that endocytosis of leptin is vesicle pH independent, as uptake is enhanced with chloroquinine or ammonium chloride treatment. These findings, in addition to the lack of vesicular co-localisation with albumin following 10 min exposure, suggest that transcytosis of leptin in proximal tubule cells may occur. Thus, transcytosis of leptin in the proximal tubules in obesity may account for the lack of leptin in the urine in obesity (Meyer et al., 1997). This may lead to an increased retention of leptin in the circulation which may augment a cycle of further damage. Future studies should more clearly define the specific pathway leptin is trafficked through the proximal tubule cells. Recent research has demonstrated that in the renal tubule, megalin-mediated uptake of toxic ligands may cause autolysosomal dysfunction due to impaired autophagy and an upregulation of fibrotic protein expression (Kuwahara et al., 2015). Previously we have demonstrated that elevated concentrations of leptin upregulates fibrotic protein expression via AMPK (Briffa et al., 2015c), which is a direct modulator of autophagy. Autophagy is a mechanism for bulk protein degradation leading to recycling of cells via

198

J.F. Briffa et al. / The International Journal of Biochemistry & Cell Biology 79 (2016) 194–198

the lysosomes (Kuwahara et al., 2015). Therefore, in addition to the reduction of leptin clearance in obesity, elevated leptin-uptake via megalin may impair autophagy and lead to fibrotic tubular damage. The findings from this study then further support our hypothesis (Briffa et al., 2015c) that suggests that elevated concentrations of leptin leads to albuminuria via an albumin-megalin indepedent mechanism. Consequently, further studies are needed to elucidate the specific pathway responsible for the processing of leptin by the renal tubule. In summary, our findings identify a leptin uptake pathway in proximal tubule cells that is independent of ClC-5 and lysosomal processing. Further, we also have demonstrated that leptin upregulates NHERF2 in proximal tubule cells. As leptin does not alter albumin endocytosis at physiological concentrations but does reduce total megalin concentrations (Briffa et al., 2015a), this suggests that the elevated NHERF2 concentration in response to leptin may lead to a maintenance of the availability of megalin for tubular endocytosis. Notwithstanding the differences between in vitro and in vivo models, this suggests that leptin may be taken up into proximal tubule cells via a transcytotic pathway which is separate from the macromolecular complex pathway. As megalin is essential for albumin endocytosis (Piwon et al., 2000), the increased NHERF2 expression may ensure that there is sufficient megalin receptor at the cell membrane for albumin uptake, under conditions where leptin is elevated. Conflict of interest The authors declare no conflict of interest. Acknowledgments Confocal images were taking using the Biological Optical Microscopy Platform at the University of Melbourne. JFB was supported by an Australian Postgraduate Award Scholarship. This work was supported by the Australian Government’s Collaborative Research Networks (CRN) program (AJM). References Biemesderfer, D., DeGray, B., Aronson, P.S., 2001. Active (9.6S) and inactive (21S) oligomers of NHE3 in microdomains of the renal brush border. J. Biol. Chem. 276, 10161–10167. Briffa, J.F., Grinfeld, E., Jenkin, K.A., Mathai, M.L., Poronnik, P., McAinch, A.J., et al., 2015a. Diet induced obesity in rats reduces NHE3 and Na/K −ATPase expression in the kidney. Clin. Exp. Pharmacol. Physiol. 10. Briffa, J.F., Grinfeld, E., Mathai, M.L., McAinch, A.J., Poronnik, P., Hryciw, D.H., 2015b. Acute leptin exposure reduces megalin expression and upregulates fibrotic markers in cultured renal proximal tubule cells. Mol. Cell. Endocrinol., http://dx.doi.org/10.1016/j.mce.2014. Briffa, J.F., Grinfeld, E., Mathai, M.L., Poronnik, P., McAinch, A.J., Hryciw, D.H., 2015c. Acute leptin exposure reduces megalin expression and upregulates TGFbeta1 in cultured renal proximal tubule cells. Mol. Cell. Endocrinol. 401, 25–34. Cammisotto, P.G., Gingras, D., Bendayan, M., 2007. Transcytosis of gastric leptin through the rat duodenal mucosa. Am. J. Physiol. Gastrointest. Liver Physiol. 293, G773–G779. Cammisotto, P.G., Bendayan, M., Sane, A., Dominguez, M., Garofalo, C., Levy, E., 2010. Receptor-Mediated transcytosis of leptin through human intestinal cells In vitro. Int. J. Cell Biol. 2010, 928169. Campbell, R., White, J., 2008. More choices than ever before: emerging therapies for type 2 diabetes. Diabet. Educ. 34, 518. Christensen, E.I., Birn, H., 2002. Megalin and cubilin: multifunctional endocytic receptors. Nat. Rev. Mol. Cell Biol. 3, 256–266. Cornall, L.M., Mathai, M.L., Hryciw, D.H., McAinch, A.J., 2011. Diet-induced obesity up-regulates the abundance of GPR43 and GPR120 in a tissue specific manner. Cell. Physil. Biochem. 28, 949–958. Cui, S., Verroust, P.J., Moestrup, S.K., Christensen, E.I., 1996. Megalin/gp330 mediates uptake of albumin in renal proximal tubule. Am. J. Physiol. 271, F900 = 7.

Cumin, F., Baum, H.P., Levens, N., 1997. Mechanism of leptin removal from the circulation by the kidney. J. Endocrinol. 155, 577–585. Devuyst, O., Christie, P.T., Courtoy, P.J., Beauwens, R., Thakker, R.V., 1999. Intra renal and subcellular distribution of the human chloride channel, CLC-5, reveals a pathophysiological basis for Dent’s disease. Hum. Mol. Genet. 8, 247–257. Eknoyan, G., 2007. Obesity, diabetes, and chronic kidney disease. Curr. Diab. Rep. 7, 449–453. Gekle, M., Mildenberger, S., Freudinger, R., Silbernagl, S., 1995. Endosomal alkalinization reduces Jmax and Km of albumin receptor-mediated endocytosis in OK cells. Am. J. Physiol. Renal Physiol. 268, F899–F906. He, Y., Hryciw, D.H., Carroll, M.L., Myers, S.A., Whitbread, A.K., Kumar, S., et al., 2008. The ubiquitin-protein ligase Nedd4-2 differentially interacts with and regulates members of the Tweety family of chloride ion channels. J. Biol. Chem. 283, 24000–24010. Hryciw, D.H., Ekberg, J., Lee, A., Lensink, I.L., Kumar, S., Guggino, W.B., et al., 2004b. Nedd4-2 functionally interacts with ClC-5: involvement in constitutive albumin endocytosis in proximal tubule cells. J. Biol. Chem. 279, 54996–55007. Hryciw, D.H., Jenkin, K.A., Simcocks, A.C., Grinfeld, E., McAinch, A.J., Poronnik, P., 2012b. The interaction between megalin and ClC-5 is scaffolded by the Na+-H+ exchanger regulatory factor 2 (NHERF2) in proximal tubule cells. Int. J. Biochem. Cell Biol. 44, 815–823. Hryciw, D.H., Ekberg, J., Lee, A., Lensink, I.L., Kumar, S., Guggino, W.B., et al., 2004a. Nedd4-2 functionally interacts with ClC-5: involvement in constitutive albumin endocytosis in proximal tubule cells. J. Biol. Chem. 279, 54996–55007. Hryciw, D.H., Ekberg, J., Ferguson, C., Lee, A., Wang, D., Parton, R.G., et al., 2006. Regulation of albumin endocytosis by PSD95/Dlg/ZO-1 (PDZ) scaffolds: interaction of Na+–H+ exchange regulatory factor-2 with ClC-5. J. Biol. Chem. 281, 16068–16077. Hryciw, D.H., Jenkin, K.A., Simcocks, A.C., Grinfeld, E., McAinch, A.J., Poronnik, P., 2012a. The interaction between megalin and ClC-5 is scaffolded by the Na(+)–H(+) exchanger regulatory factor 2 (NHERF2) in proximal tubule cells. Int. J. Biochem. Cell Biol. 44, 815–823. Johnson, M.R., Rice, K.C., Howlett, A., Melvin, L.S., Herkenham, M., 1992. The cannabinoid receptor-pharmacologic identification, anatomical localization and cloning. NIDA Res. Monogr. 119, 86–90. Kuwahara, S., Hosojima, M., Kaneko, R., Aoki, H., Nakano, D., Sasagawa, T., et al., 2015. Megalin-mediated tubuloglomerular alterations in high-fat diet-induced kidney disease. J. Am. Soc. Nephrol. JASN 7. Li, J., Poulikakos, P.I., Dai, Z., Testa, J.R., Callaway, D.J., Bu, Z., 2007. Protein kinase C phosphorylation disrupts Na+/H+ exchanger regulatory factor 1 autoinhibition and promotes cystic fibrosis transmembrane conductance regulator macromolecular assembly. J. Biol. Chem. 282, 27086–27099. Maffei, M., Halaas, J., Ravussin, E., Pratley, R.E., Lee, G.H., Zhang, Y., et al., 1995. Leptin levels in human and rodent: measurement of plasma leptin and ob RNA in obese and weight-reduced subjects. Nat. Med. 1, 1155–1161. Marinó, M., Andrews, D., Brown, D., McCluskey, R.T., 2001. Transcytosis of retinol-binding protein across renal proximal tubule cells after megalin (gp 330)-mediated endocytosis. J. Am. Soc. Nephrol. 12, 637–648. Marino, M., Lisi, S., Pinchera, A., Chiovato, L., McCluskey, R.T., 2003. Targeting of thyroglobulin to transcytosis following megalin-mediated endocytosis: evidence for a preferential pH-independent pathway. J. Endocrinol. Invest. 26, 222–229. Maritzen, T., Lisi, S., Botta, R., Pinchera, A., Fanelli, G., Viacava, P., et al., 2006. ClC-5 does not affect megalin expression and function in the thyroid. Thyroid 16, 725–730. Meyer, C., Robson, D., Rackovsky, N., Nadkarni, V., Gerich, J., 1997. Role of the kidney in human leptin metabolism. Am. J. Physiol. 273, E903–E907. Nagai, J., Christensen, E.I., Morris, S.M., Willnow, T.E., Cooper, J.A., Nielsen, R., 2005. Mutually dependent localization of megalin and Dab2 in the renal proximal tubule. Am. J. Physiol. Renal Physiol. 289, F569–F576. Oka, S., Nakajima, K., Yamashita, A., Kishimoto, S., Sugiura, T., 2007. Identification of GPR55 as a lysophosphatidylinositol receptor. Biochem. Biophys. Res. Commun. 362, 928–934. Piwon, N., Gunther, W., Schwake, M., Bosl, M.R., Jentsch, T.J., 2000. ClC-5 Cl− -channel disruption impairs endocytosis in a mouse model for Dent’s disease. Nature 408, 369–373. Ryberg, E., Larsson, N., Sjögren, S., Hjorth, S., Hermansson, N., Leonova, J., et al., 2007. The orphan receptor GPR55 is a novel cannabinoid receptor. Br. J. Pharmacol. 152, 1092–1101. Santo, Y., Hirai, H., Shima, M., Yamagata, M., Michigami, T., Nakajima, S., et al., 2004. Examination of megalin in renal tubular epithelium from patients with Dent disease. Pediatr. Nephrol. 19, 612–615. Tenten, V., Menzel, S., Kunter, U., Sicking, E.M., van Roeyen, C.R., Sanden, S.K., Kaldenbach, M., Boor, P., Fuss, A., Uhlig, S., Lanzmich, R., Willemsen, B., Dijkman, H., Grepl, M., Wild, K., Kriz, W., Smeets, B., Floege, J., Moeller, M.J., 2013. Albumin is recycled from the primary urine by tubular transcytosis. J. Am. SoC. Nephrol. 24 (December (12)), 1966–1980. Zhai, X.Y., Nielsen, R., Birn, H., Drumm, K., Mildenberger, S., Freudinger, R., et al., 2000. Cubilin- and megalin-mediated uptake of albumin in cultured proximal tubule cells of opossum kidney. Kidney Int. 58, 1523–1533.