- Email: [email protected]
Urocortin in human placenta and maternal plasma
Peptides 20 (1999) 205–209
Urocortin in human placenta and maternal plasma Fumie Watanabea, Yutaka Okia,*, Megumi Ozawaa, Masahiro Masuzawaa, Masayasu Iwabuchia, Teruya Yoshimia, Tomizo Nishiguchib, Kazumi Iinoc, Hironobu Sasanoc a
Second Division, Department of Medicine, Hamamatsu University School of Medicine, 3600 Handa– cho, Hamamatsu, 431–31, Japan Department of Gynecology and Obstetrics, Hamamatsu University School of Medicine, 3600 Handa– cho, Hamamatsu, 431–31, Japan c Second Department of Pathology, Tohoku University School of Medicine, 2–1 Seiryo– cho, Aoba– ku, Sendai, 980, Japan
b
Received 26 May 1998; accepted 8 July 198
Abstract Plasma immunoreactive (IR-) urocortin (Ucn) and corticotropin-releasing factor (CRF) levels in pregnant women were measured by their specific radioimmunoassays after extraction. Although plasma IR–CRF levels were increased in pregnant women as compared to men and non-pregnant women, there was no difference of plasma IR–Ucn levels among groups. Ucn mRNA was detected in cytotrophoblasts and syncytiotrophoblasts by in situ hybridization. A reverse-phase high-performance liquid chromatography (HPLC) showed the major peak of IR–Ucn in placenta and plasma that had similar chromatographic mobility to synthetic Ucn1– 40. These data suggest that Ucn is produced and processed into the same form of synthetic Ucn in placenta, but not secreted into maternal blood. © 1999 Elsevier Science Inc. All rights reserved. Keywords: Urocortin; Corticotropin-releasing factor; Placenta; Pregnancy; mRNA
1. Introduction Urocortin (Ucn) has been cloned as a new member of the corticotropin releasing factor (CRF) family in rat and human [2,19]. It is localized in central nervous system, digestive system, and endocrine system [5,8,11], and coded to human chromosome 2 [2]. Ucn shows 95% sequence identity between rat and human [2]. The synthetic urocortin binds to all 3 types of CRF receptors and CRF-binding protein (CRF-BP) [2] and stimulated adrenocorticotropin release from anterior pituitary cells [2,9,19]. It has been known that the placenta is an important source of CRF and CRF-BP [3,12,17,18]. The placenta secrets large amount of CRF into human maternal blood and fetal circulation during pregnancy [4,6,15,16]. There was a significant correlation between maternal plasma CRF levels and gestational weeks [1,6,16]. Recently, it was reported that the human placenta expresses Ucn mRNA and contains the immunoreactive
* Corresponding author. Tel.: 181-11-53-435-2263; fax: 181-11-53435-2354. E-mail address: [email protected] (Y. Oki)
Ucn peptide [10]. Thus, we examined whether Ucn is secreted into maternal blood in the same manner as CRF.
2. Materials and methods 2.1. Reagents Synthetic human Ucn1– 40 and rat/human (r/h)CRF1– 41 were purchased from Peptide Institute Co. Ltd. (Osaka, Japan). Other chemicals were purchased from Katayama Chemical (Osaka, Japan). 2.2. Subjects All subjects participating in this study gave informed consent. Twenty-four pregnant women, aged 23–35 years, 6 non-pregnant women, aged 23–32 years, and 5 men, aged 25–35 years were studied between 9:00 a.m. and 12:00 p.m. Six pregnant women were in the first trimester of pregnancy (up to 14 weeks), 8 were in the second trimester (15–27 weeks), and 10 were in the third trimester (after 28 weeks). All were in good health and none were taking any medication.
0196-9781/99/$ – see front matter © 1999 Elsevier Science Inc. All rights reserved. PII: S 0 1 9 6 - 9 7 8 1 ( 9 9 ) 0 0 1 7 5 - 2
206
F. Watanabe et al. / Peptides 20 (1999) 205–209
2.3. Plasma collection and extraction Blood was collected in ice-chilled glass tubes containing EDTA-disodium at 1 mg/ml blood, and immediately centrifuged at 4°C for 15 min. Plasma was stored at 235°C until extraction. Ucn was extracted from plasma as follows. Plasma was mixed with an equal volume of 6 M guanidine HCl, and the mixture (2 ml) was applied onto Sep–Pak C-18 (Waters Associates, Milford, MA). The column was washed twice with 10 ml distilled water, and then eluted with 4 ml of 70% acetonitrile-0.01% trifluoroacetic acid (TFA). The extracts were lyophilized, reconstituted with radioimmunoassay (RIA) buffer (63 mM Na2HPO4, 12.7 mM EDTANa2, 250 KIU/ml aprotinin, 0.05% NaN3 and 0.1% Triton X 100, pH 7.4) and assayed in duplicate for Ucn immunoreactivity. The recovery of synthetic human Ucn (50 pg/ml) added to silicic acid-treated plasma was 42.5%. Plasma CRF was extracted from plasma by the same procedure as in the case of Ucn substituting 60% acetonitrile/0.5% acetic acid as an eluent. The recovery of synthetic r/hCRF (50 pg/ml) added to silicic acid-treated plasma was 62.7%. Plasma Ucn and CRF levels were not corrected with the recovery rate. 2.4. Extraction of placenta Four term placentas were collected and stored at 280°C until extraction. The placenta was cut into pieces and rinsed with saline at 4°C. Each placenta (100 mg) was placed in 1 ml extraction buffer (63 mM Na2HPO4, 12.7 mM EDTANa2, pH 7.4), incubated at 98°C for 10 min, and homogenized with a polytron homogenizer as previously reported [5]. The homogenate was centrifuged at 10,000 3 g for 30 min, and the supernatant was lyophilized. The dried extract was reconstituted with RIA buffer and subjected to RIAs. The recovery rate of synthetic Ucn added to placenta homogenate was 84.6%. 2.5. HPLC An aliquot (100 ml) of tissue or plasma extract was injected onto a HPLC column (Wakosil-II3C18, 4.6 3 100 mm, Wako Chemical Co., Tokyo, Japan). The column was pre-equilibrated with 0.1% TFA/20% acetonitrile. A linear gradient, from 20 to 70% of acetonitrile in 0.1% TFA at a flow rate of 1 ml, was applied over 50 min. One milliliter samples were collected in an automatic fraction collector, lyophilized to dryness, reconstituted with RIA buffer, and assayed for IR–Ucn determination. A standard of 5 mg of human Ucn1– 40 was injected to determine a chromatographic profile by absorbance at A215.
Ucn21–35 coupled to bovine thyroglobulin with glutaraldehyde. Synthetic peptide [Tyr]18-Ucn19 –37 was iodinated by the chloramine T method, purified by Sephadex G-25 gelchromatography, and used as a tracer. Human Ucn was used as reference standard. The separation of bound and free tracer was performed by double antibody method as described previously [8]. The minimum detection limit of plasma IR–Ucn was 4 pg/ml. The intra- and inter-assay coefficients of variation were 6% and 11%, respectively. The assay did not crossreact with r/hCRF, ovine CRF, urotensin I or sauvagine [8]. The r/hCRF-RIA was also developed by ourselves and the characteristics have been reported previously [7]. This assay did not crossreact with human Ucn up to 480 ng/ml. The minimum detection limit of plasma IR–CRF was 2.5 pg/ml. 2.7. Tissue preparation Cesarean placentas were fixed in 4% paraformaldehyde containing 0.5% glutaraldehyde for 18 h at 4°C for in situ hybridization study. 2.8. In situ hybridization In situ hybridization for visualizing Ucn mRNA was performed by use of a manual capillary actions system (MicroProbe staining system, Fisher Scientific, Pittsburgh, PA) as reported previously [5]. The sequence of the 28-base oligonucleotide probe used for in situ hybridization analysis consisted of ATTGACCTCACCTTTCACCTGCTGCGGA (nucleotides 305–332). Because oligonucleotide probe was used as a negative control. The probes were synthesized with a 39-biotinylated tail (Brigati tail; 59-probe-biotinbiotin-biotin-TAG-TAG-biotin-biotin-biotin-39). After hybridization, the sections were incubated with alkaline phosphatase-conjugated streptavidin. After washing, hybridization products were visualized as red using fast red salt. The slides were counterstained with hematoxylin, air-dried, and coverslipped for microscopic examination. 2.9. Statistics The results are expressed as the mean 6 SEM. Statistical analysis was performed by one-way ANOVA, followed by Scheffe’s multiple comparison test. Correlation between plasma peptide levels and gestational weeks was analyzed by a standard multiple regression analysis. p , 0.05 was considered significant. 3. Results
2.6. RIAs
3.1. Immunoreactive IR–Ucn concentration in maternal plasma
The specific antiserum against Ucn was raised in New Zealand white rabbit by repeated injections of synthetic
Plasma IR–Ucn levels were detected in all subjects, but there was no difference of plasma IR–Ucn concentrations
F. Watanabe et al. / Peptides 20 (1999) 205–209
207
Table 1 Plasma IR-Ucn and IR-CRF concentrations in men, non-pregnant and pregnant women No. of subjects Men Non-pregnant women Pregnant women 1st trimester 2nd trimester 3rd trimester
Plasma IR-Ucn pg/ml
5 6
16.6 6 5.5 12.8 6 1.9
6 8 10
17.5 6 1.9 16.6 6 2.7 12.8 6 1.8
Plasma IR-CRF pg/ml 9.1 6 1.1 9.3 6 1.5 47.7 6 10.7* 72.0 6 11.9*,** 99.6 6 16.8*,**
The results represent the mean 6 SEM. * p , 0.05 versus non-pregnant women. ** p , 0.05 versus 1st trimester.
among groups (Table 1). Plasma IR–Ucn concentrations did not correlate with the weeks of pregnancy (p . 0.1, Fig. 1). Plasma IR–CRF levels significantly increased in pregnant women in the second and third trimesters as compared to non-pregnant women and pregnant women of the first trimester (Table 1), and correlated well with gestational weeks (R 5 0.54, p , 0.01, Fig. 2). 3.2. IR–Ucn and IR–CRF concentration in placenta The concentrations of IR–Ucn and IR–CRF were measured by their specific RIAs. In term placenta, the concentration of IR–Ucn was slightly greater than that of IR–CRF (1.21 6 0.13 and 0.87 6 0.11 pmol/g.w.w, n 5 4 each, respectively).
Fig. 2. Relationship of plasma IR–CRF concentration to gestational week. The week of gestation was plotted on the horizontal axis with corresponding plasma IR–CRF concentration plotted on the vertical axis.
showed the major peak of IR–Ucn that had similar chromatographic mobility to synthetic human Ucn (Fig. 3A, B). 3.4. Urocortin gene expression in human placenta Urocortin mRNA hybridization signals appearing red were detected in the cytoplasm of cytotrophoplast and syncytiotrophoblast of Cesarean placenta (Fig. 4A). In negative controls using the sense oligonucleotide probe, no significant accumulation of Ucn mRNA was detected (Fig. 4B).
3.3. Reverse-phase HPLC profile of placenta and plasma extract 4. Discussion The chromatographic profiles of placenta and plasma extract were analyzed by reverse-phase HPLC. The HPLC
Fig. 1. Relationship of plasma IR–Ucn concentration to gestational week. The week of gestation was plotted on the horizontal axis with corresponding plasma IR–Ucn concentration plotted on the vertical axis.
The placenta is a source of a large number of hormones, neuropeptides, growth factors and cytokines [11]. It has been reported that CRF is also expressed in placenta and participates in fetal growth [14]. Ucn is cloned as a new member of CRF family in rat and human midbrains and binds to all three types of CRF receptors and CRF-BP with greater potencies than CRF [2]. Most recently, the gene expression and localization of Ucn were demonstrated in human placenta by using reverse transcriptase-polymerase chain reaction (PCR) and immunohistochemistry [10]. Therefore, it is worthy to investigate whether placenta secrets Ucn into maternal blood in the same manner as CRF. In this study, we have been able to detect IR–Ucn in human plasma by using the extraction of plasma with Sep– Pak C18 and a specific RIA. The term placenta contains greater but not less concentration of IR–Ucn than that of IR–CRF. The immunohistochemical study showed that Ucn immunoreactivity was localized in both cytotrophoblast and syncytiotrophoblast of the term and Cesarean placentas (data not shown) as reported previously [10]. In addition, reverse-phase HPLC demonstrated that the major parts of
208
F. Watanabe et al. / Peptides 20 (1999) 205–209
Fig. 3. The HPLC profiles of placental (panel A) and plasma (panel B) extracts. The extracts from term placenta and plasm were applied on HPLC column and eluted with a linear gradient of acetonitrile from 20% to 70% in 0.1% TFA over 50 min at a flow rate of 1 ml/min. IR–Ucn in each fraction was measured by RIA. The arrow indicates the elution position of synthetic human Ucn1– 40. The shaded area indicates the undetectable limit of IR–Ucn.
IR–Ucn in placenta and plasma have the same chromatographic mobility as synthetic human Ucn1– 40. In situ hybridization study also revealed that Ucn mRNA was present in syncytiotrophoblast and cytotrophoblast of placental villi. These led us to hypothesize that Ucn is produced in the placenta and secreted into maternal blood. However, there was no difference of plasma IR–Ucn levels among groups of men, non-pregnant and pregnant women, and no relationship between plasma IR–Ucn levels and gestational weeks during pregnancy. On the other hand, plasma IR– CRF levels during pregnancy correlated well with the gestational weeks as previously reported [6,16]. These data suggest that both Ucn and CRF are synthesized in the placenta but Ucn is not released into maternal blood. It is
important to measure Ucn levels in umbilical cord plasma to understand the role of Ucn in fetus but, unfortunately, we could not obtain umbilical blood in this study. It has been considered that placental CRF plays important roles in regulating the placental adrenocorticotropin release and the development of the fetal pituitary-adrenal axis [13,14]. Ucn is a potent ligand for CRF receptors and stimulates ACTH release from pituitary cells [2,9,19]. Although placental Ucn is not reflected in maternal plasma, Ucn may have important roles in placenta or fetus via CRF receptors as autocrine or paracrine mechanism. In conclusion, IR–Ucn is present in placenta as the same form of synthetic Ucn1– 40, but plasma Ucn is not increased in pregnant women. Although Ucn does not behave like CRF during pregnancy, Ucn may play important roles in placenta or fetus because of its high potency as a ligand for CRF receptors. Acknowledgments We thank Dr. Toshiro Fujii and Mr. Noriyuki Ito for their valuable help. This work is supported by Smoking Research Foundation. References
Fig. 4. mRNA in situ hybridization for urocortin mRNA in human Cesarean placenta. mRNA hybridization signals are visualized as red as a result of fast red salt reaction (A). The negative control of using the sense oligonucleotide demonstrated no accumulation of mRNA hybridization signals (B). Magnification, x80; hematoxylin was used as nuclear stain.
[1] Campbell EA, Linton EA, Wolfe CD, Scraggs PR, Jones MT, Lowry PJ. Plasma corticotropin-releasing hormone concentrations during pregnancy and parturition. J. Clin. Endocrinol. Metab. 1987;64:1054 –1059. [2] Donaldson CJ, Sutton SW, Perrin MH, Corrigan AZ, Lewis KA, Rivier JE, Vaughan JM, Vale WW. Cloning and characterization of human urocortin. Endocrinology 1996;137:2167–2170. [3] Frim DM, Emanuel RL, Robinson BG, Smas CM, Adler GK, Majzoub JA. Characterization and gestational regulation of corticotropinreleasing hormone messenger RNA in human placenta. J. Clin. Invest. 1988;82:287–292.
F. Watanabe et al. / Peptides 20 (1999) 205–209 [4] Goland RS, Wardlaw SL, Stark RI, Brown LJ, Frantz AG. High levels of corticotropin-releasing hormone immunoactivity in maternal and fetal plasma during pregnancy. J. Clin. Endocrinol. Metab. 1986;63: 1199 –1203. [5] Iino K, Sasano H, Oki Y, Andoh N, Shin RW, Kitamoto T, Totsune K, Takahashi K, Suzuki H, Nagura H, Yoshimi T. Urocortin expression in human pituitary gland and pituitary adenoma. J. Clin. Endocrinol. Metab. 1997;82:3842–3850. [6] Laatikainen T, Virtanen T, Raisanen I, Salminen K. Immunoreactive corticotropin-releasing factor and corticotropin during pregnancy, labor and puerperium. Neuropeptides 1987;10:343–353. [7] Ohgo S, Nakatsuru K, Oki Y, Ishikawa E, Matsukura S. Stimulation by interleukin-1 (IL-1)-1) of the release of rat corticotropin-releasing factor (CRF), that is independent of the cholinergic mechanism, from superfused rat hypothalamo-neurohypophysial complexes. Brain Res. 1991;550:213–219. [8] Oki Y, Iwabuchi M, Masuzawa M, Watanabe F, Ozawa M, Iino K, Tominaga T, Yoshimi T. Distribution and concentration of urocortin, and effect of adrenalectomy on its content in rat hypothalamus. Life Sci. 1998;62:807– 812. [9] Ozawa M, Oki Y, Watanabe F, Iino K, Masuzawa M, Iwabuchi M, Yoshimi T. Effect of urocortin and its interaction with adrenocorticotropin (ACTH) secretagogues on ACTH release. Peptides 1998;19: 513–518. [10] Petraglia F, Florio P, Gallo R, Simoncini T, Saviozzi M, Di BA, Vaughan J, Vale W. Human placenta and fetal membranes express human urocortin mRNA and peptide. J. Clin. Endocrinol. Metab. 1996;81:3807–3810. [11] Petraglia F, Florio P, Nappi C, Genazzani AR. Peptide signaling in human placenta and membranes: autocrine, paracrine and endocrine mechanisms. Endocr. Rev. 1996;17:156 –186.
209
[12] Petraglia F, Potter E, Cameron VA, Sutton S, Behan DP, Woods RJ, Sawchenko PE, Lowry PJ, Vale W. Corticotropin-releasing factorbinding protein is produced by human placenta and intrauterine tissues. J. Clin. Endocrinol. Metab. 1993;77:919 –924. [13] Petraglia F, Sawchenko PE, Rivier J, Vale W. Evidence for local stimulation of ACTH secretion by corticotropin-releasing factor in human placenta. Nature 1987;328:717–719. [14] Robinson BG, Emanuel RL, Frim DM, Majzoub JA. Glucocorticoid stimulates expression of corticotropin-releasing hormone gene in human placenta. Proc. Natl. Acad. Sci. USA 1988;85:5244 –5248. [15] Sasaki A, Liotta AS, Luckey MM, Margioris AN, Suda T, Krieger DT. Immunoreactive corticotropin-releasing factor is present in human maternal plasma during the third trimester of pregnancy. J. Clin. Endocrinol. Metab. 1984;59:812– 814. [16] Sasaki A, Shinkawa O, Margioris AN, Liotta AS, Sato S, Murakami O, Go M, Shimizu Y, Hanew K, Yoshinaga K. Immunoreactive corticotropin-releasing hormone in human plasma during pregnancy, labor and delivery. J. Clin. Endocrinol. Metab. 1987;64:224 –229. [17] Sasaki A, Tempst P, Liotta AS, Margioris AN, Hood LE, Kent SB, Sato S, Shinkawa O, Yoshinaga K, Krieger DT. Isolation and characterization of a corticotropin-releasing hormone-like peptide from human placenta. J. Clin. Endocrinol. Metab. 1988;67:768 –773. [18] Thomson M, Chan EC, Falconer J, Madsen G, Smith R. Secretion of corticotropin-releasing hormone by superfused human placental fragments. Gynecological Endocrinology 1988;2:87–100. [19] Vaughan J, Donaldson C, Bittencourt J, Perrin MH, Lewis K, Sutton S, Chan R, Turnbull AV, Lovejoy D, Rivier C, Rivier J, Sawchenko PE, Vale W. Urocortin, a mammalian neuropeptide related to fish urotensin I and to corticotropin-releasing factor. Nature 1995;378: 287–292.
Urocortin in human placenta and maternal plasma Fumie Watanabea, Yutaka Okia,*, Megumi Ozawaa, Masahiro Masuzawaa, Masayasu Iwabuchia, Teruya Yoshimia, Tomizo Nishiguchib, Kazumi Iinoc, Hironobu Sasanoc a
Second Division, Department of Medicine, Hamamatsu University School of Medicine, 3600 Handa– cho, Hamamatsu, 431–31, Japan Department of Gynecology and Obstetrics, Hamamatsu University School of Medicine, 3600 Handa– cho, Hamamatsu, 431–31, Japan c Second Department of Pathology, Tohoku University School of Medicine, 2–1 Seiryo– cho, Aoba– ku, Sendai, 980, Japan
b
Received 26 May 1998; accepted 8 July 198
Abstract Plasma immunoreactive (IR-) urocortin (Ucn) and corticotropin-releasing factor (CRF) levels in pregnant women were measured by their specific radioimmunoassays after extraction. Although plasma IR–CRF levels were increased in pregnant women as compared to men and non-pregnant women, there was no difference of plasma IR–Ucn levels among groups. Ucn mRNA was detected in cytotrophoblasts and syncytiotrophoblasts by in situ hybridization. A reverse-phase high-performance liquid chromatography (HPLC) showed the major peak of IR–Ucn in placenta and plasma that had similar chromatographic mobility to synthetic Ucn1– 40. These data suggest that Ucn is produced and processed into the same form of synthetic Ucn in placenta, but not secreted into maternal blood. © 1999 Elsevier Science Inc. All rights reserved. Keywords: Urocortin; Corticotropin-releasing factor; Placenta; Pregnancy; mRNA
1. Introduction Urocortin (Ucn) has been cloned as a new member of the corticotropin releasing factor (CRF) family in rat and human [2,19]. It is localized in central nervous system, digestive system, and endocrine system [5,8,11], and coded to human chromosome 2 [2]. Ucn shows 95% sequence identity between rat and human [2]. The synthetic urocortin binds to all 3 types of CRF receptors and CRF-binding protein (CRF-BP) [2] and stimulated adrenocorticotropin release from anterior pituitary cells [2,9,19]. It has been known that the placenta is an important source of CRF and CRF-BP [3,12,17,18]. The placenta secrets large amount of CRF into human maternal blood and fetal circulation during pregnancy [4,6,15,16]. There was a significant correlation between maternal plasma CRF levels and gestational weeks [1,6,16]. Recently, it was reported that the human placenta expresses Ucn mRNA and contains the immunoreactive
* Corresponding author. Tel.: 181-11-53-435-2263; fax: 181-11-53435-2354. E-mail address: [email protected] (Y. Oki)
Ucn peptide [10]. Thus, we examined whether Ucn is secreted into maternal blood in the same manner as CRF.
2. Materials and methods 2.1. Reagents Synthetic human Ucn1– 40 and rat/human (r/h)CRF1– 41 were purchased from Peptide Institute Co. Ltd. (Osaka, Japan). Other chemicals were purchased from Katayama Chemical (Osaka, Japan). 2.2. Subjects All subjects participating in this study gave informed consent. Twenty-four pregnant women, aged 23–35 years, 6 non-pregnant women, aged 23–32 years, and 5 men, aged 25–35 years were studied between 9:00 a.m. and 12:00 p.m. Six pregnant women were in the first trimester of pregnancy (up to 14 weeks), 8 were in the second trimester (15–27 weeks), and 10 were in the third trimester (after 28 weeks). All were in good health and none were taking any medication.
0196-9781/99/$ – see front matter © 1999 Elsevier Science Inc. All rights reserved. PII: S 0 1 9 6 - 9 7 8 1 ( 9 9 ) 0 0 1 7 5 - 2
206
F. Watanabe et al. / Peptides 20 (1999) 205–209
2.3. Plasma collection and extraction Blood was collected in ice-chilled glass tubes containing EDTA-disodium at 1 mg/ml blood, and immediately centrifuged at 4°C for 15 min. Plasma was stored at 235°C until extraction. Ucn was extracted from plasma as follows. Plasma was mixed with an equal volume of 6 M guanidine HCl, and the mixture (2 ml) was applied onto Sep–Pak C-18 (Waters Associates, Milford, MA). The column was washed twice with 10 ml distilled water, and then eluted with 4 ml of 70% acetonitrile-0.01% trifluoroacetic acid (TFA). The extracts were lyophilized, reconstituted with radioimmunoassay (RIA) buffer (63 mM Na2HPO4, 12.7 mM EDTANa2, 250 KIU/ml aprotinin, 0.05% NaN3 and 0.1% Triton X 100, pH 7.4) and assayed in duplicate for Ucn immunoreactivity. The recovery of synthetic human Ucn (50 pg/ml) added to silicic acid-treated plasma was 42.5%. Plasma CRF was extracted from plasma by the same procedure as in the case of Ucn substituting 60% acetonitrile/0.5% acetic acid as an eluent. The recovery of synthetic r/hCRF (50 pg/ml) added to silicic acid-treated plasma was 62.7%. Plasma Ucn and CRF levels were not corrected with the recovery rate. 2.4. Extraction of placenta Four term placentas were collected and stored at 280°C until extraction. The placenta was cut into pieces and rinsed with saline at 4°C. Each placenta (100 mg) was placed in 1 ml extraction buffer (63 mM Na2HPO4, 12.7 mM EDTANa2, pH 7.4), incubated at 98°C for 10 min, and homogenized with a polytron homogenizer as previously reported [5]. The homogenate was centrifuged at 10,000 3 g for 30 min, and the supernatant was lyophilized. The dried extract was reconstituted with RIA buffer and subjected to RIAs. The recovery rate of synthetic Ucn added to placenta homogenate was 84.6%. 2.5. HPLC An aliquot (100 ml) of tissue or plasma extract was injected onto a HPLC column (Wakosil-II3C18, 4.6 3 100 mm, Wako Chemical Co., Tokyo, Japan). The column was pre-equilibrated with 0.1% TFA/20% acetonitrile. A linear gradient, from 20 to 70% of acetonitrile in 0.1% TFA at a flow rate of 1 ml, was applied over 50 min. One milliliter samples were collected in an automatic fraction collector, lyophilized to dryness, reconstituted with RIA buffer, and assayed for IR–Ucn determination. A standard of 5 mg of human Ucn1– 40 was injected to determine a chromatographic profile by absorbance at A215.
Ucn21–35 coupled to bovine thyroglobulin with glutaraldehyde. Synthetic peptide [Tyr]18-Ucn19 –37 was iodinated by the chloramine T method, purified by Sephadex G-25 gelchromatography, and used as a tracer. Human Ucn was used as reference standard. The separation of bound and free tracer was performed by double antibody method as described previously [8]. The minimum detection limit of plasma IR–Ucn was 4 pg/ml. The intra- and inter-assay coefficients of variation were 6% and 11%, respectively. The assay did not crossreact with r/hCRF, ovine CRF, urotensin I or sauvagine [8]. The r/hCRF-RIA was also developed by ourselves and the characteristics have been reported previously [7]. This assay did not crossreact with human Ucn up to 480 ng/ml. The minimum detection limit of plasma IR–CRF was 2.5 pg/ml. 2.7. Tissue preparation Cesarean placentas were fixed in 4% paraformaldehyde containing 0.5% glutaraldehyde for 18 h at 4°C for in situ hybridization study. 2.8. In situ hybridization In situ hybridization for visualizing Ucn mRNA was performed by use of a manual capillary actions system (MicroProbe staining system, Fisher Scientific, Pittsburgh, PA) as reported previously [5]. The sequence of the 28-base oligonucleotide probe used for in situ hybridization analysis consisted of ATTGACCTCACCTTTCACCTGCTGCGGA (nucleotides 305–332). Because oligonucleotide probe was used as a negative control. The probes were synthesized with a 39-biotinylated tail (Brigati tail; 59-probe-biotinbiotin-biotin-TAG-TAG-biotin-biotin-biotin-39). After hybridization, the sections were incubated with alkaline phosphatase-conjugated streptavidin. After washing, hybridization products were visualized as red using fast red salt. The slides were counterstained with hematoxylin, air-dried, and coverslipped for microscopic examination. 2.9. Statistics The results are expressed as the mean 6 SEM. Statistical analysis was performed by one-way ANOVA, followed by Scheffe’s multiple comparison test. Correlation between plasma peptide levels and gestational weeks was analyzed by a standard multiple regression analysis. p , 0.05 was considered significant. 3. Results
2.6. RIAs
3.1. Immunoreactive IR–Ucn concentration in maternal plasma
The specific antiserum against Ucn was raised in New Zealand white rabbit by repeated injections of synthetic
Plasma IR–Ucn levels were detected in all subjects, but there was no difference of plasma IR–Ucn concentrations
F. Watanabe et al. / Peptides 20 (1999) 205–209
207
Table 1 Plasma IR-Ucn and IR-CRF concentrations in men, non-pregnant and pregnant women No. of subjects Men Non-pregnant women Pregnant women 1st trimester 2nd trimester 3rd trimester
Plasma IR-Ucn pg/ml
5 6
16.6 6 5.5 12.8 6 1.9
6 8 10
17.5 6 1.9 16.6 6 2.7 12.8 6 1.8
Plasma IR-CRF pg/ml 9.1 6 1.1 9.3 6 1.5 47.7 6 10.7* 72.0 6 11.9*,** 99.6 6 16.8*,**
The results represent the mean 6 SEM. * p , 0.05 versus non-pregnant women. ** p , 0.05 versus 1st trimester.
among groups (Table 1). Plasma IR–Ucn concentrations did not correlate with the weeks of pregnancy (p . 0.1, Fig. 1). Plasma IR–CRF levels significantly increased in pregnant women in the second and third trimesters as compared to non-pregnant women and pregnant women of the first trimester (Table 1), and correlated well with gestational weeks (R 5 0.54, p , 0.01, Fig. 2). 3.2. IR–Ucn and IR–CRF concentration in placenta The concentrations of IR–Ucn and IR–CRF were measured by their specific RIAs. In term placenta, the concentration of IR–Ucn was slightly greater than that of IR–CRF (1.21 6 0.13 and 0.87 6 0.11 pmol/g.w.w, n 5 4 each, respectively).
Fig. 2. Relationship of plasma IR–CRF concentration to gestational week. The week of gestation was plotted on the horizontal axis with corresponding plasma IR–CRF concentration plotted on the vertical axis.
showed the major peak of IR–Ucn that had similar chromatographic mobility to synthetic human Ucn (Fig. 3A, B). 3.4. Urocortin gene expression in human placenta Urocortin mRNA hybridization signals appearing red were detected in the cytoplasm of cytotrophoplast and syncytiotrophoblast of Cesarean placenta (Fig. 4A). In negative controls using the sense oligonucleotide probe, no significant accumulation of Ucn mRNA was detected (Fig. 4B).
3.3. Reverse-phase HPLC profile of placenta and plasma extract 4. Discussion The chromatographic profiles of placenta and plasma extract were analyzed by reverse-phase HPLC. The HPLC
Fig. 1. Relationship of plasma IR–Ucn concentration to gestational week. The week of gestation was plotted on the horizontal axis with corresponding plasma IR–Ucn concentration plotted on the vertical axis.
The placenta is a source of a large number of hormones, neuropeptides, growth factors and cytokines [11]. It has been reported that CRF is also expressed in placenta and participates in fetal growth [14]. Ucn is cloned as a new member of CRF family in rat and human midbrains and binds to all three types of CRF receptors and CRF-BP with greater potencies than CRF [2]. Most recently, the gene expression and localization of Ucn were demonstrated in human placenta by using reverse transcriptase-polymerase chain reaction (PCR) and immunohistochemistry [10]. Therefore, it is worthy to investigate whether placenta secrets Ucn into maternal blood in the same manner as CRF. In this study, we have been able to detect IR–Ucn in human plasma by using the extraction of plasma with Sep– Pak C18 and a specific RIA. The term placenta contains greater but not less concentration of IR–Ucn than that of IR–CRF. The immunohistochemical study showed that Ucn immunoreactivity was localized in both cytotrophoblast and syncytiotrophoblast of the term and Cesarean placentas (data not shown) as reported previously [10]. In addition, reverse-phase HPLC demonstrated that the major parts of
208
F. Watanabe et al. / Peptides 20 (1999) 205–209
Fig. 3. The HPLC profiles of placental (panel A) and plasma (panel B) extracts. The extracts from term placenta and plasm were applied on HPLC column and eluted with a linear gradient of acetonitrile from 20% to 70% in 0.1% TFA over 50 min at a flow rate of 1 ml/min. IR–Ucn in each fraction was measured by RIA. The arrow indicates the elution position of synthetic human Ucn1– 40. The shaded area indicates the undetectable limit of IR–Ucn.
IR–Ucn in placenta and plasma have the same chromatographic mobility as synthetic human Ucn1– 40. In situ hybridization study also revealed that Ucn mRNA was present in syncytiotrophoblast and cytotrophoblast of placental villi. These led us to hypothesize that Ucn is produced in the placenta and secreted into maternal blood. However, there was no difference of plasma IR–Ucn levels among groups of men, non-pregnant and pregnant women, and no relationship between plasma IR–Ucn levels and gestational weeks during pregnancy. On the other hand, plasma IR– CRF levels during pregnancy correlated well with the gestational weeks as previously reported [6,16]. These data suggest that both Ucn and CRF are synthesized in the placenta but Ucn is not released into maternal blood. It is
important to measure Ucn levels in umbilical cord plasma to understand the role of Ucn in fetus but, unfortunately, we could not obtain umbilical blood in this study. It has been considered that placental CRF plays important roles in regulating the placental adrenocorticotropin release and the development of the fetal pituitary-adrenal axis [13,14]. Ucn is a potent ligand for CRF receptors and stimulates ACTH release from pituitary cells [2,9,19]. Although placental Ucn is not reflected in maternal plasma, Ucn may have important roles in placenta or fetus via CRF receptors as autocrine or paracrine mechanism. In conclusion, IR–Ucn is present in placenta as the same form of synthetic Ucn1– 40, but plasma Ucn is not increased in pregnant women. Although Ucn does not behave like CRF during pregnancy, Ucn may play important roles in placenta or fetus because of its high potency as a ligand for CRF receptors. Acknowledgments We thank Dr. Toshiro Fujii and Mr. Noriyuki Ito for their valuable help. This work is supported by Smoking Research Foundation. References
Fig. 4. mRNA in situ hybridization for urocortin mRNA in human Cesarean placenta. mRNA hybridization signals are visualized as red as a result of fast red salt reaction (A). The negative control of using the sense oligonucleotide demonstrated no accumulation of mRNA hybridization signals (B). Magnification, x80; hematoxylin was used as nuclear stain.
[1] Campbell EA, Linton EA, Wolfe CD, Scraggs PR, Jones MT, Lowry PJ. Plasma corticotropin-releasing hormone concentrations during pregnancy and parturition. J. Clin. Endocrinol. Metab. 1987;64:1054 –1059. [2] Donaldson CJ, Sutton SW, Perrin MH, Corrigan AZ, Lewis KA, Rivier JE, Vaughan JM, Vale WW. Cloning and characterization of human urocortin. Endocrinology 1996;137:2167–2170. [3] Frim DM, Emanuel RL, Robinson BG, Smas CM, Adler GK, Majzoub JA. Characterization and gestational regulation of corticotropinreleasing hormone messenger RNA in human placenta. J. Clin. Invest. 1988;82:287–292.
F. Watanabe et al. / Peptides 20 (1999) 205–209 [4] Goland RS, Wardlaw SL, Stark RI, Brown LJ, Frantz AG. High levels of corticotropin-releasing hormone immunoactivity in maternal and fetal plasma during pregnancy. J. Clin. Endocrinol. Metab. 1986;63: 1199 –1203. [5] Iino K, Sasano H, Oki Y, Andoh N, Shin RW, Kitamoto T, Totsune K, Takahashi K, Suzuki H, Nagura H, Yoshimi T. Urocortin expression in human pituitary gland and pituitary adenoma. J. Clin. Endocrinol. Metab. 1997;82:3842–3850. [6] Laatikainen T, Virtanen T, Raisanen I, Salminen K. Immunoreactive corticotropin-releasing factor and corticotropin during pregnancy, labor and puerperium. Neuropeptides 1987;10:343–353. [7] Ohgo S, Nakatsuru K, Oki Y, Ishikawa E, Matsukura S. Stimulation by interleukin-1 (IL-1)-1) of the release of rat corticotropin-releasing factor (CRF), that is independent of the cholinergic mechanism, from superfused rat hypothalamo-neurohypophysial complexes. Brain Res. 1991;550:213–219. [8] Oki Y, Iwabuchi M, Masuzawa M, Watanabe F, Ozawa M, Iino K, Tominaga T, Yoshimi T. Distribution and concentration of urocortin, and effect of adrenalectomy on its content in rat hypothalamus. Life Sci. 1998;62:807– 812. [9] Ozawa M, Oki Y, Watanabe F, Iino K, Masuzawa M, Iwabuchi M, Yoshimi T. Effect of urocortin and its interaction with adrenocorticotropin (ACTH) secretagogues on ACTH release. Peptides 1998;19: 513–518. [10] Petraglia F, Florio P, Gallo R, Simoncini T, Saviozzi M, Di BA, Vaughan J, Vale W. Human placenta and fetal membranes express human urocortin mRNA and peptide. J. Clin. Endocrinol. Metab. 1996;81:3807–3810. [11] Petraglia F, Florio P, Nappi C, Genazzani AR. Peptide signaling in human placenta and membranes: autocrine, paracrine and endocrine mechanisms. Endocr. Rev. 1996;17:156 –186.
209
[12] Petraglia F, Potter E, Cameron VA, Sutton S, Behan DP, Woods RJ, Sawchenko PE, Lowry PJ, Vale W. Corticotropin-releasing factorbinding protein is produced by human placenta and intrauterine tissues. J. Clin. Endocrinol. Metab. 1993;77:919 –924. [13] Petraglia F, Sawchenko PE, Rivier J, Vale W. Evidence for local stimulation of ACTH secretion by corticotropin-releasing factor in human placenta. Nature 1987;328:717–719. [14] Robinson BG, Emanuel RL, Frim DM, Majzoub JA. Glucocorticoid stimulates expression of corticotropin-releasing hormone gene in human placenta. Proc. Natl. Acad. Sci. USA 1988;85:5244 –5248. [15] Sasaki A, Liotta AS, Luckey MM, Margioris AN, Suda T, Krieger DT. Immunoreactive corticotropin-releasing factor is present in human maternal plasma during the third trimester of pregnancy. J. Clin. Endocrinol. Metab. 1984;59:812– 814. [16] Sasaki A, Shinkawa O, Margioris AN, Liotta AS, Sato S, Murakami O, Go M, Shimizu Y, Hanew K, Yoshinaga K. Immunoreactive corticotropin-releasing hormone in human plasma during pregnancy, labor and delivery. J. Clin. Endocrinol. Metab. 1987;64:224 –229. [17] Sasaki A, Tempst P, Liotta AS, Margioris AN, Hood LE, Kent SB, Sato S, Shinkawa O, Yoshinaga K, Krieger DT. Isolation and characterization of a corticotropin-releasing hormone-like peptide from human placenta. J. Clin. Endocrinol. Metab. 1988;67:768 –773. [18] Thomson M, Chan EC, Falconer J, Madsen G, Smith R. Secretion of corticotropin-releasing hormone by superfused human placental fragments. Gynecological Endocrinology 1988;2:87–100. [19] Vaughan J, Donaldson C, Bittencourt J, Perrin MH, Lewis K, Sutton S, Chan R, Turnbull AV, Lovejoy D, Rivier C, Rivier J, Sawchenko PE, Vale W. Urocortin, a mammalian neuropeptide related to fish urotensin I and to corticotropin-releasing factor. Nature 1995;378: 287–292.