Urotensin II upregulates migration and cytokine gene expression in leukocytes of the African clawed frog, Xenopus laevis

General and Comparative Endocrinology 216 (2015) 54–63

Contents lists available at ScienceDirect

General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen

Urotensin II upregulates migration and cytokine gene expression in leukocytes of the African clawed frog, Xenopus laevis Shiori Tomiyama, Tomoya Nakamachi, Minoru Uchiyama, Kouhei Matsuda, Norifumi Konno ⇑ Department of Biological Science, Graduate School of Science and Engineering, University of Toyama, 3190 Gofuku, Toyama 930-8555, Japan

a r t i c l e

i n f o

Article history: Received 28 December 2014 Revised 24 March 2015 Accepted 12 April 2015 Available online 20 April 2015 Keywords: Urotensin II (UII) Urotensin II receptor (UTR) Leukocyte Migration Cytokine Xenopus laevis

a b s t r a c t Urotensin II (UII) exhibits diverse physiological actions including vasoconstriction, locomotor activity, osmoregulation, and immune response via the UII receptor (UTR) in mammals. However, in amphibians the function of the UII–UTR system remains unknown. In the present study, we investigated the potential immune function of UII using leukocytes isolated from the African clawed frog, Xenopus laevis. Stimulation of male frogs with lipopolysaccharide increased mRNA expression of UII and UTR in leukocytes, suggesting that inflammatory stimuli induce activation of the UII–UTR system. Migration assays showed that both UII and UII-related peptide enhanced migration of leukocytes in a dose-dependent manner, and that UII effect was inhibited by the UTR antagonist urantide. Inhibition of Rho kinase with Y-27632 abolished UII-induced migration, suggesting that it depends on the activation of RhoA/Rho kinase. Treatment of isolated leukocytes with UII increased the expression of several cytokine genes including tumor necrosis factor-a, interleukin-1b, and macrophage migration inhibitory factor, and the effects were abolished by urantide. These results suggest that in amphibian leukocytes the UII–UTR system is involved in the activation of leukocyte migration and cytokine gene expression in response to inflammatory stimuli. Ó 2015 Elsevier Inc. All rights reserved.

1. Introduction Urotensin II (UII) is a cyclic peptide originally isolated from the urophyses of teleost fish based on its ability to contract smooth muscles (Pearson et al., 1980). Subsequently, isoforms of UII have been isolated in various vertebrate species including amphibians (Conlon et al., 1992; Konno et al., 2013), rodents (Coulouarn et al., 1999), and human (Coulouarn et al., 1998). Recently, a second gene encoding a precursor of a UII analog, termed UII-related peptide (URP), has been reported in the Japanese eel (Nobata et al., 2011), African clawed frog (Konno et al., 2013), birds (Tostivint et al., 2006), and rodents and humans (Sugo et al., 2003). The putative mature form of URP is an octapeptide (ACFWKYCV/I), and shares the same cyclic moiety with UII, although its precursor sequences differ among vertebrate species. UII and URP act through the G-protein-coupled receptor-14, recently renamed urotensin II receptor (UTR). Complementary DNAs that encode UTR have been cloned in teleost fish (Evans et al., 2011; Lu et al., 2006), rodents (Marchese et al., 1995), cats (Aiyar et al., 2005), and humans (Ames et al., 1999). However, there

⇑ Corresponding author. Fax: +81 76 445 6549. E-mail address: [email protected] (N. Konno). http://dx.doi.org/10.1016/j.ygcen.2015.04.009 0016-6480/Ó 2015 Elsevier Inc. All rights reserved.

was no information on amphibian UTR until we recently cloned a functional UTR from the African clawed frog, Xenopus laevis (Konno et al., 2013). It is well established that UII in mammals is a potent vasoconstrictor with a potency of greater than that of endothelin-1 (Ames et al., 1999; Douglas and Ohlstein, 2000). Furthermore, recent studies in fish and mammals have shown that UII regulates diverse physiological actions including locomotor activity (Do-Rego et al., 2005), osmoregulation (Balment et al., 2005; Evans et al., 2011; Lu et al., 2006; Song et al., 2006), and immune response (Segain et al., 2007; Singh and Rai, 2011; Watanabe et al., 2005) through UTR. However, few studies have investigated the physiological roles of UII/URP in amphibians with the exception of the effects of UII on smooth muscle contraction (Yano et al., 1994) and vasoconstriction (Yano et al., 1995). One of the reasons may be that the target sites of UII/URP have not been well defined in amphibians. Thus, findings from amphibians would provide valuable information for understanding the diverse roles and functional evolution of the UII–UTR system in vertebrates. We previously cloned cDNAs encoding URP and UTR from X. laevis and characterized the properties of UTR in the presence of UII, URP, and a UTR antagonist (urantide) using a calcium mobilization assay in the Chinese hamster ovary cells transiently expressing Xenopus UTR (Konno et al., 2013). Furthermore,

S. Tomiyama et al. / General and Comparative Endocrinology 216 (2015) 54–63

immunohistochemical localization of Xenopus UTR suggested that the UII–UTR system acts in the kidney and urinary bladder (osmoregulatory organs), splenocytes and leukocytes (immune cells), and hyaline chondrocytes (connective tissue) (Konno et al., 2013). However, direct physiological actions in the target tissues of UII/URP have not yet been demonstrated. Because UTR was expressed in splenocytes and leukocytes in our previous study, we focused in the present study on potential immune functions of UII/URP in amphibian leukocytes. Recent studies have revealed that UII and UTR were expressed respectively in lymphocytes and in monocytes/macrophages isolated from human peripheral blood mononuclear cells (PBMCs) of healthy subjects (Bousette et al., 2004; Segain et al., 2007). UTR is likely to function as a chemoattractant receptor for UII in human PBMC and rat splenocytes (Segain et al., 2007). In addition, the interaction between the UII–UTR system and cytokines, which are released from innate immune cells and play key roles in the regulation of immune response, has been reported in pathologies such as fibrotic disorders (Dai et al., 2007, 2011; Tian et al., 2008). Liang and colleagues showed that the inhibition of the UII–UTR system with urantide reduced the serum levels of TNFa, IL-1b, and IFN-c in lipopolysaccharide (LPS)/D-galactosamine (GaIN)-challenged mice (Liang et al., 2013). However, the direct actions of UII on cytokine production in leukocytes remain to be elucidated even in mammals. Thus, in the present study, we investigated the potential immune functions of the UII–UTR system in X. laevis, which is used to study the immune system, because it possesses both innate and acquired immune systems, as observed in mammals. The present study may shed light on the mechanism of control of inflammatory response via the UII–UTR system in leukocytes. 2. Materials and methods 2.1. Reagents LPS (Escherichia coli strain O111), which was used in previous immune studies with X. laevis (Cui et al., 2011; Nagata et al., 2013), was purchased from Sigma (St. Louis, MO, USA). Rho-kinase inhibitor (Y-27632) was purchased from Wako Pure Chemical Industries (Osaka, Japan). Xenopus UII peptide (GNLSECFWKYCV) was synthesized by GenScript (Piscataway, NJ, USA). Human URP (ACFWKYCV) and urantide (a potent UTR antagonist) were purchased from the Peptide Institute (Osaka, Japan). 2.2. Animals and isolation of leukocytes Immature male X. laevis 1.5 years of age (30–50 g body weight) were purchased from a commercial supplier (Xenopus Inbreed Strain Resource Center, Hyogo, Japan) and maintained in plastic containers (40  30  20 cm) containing dechlorinated tap water at 18–22 °C under a 12-h light/12-h dark photoperiod until use. Frogs were anesthetized with 0.1% ethyl 3-aminobenzoate methanesulfonate (MS-222; Sigma). In an experiment testing the inflammatory response, frogs (n = 8) were intraperitoneally injected with 100 lg of LPS in 200 ll Dulbecco’s phosphate-buffered saline (PBS, pH 7.4). The dose of LPS and schedule for blood sampling were determined as previously described in X. laevis (Nagata et al., 2013). In the study, the injection of 100 lg LPS to immature X. laevis (30–40 g body weight) resulted in marked increases in the serum X-lectin concentration, which plays a role in antibacterial innate immunity, to maximum levels on day 3 after injection (Nagata et al., 2013). Three days after injection, the frogs were anesthetized in 0.1% MS-222 and peripheral blood was collected by cardiac puncture in 1-mL syringes. Blood samples were

55

overlaid onto discontinuous Percoll (GE Healthcare BioScience, Piscataway, NJ, USA) gradients [90, 60, 50, 40% (v/v)] buffered with 7/9 diluted Dulbecco’s PBS and centrifuged at 500g for 15 min at room temperature to separate erythrocytes and leukocytes (Aizawa et al., 2005) and the leukocyte suspension was used for histological observation, migration assay, and molecular analysis. All the experiments were performed in accordance with the guide for the care and use of laboratory animals and approved by the ethics committees of the University of Toyama. 2.3. Cytology of leukocytes To discriminate leukocyte cell type, smear preparations of leukocytes were stained with May–Grunwald Giemsa (MGG) (Nacalai Tesque, Kyoto, Japan) following the manufacturer’s instructions. In myeloperoxidase (MPO) staining, which is important for the cytomorphological diagnosis and classification of leukocytes, smear preparations were fixed in fixative containing 54% acetone and 2.7% glutaraldehyde for 30 s and then stained for MPO with an ImmPACT DAB Peroxidase Substrate kit (Vector Laboratories, Burlingame, CA). The cells were observed with an inverted microscope (Nikon ECLIPSE C1; Nikon, Tokyo, Japan). 2.4. Reverse-transcription (RT)-PCR The expression of UII, URP, and UTR in leukocytes isolated from peripheral blood of immature male frogs was confirmed by the detection of each mRNA expression by RT-PCR. Total RNA was isolated from leukocytes, erythrocytes, and brain as positive control using RNAiso Plus reagent (Takara Bio, Otsu, Japan). Complementary DNA was synthesized from 1 lg of total RNA using a PrimeScript RT reagent Kit with gDNA Eraser (Takara Bio). Specific primers (Table 1) used in PCR were designed for UII (GenBank accession NM_001280580), URP (NM_001280582), UTR (AB727592), and elongation factor 1 alpha (EF1a; NM001101761) as reference. The PCR conditions comprised 32 cycles (UII, URP, and UTR) and 25 cycles (EF1a) of 30 s at 94 °C, 30 s at 58 °C, and 30 s at 72 °C, using 25-ll reaction mixtures. Sequences of PCR products amplified using each of these primer sets were confirmed by sequencing. 2.5. Migration assay of leukocytes The migration ability of the isolated leukocytes was assessed using a transwell migration assay (a modified Boyden chamber assay) with polycarbonate membranes (5 lm pore size; Fig. S1) (Millicells; Millipore Corp., Billerica, MA, USA) as described previously (Mori et al., 2003). Leukocytes (2  105 cells) isolated from peripheral blood were suspended in Leibovitz’s L-15 medium (Life Technologies Corp.) adjusted to amphibian osmolality (220 mOsm) with Dulbecco’s PBS and were added to the upper chamber. After preincubation for 30 min, each UII, URP (109– 108 M), and LPS (2 lg/ml medium) was added to the lower chamber. The dose of LPS and incubation time with ligands and LPS in the migration assay were determined according to previous studies with human PBMCs and Xenopus leukocytes (Chadzinska and Plytycz, 2004; Cui et al., 2011; Segain et al., 2007). When preincubated, the leukocytes were pretreated with urantide (106 M) or Y-27632 (107 M) for 30 min at 22 °C. The leukocytes were allowed to migrate for 12 h at 22 °C. After this period, leukocytes migrating to the lower chamber were collected by centrifugation at 300g for 3 min and then counted with an automatic cell counter (Countess, Life Technologies Corp.). Cell migration was expressed as the chemotactic index calculated by the following ratio: cells migrating to reagents (LPS, UII, and URP)/cells migrating to control (medium). Furthermore, to determine the cell types of migrating

56

S. Tomiyama et al. / General and Comparative Endocrinology 216 (2015) 54–63

Table 1 Primers for RT-PCR and real-time PCR. Target genes

Target genes

Oligonucleotide sequences (50 -30 )

Product sizes (bp)

UII precursor

NM_001280580

104

URP precursor

NM_001280582

UTR

AB727592

IL-b

NM_001085605

TNF-a

NM_001114778

MIF

BC097727

TGF-b1

NM_001087861

G-CSF

JX418294

EF1a

X55324

Sense: TGCAATCCAAAGACAAGAAAC Antisense: TCGCCATACAGACGGATACAC Sense: CTTGTTATGATTTCTATGCACTCTG Antisense: ACACAGTATTTCCAAAAGCACG Sense: CTGCTGACCAAGAACTACAAGG Antisense: ACTGAGCATCGGAAGGAATC Sense: ATCAGGGTGGAAGCAAAAGG Antisense: CTGTTCGTGGAGGTTTCATTG Sense: TTGAGTTTCTTGATGCCGAC Antisense: GCCAAATAAGCAATAGATGTCC Sense: CCAGCTGAGTACATTGCAATTC Antisense: CCCTATCTTTCCAATGCTGC Sense: CAAACTGCTGTGTGAAACCTC Antisense: CTGTACCATGTCTTTGCTTTGC Sense: AGGAAAAACAGCGAGAATGC Antisense: GATGAGATGCCACCACGAAG Sense: ATGTCACTATCATTGATGCTCCAG Antisense: TACCAACAATCAGCTGCTTAACAC

leukocytes, leukocytes migrating to the lower chamber were collected and resuspended in 10 ll medium. One microliter of the cell suspension was smeared on slide glasses and the slide glasses were then stained with MGG solution. MGG-stained smears were enclosed with gridded cover glasses (0.15 mm grid/compartment; GC1300, Matsunami, Osaka, Japan) and the number and cell type of the migrating cells in a given grid area (164 compartments/ slide; 3.69 mm2) were counted and classified with an inverted microscope.

2.6. Analysis of cytokine gene expression in leukocytes Leukocytes (2  106 cells) isolated from peripheral blood were suspended in Leibovitz’s L-15 medium adjusted to amphibian osmolality (220 mOsm) with Dulbecco’s PBS and preincubated in a 60 mm dish for 30 min at 22 °C. After preincubation, UII (109– 108 M) was added to the dish and incubated for 12 h at 22 °C. For preincubation, the suspensions were pretreated with urantide (106 M) for 30 min at 22 °C. After treatment with UII, the cells were recovered from the medium. For expression analysis of several cytokine genes, total RNA was isolated from the collected leukocytes using RNAiso Plus reagent (Takara Bio) and used in expression analysis by real-time RT-PCR. Complementary DNA was synthesized from 1 lg of total RNA using a PrimeScript RT reagent Kit with gDNA Eraser (Takara Bio). Specific primers

308 241 205 183 108 344 262 198

(Table 1) were designed for UII (GenBank accession NM_001280580), URP (NM_001280582), UTR (AB727592), interleukin-1b (IL-1b; NM_001085605), tumor necrosis factor (TNF-a; NM_001114778), macrophage migration inhibitory factor (MIF; BC097727), granulocyte-colony stimulating factor (G-CSF; JX418294), and EF1a (NM001101761). All primers were tested for non-specific product amplification and primer-dimer formation by melting curve analyses and gel electrophoresis. Real-time RTPCR was performed using THUNDERBIRD SYBR qPCR Mix (TOYOBO, Osaka, Japan) and a Thermal Cycler Dice Real Time System (Takara Bio), according to the supplier’s instructions. The following cycling conditions were employed for all assays: 1 cycle of 95 °C for 30 s, 40 cycles of 95 °C for 5 s, 60 °C for 30 s, 1 cycle of 95 °C for 15 s, 60 °C for 30 s, and 1 cycle of 95 °C for 15 s. The qRTPCR data were analyzed using the 2  DDCt method (Livak and Schmittgen, 2001). To check PCR specificity, nucleotide sequences of the PCR products were confirmed by sequencing. The levels of expression of EF1a mRNA did not show significant changes among all groups when examined in this study.

2.7. Statistical analysis Data are expressed as mean ± standard error (SE). Values were compared between groups using one-way or two-way ANOVA followed by Bonferroni’s multiple-comparison test. Significant

Fig. 1. Isolation and histological classification of leukocytes in normal X. laevis. (A) A leukocyte fraction was isolated from the peripheral blood by discontinuous density gradient centrifugation in Percoll. (B) Histological classification of leukocytes was performed by staining with both May–Grunwald Giemsa and MPO. The types of hemocytes were easily distinguished in a Xenopus leukocyte smear stained by MGG and MPO staining, based on cell size, mono- or multinuclear property, cell shape, and MPO activity. Scale bars = 10 lm.

S. Tomiyama et al. / General and Comparative Endocrinology 216 (2015) 54–63

Fig. 2. RT-PCR of mRNA expression of UII, URP, and UTR in brain (positive control) and leukocytes and erythrocytes isolated from normal Xenopus peripheral blood. EF1a was used as a reference. Minus RT (RT) indicates a minus-reverse transcriptase control of an individual gene sample.

Fig. 3. The effect of LPS on the gene expression of UII, URP, and UTR in the leukocytes of X. laevis. Expression of UII, URP, and UTR mRNAs were evaluated by quantitative real-time RT-PCR in leukocytes isolated from the peripheral blood of male frogs with the subcutaneous injection of PBS (control) or LPS (100 lg/frog). The expression of objective mRNA was normalized to EF1a mRNA expression. Expression of URP mRNA was undetectable (ND) in this analysis. The data are expressed as mean ± SE (n = 8). Asterisks indicate significant differences (* < 0.05, ** < 0.01, unpaired Student’s t test) relative to control samples.

differences between the two groups were determined using the unpaired Student’s t test. A P value of less than 0.05 or 0.01 was considered to be statistically significant. 3. Results 3.1. Classification of the isolated leukocytes and mRNA expressions of UII and UTR The leukocytes used in all experiments were isolated from the peripheral blood of immature male frogs by discontinuous density gradient centrifugation with Percoll (Fig. 1A). The morphological characteristics of amphibian leukocytes are demonstrated in detail in the atlas of adult X. laevis hematology (Hadji-Azimi et al., 1987). The types of hemocyte were easily distinguished in a Xenopus

57

Fig. 4. Effect of LPS on chemotaxis of isolated leukocytes. Leukocytes (2  105 cells) were added to the upper chamber and incubated with LPS (2 lg/ml medium) added to the lower chamber for 12 h. Chemotaxis was expressed as the following ratio: number of cells migrating to LPS/cells migrating to vehicle control (PBS). The data are expressed as mean ± SE of three independent experiments (n = 3). Asterisks indicate significant differences (** < 0.01, unpaired Student’s t test) relative to control samples.

leukocyte smear stained by MGG and MPO staining based on cell size, mono- or multinuclear property, cell shape, and MPO activity (Fig. 1B). The leukocyte samples contained six main types of cells: neutrophils (31.7 ± 3.5%, n = 5), basophils (23.2 ± 5.0%, n = 5), eosinophils (2.2 ± 0.3%, n = 5), monocytes (1.7 ± 0.5%, n = 5), lymphocytes (41.2 ± 4.0%, n = 5), and thrombocytes. MPO activity was abundantly observed in the granulocytes of neutrophils, basophils, and eosinophils, but not in monocytes, lymphocytes and thrombocytes. Similar to previous reports by Hadji-Azimi et al. (1987), monocytes have a large diameter of 12–18 lm and the nuclei are kidney-shaped with a deep curvature. Lymphocytes are mostly round cells with a regular contour and they have a diameter of 5–10 lm. Their cytoplasm around the nucleus is scanty. Thrombocytes are easily distinguished from all leukocytes. The cells are mostly oblong cells and the cytoplasm is very scanty. In the expression analysis with RT-PCR, mRNA expressions of UII precursor and UTR were detected in the fraction of leukocytes isolated from naive frogs (Fig. 2), but URP transcript was undetected in leukocytes. None of these genes was expressed in erythrocytes. 3.2. LPS upregulates the expression of UII and UTR mRNAs in leukocytes LPS is well-known to be the major component of the outer membrane of Gram-negative bacteria and induces strong inflammatory responses when administered to vertebrates. We intraperitoneally injected LPS from E. coli 0111:B4 in male frogs to determine whether it affects the UII–UTR system in leukocytes. Three days after LPS injection, leukocytes were isolated from peripheral blood by Percoll density gradient centrifugation and the expression of UII, URP, and UTR mRNAs was examined by real-time RT-PCR. The injection of LPS (100 lg/frog) resulted in marked increases in UII (7.8-fold) and UTR mRNAs (8.2-fold) (Fig. 3). In contrast, URP mRNA expression in the leukocytes of both groups was undetectable in this expression analysis. 3.3. UII and URP induces the migration of leukocytes To investigate whether UII and/or URP affect the motility of the isolated leukocytes, a migration assay was performed following the

58

S. Tomiyama et al. / General and Comparative Endocrinology 216 (2015) 54–63

Fig. 5. The effect of UII and URP on the chemotaxis of isolated leukocytes. (A and C) Leukocytes were added to the upper chamber and incubated with 109–108 M of UII or URP added to the lower chamber for 12 h. (B and D) Before addition of 108 M of UII or URP, leukocytes were pretreated with the UTR antagonist urantide (106 M) for 30 min at 22 °C. Chemotaxis was expressed as the following ratio: number of cells migrating to reagents/cells migrating to vehicle control (PBS). The data are expressed as mean ± SE (n = 6). Different letters in the plots indicate significant differences at P < 0.01 (one-way (A and C) or two-way (B and D) ANOVA using Bonferroni correction).

experimental flow shown in Fig. 4. We initially evaluated the effects of LPS on migration ability of the isolated leukocytes. The addition of LPS (2 lg/ml medium) induced a greater than 2-fold increase in the migration of leukocytes (Fig. 4), indicating that the isolated leukocytes possess an ability to migrate in response to an inflammatory stimulus. UII and URP significantly enhanced migration of leukocytes in a dose-dependent manner (Fig. 5A and C). The addition of URP at an equal dose to UII produced a stronger effect than that of UII. Although the addition of the UTR antagonist urantide (106 M) alone did not affect the migration of leukocytes, UII and URP-induced migration were abolished by pre-treatment with 106 M UTR antagonist (Fig. 5B and D). 3.4. UII enhances the migration of monocytes and lymphocytes To determine the cell type of the migrating leukocytes, we examined the type and number of the UII-induced migrating cells on the basis of the characteristics of X. laevis leukocytes (Fig. 1B). The treatment of leukocytes with 108 M UII for 12 h

Fig. 6. Identification of the UII-induced migrating cell type of leukocytes. Treatment of leukocytes with 108 M UII significantly increased migration of monocytes and lymphocytes. The data are expressed as mean ± SE (n = 5). Asterisks indicate significant differences (* < 0.05, ** < 0.01, unpaired Student’s t test) relative to control samples.

S. Tomiyama et al. / General and Comparative Endocrinology 216 (2015) 54–63

59

antagonist (106 M urantide) significantly inhibited the UII-induced cytokine expression (Fig. 8B, D, and F), indicating that this effect is mediated by UTR.

4. Discussion

Fig. 7. Effect of the Rho-kinase inhibitor Y-27632 on UII-induced migration. Before the addition of 108 M of UII, leukocytes were pretreated with Y-27632 (107 M) for 30 min at 22 °C. Chemotaxis was expressed as the following ratio: number of cells migrating to reagents/cells migrating to vehicle control (PBS). The data are expressed as mean ± SE (n = 6). Different letters in the plots indicate significant differences at P < 0.01 (two-way ANOVA using Bonferroni correction).

significantly increased the migration of monocytes (chemotactic index = 4.31 ± 0.48, P = 0.0002, n = 5) and lymphocytes (chemotactic index = 1.50 ± 0.12, P = 0.0374, n = 5) (Fig. 6). In contrast, UII had no effect on the migration of neutrophils (P = 0.0715, n = 5), basophils (P = 0.1713, n = 5), or eosinophils (P = 0.3037, n = 5). 3.5. UII-induced migration is mediated through the RhoA/Rho kinase signaling pathway The RhoA/Rho kinase signaling pathway is essentially involved in vasocontraction and the regulation of actin polymerization and actomyosin contraction (Etienne-Manneville and Hall, 2002). Segain and colleagues reported that the RhoA/Rho kinase signaling pathway plays a major role in the UII-induced migration of human PBMC and rat splenocytes (Segain et al., 2007). We accordingly investigated whether the activation of RhoA/Rho kinase is involved in UII-induced migration of leukocytes isolated from X. laevis. The inhibition of Rho kinase with Y-27632 (107 M) abolished the UIIinduced migration of leukocytes (Fig. 7), although the addition of Y27632 alone did not affect the migration of leukocytes. 3.6. UII upregulates the expression of cytokine genes in leukocytes In mammals, cytokines including TNF-a, IL-1b, MIF, and G-CSF, which are produced primarily in activated monocytes and macrophages, play a key role in the regulation of innate immune responses. In mammals, TNF-a and IL-1b, which are important proinflammatory cytokines produced primarily by activated monocytes and macrophages, are potent mediators of immunoinflammatory responses and inducers of other proinflammatory cytokines. MIF is constitutively expressed in innate immune cells such as monocytes and macrophages and promotes the proinflammatory function of the innate and acquired immune systems. GCSF stimulates the survival, proliferation, differentiation, and function of neutrophils. Gene sequences of TNF-a, IL-1b, MIF, and G-CSF have already been identified in X. laevis. To determine whether UII is involved in cytokine production in leukocytes, we evaluated the effects of UII on the expression of these cytokine genes by quantitative real-time RT-PCR. The mRNA expression of TNF-a (Fig. 8A), IL-1b (Fig. 8C), and MIF (Fig. 8E) in leukocytes was significantly increased by treatment with UII (108 M), but UII had no effect on G-CSF mRNA expression (Fig. 8G). Pre-treatment with UTR

Recent studies in mammals including humans have revealed an interaction between the UII–UTR system and the immune system. Increased expressions of UII and UTR have been reported in inflamed sites of atherosclerotic human aorta and coronary arteries (Bousette et al., 2004; Hassan et al., 2005; Maguire et al., 2004). In addition, UTR expression has been reported in rat splenocytes and human PBMCs including macrophages, monocytes, and lymphocytes (Bousette et al., 2004; Segain et al., 2007). Plasma UII level is elevated in patients with hypertension (Rodrigo et al., 2011), coronary heart disease (Chai et al., 2010), type II diabetes mellitus (Gruson et al., 2010), and hepatic cirrhosis (Romanelli et al., 2011), and is most likely to be associated with an inflammatory response in the metabolic syndrome (Barrette and Schwertani, 2012). These reports suggest a potential immune inflammatory function of the UII–UTR system. However, the molecular mechanism and the role of UII–UTR system in immune response and pathologies have not yet been elucidated. In amphibian immune studies, many of the genes known to be involved in mammalian innate immunity have been identified in X. laevis and Xenopus tropicalis (Robert and Ohta, 2009). In Xenopus species, inflammatory stimulation with bacteria and LPS induced increases in some important components (e.g., lectin, cytokines, nitric oxide, stress protein) of innate immune responses in various tissues and plasma (Cui et al., 2011; Morales et al., 2003; Nagata et al., 2013; Nikolaeva et al., 2012). However, few studies have examined the hormonal regulation of immune responses in amphibian leukocytes. Our investigation provided new insights into the role of the UII–UTR system in amphibian immune responses. In the present study, we found that the administration of LPS to frogs induced a marked upregulation of UII and UTR mRNA expression in leukocytes. Similarly, Segain and colleagues reported previously that inflammatory stimuli such as LPS, TNF-a, and interferon-c significantly induced the expressions of UTR mRNA and protein in human PBMC (Segain et al., 2007). They also performed a promoter assay with mutational ablation of the NF-jB binding sites on the UTR promoter and showed that NF-jB binding sites on the UTR promoter are essential for inducing UTR gene transcription in response to LPS stimulation (Segain et al., 2007). We also identified NF-jB binding sites (539 to 550) with high reliability in searching for transcription factor binding sites in the 50 upstream sequence of X. tropicalis UTR gene (scaffold GL172814.1: 827,150–828,280). Increased UTR expression in response to inflammatory stimuli may enhance the function of the UII–UTR system in leukocytes under inflammatory conditions. Our data on UII precursor mRNA expression by LPS stimulus lend support to this idea. The administration of LPS in vivo increased UII mRNA expression in leukocytes by 7.8-fold compared with control. This result suggests that UII acts on UTR-expressing leukocytes in an autocrine or paracrine fashion in the early stage of inflammatory response. However, the transcriptional mechanism of UII in vertebrates remains to be determined. The migration assay of Xenopus leukocytes showed that in addition to the enhancement of leukocyte migration by LPS, treatments with both 108 M UII and URP also exert an obvious migratory effect through UTR. In particular, the migration of monocytes and lymphocytes were increased up to 4.3-fold and 1.5-fold compared to the control by treatment with 108 M UII, respectively. Immunocytochemical observation in our previous study revealed that UTR is expressed in monocytes, lymphocytes, and splenocytes

60

S. Tomiyama et al. / General and Comparative Endocrinology 216 (2015) 54–63

Fig. 8. Effect of UII on the expression of cytokine genes in isolated leukocytes. The expression levels of cytokine genes (TNF-a, IL-b, MIF, and G-CSF) were analyzed by quantitative real-time RT-PCR in Xenopus leukocytes treated with 109–108 M of UII and/or pretreated with 106 M of urantide. The data are expressed as mean ± SE (n = 5). Different letters in the plots indicate significant differences at P < 0.05 (one-way (A, C, and E) or two-way (B, D, and F) ANOVA using Bonferroni correction).

(Konno et al., 2013). Similarly, Bousette et al. (2004) and Segain et al. (2007) also reported previously that UTR mRNA and protein levels were highest in the monocyte and macrophage populations

in human leukocytes, but low in lymphocytes. Treatment of human PBMCs including monocytes, macrophages, and lymphocytes with 108 M UII significantly increased their migration activity (Segain

S. Tomiyama et al. / General and Comparative Endocrinology 216 (2015) 54–63

61

Fig. 9. Predicted pathways of immune functions via the UII–UTR system in monocytes and/or lymphocytes of X. laevis. The UII and UTR system is present in monocytes and/or lymphocytes and is likely to be involved in the control of two immune functions, migration and cytokine production. IL-1b, interleukin-1b; LPS, lipopolysaccharide; MIF, macrophage migration inhibitory factor; TLR4, Toll-like receptor 4; TNF-a, tumor necrosis factor.

et al., 2007; Xu et al., 2009). These results suggest that UII enhances the migration of mononuclear leukocytes (monocytes and lymphocytes) in both amphibians and mammals. The distinct migratory responses between monocytes and lymphocytes found in this study raises two possibilities, although we could not confirm these because of the absence of a valuable tool for isolating each cell population from amphibian leukocytes. One of these may be that the expression of UTR is low in Xenopus lymphocytes. On the other hand, the migratory effect of UII on lymphocytes may be an indirect effect, because IL-1b also induces the migration of human PBMC (Segain et al., 2007). Furthermore, our results that UII upregulated the expression of IL-1b mRNA in Xenopus leukocytes may account for the low migratory effect of lymphocytes. It is well known that the RhoA/Rho kinase pathway is essential to vasocontraction and the control of arterial tone (EtienneManneville and Hall, 2002). This signaling pathway has already been shown to be responsible for the chemotaxis of human peripheral blood lymphocytes and rat splenocytes (Segain et al., 2007; Vicente-Manzanares et al., 2002). Our finding, similar to the mammalian results, that the inhibition of Rho kinase by Y-27632 blocked UII-induced migration of leukocytes isolated from X. laevis suggests that UII-induced migratory effects are mediated through the RhoA/Rho kinase signaling pathway in amphibians. URP shares the same cyclic moiety (CFWKYCV sequence) with UII peptides in various species of vertebrates. In the present study, URP at a dose equal to that of UII exerted a stronger migratory effect than UII. We reported previously that URP displays high potency for intracellular Ca2+ mobilization in Xenopus-UTR-expressing Chinese hamster ovary cells compared with that observed for UII (Konno et al., 2013). Likewise, in competitive binding analyses, URP showed a higher binding affinity to human or rat UTR than to human UII (Sugo et al., 2003). These results suggest that URP activates UTR with high potency compared with UII. However, in the present study, transcripts of URP were not detected in the leukocytes of either the control or LPS-treated frogs. Furthermore, a relationship between URP and immune

function has not been reported to date in every animal species. Thus, URP may be independent of inflammatory responses in at least X. laevis. To identify other immune functions of UII, we evaluated the effect of UII on the expression of four types of cytokine genes (TNF-a, IL-1b, MIF, and G-CSF), which have already been identified in X. laevis. The treatment of 108 M UII to leukocyte suspension resulted in an increase in mRNA expressions of TNF-a, IL-1b, and MIF. The increased gene expressions were suppressed by pre-treatment of the UTR antagonist (106 M urantide). This result suggests that expression of at least three cytokine genes (TNF-a, IL-1b, and MIF) are upregulated through the UII–UTR system. To the best of our knowledge, this finding is the first report on vertebrate leukocytes. We also attempted to determine the potential of cytokine production or release from leukocyte by using an ELISA kit for human MIF, considering Xenopus MIF and human MIF share high (70%) amino acid identity. However, we could not detect a measurable level of MIF in the medium and cell lysate (data not shown). This result may be due to differences in epitope sequence between human and Xenopus MIF. Although the signaling pathway of UII-induced cytokine expression has not yet been elucidated in leukocytes, it is likely that NFjB-dependent pathway, which is activated by the mitogen-activated protein kinase (MAPK) pathway, is involved in the upregulation of cytokine gene expression via the UII–UTR system. It is well known that NF-jB in mammals plays a critical role in the activation of immune cells by upregulating the expression of many cytokines (e.g., IL-1, IL-2, IL-6, IL-12, TNF-a, IFN-c, and GM-CSF) essential to the immune response (Liang et al., 2013). UII increased the phosphorylation of NF-jB in lung adenocarcinoma A549 cells and induced the upregulation of cytokines such as IL-6 and TNFa (Zhou et al., 2012). Furthermore, the mutation of NF-jB binding sites on the IL-8 promoter reduced promoter activity in human umbilical vein endothelial cells, suggesting that the NF-jB transcription factor plays key roles in the induction of IL-8 expression (Lee et al., 2014). These findings support the hypothesis that the

62

S. Tomiyama et al. / General and Comparative Endocrinology 216 (2015) 54–63

UII–UTR system plays an important role in the regulation of the production of various cytokines via the NF-jB-dependent pathway in leukocytes. In view of our results and mammalian results, we conclude that the mechanism of inflammatory responses via the UII–UTR system is present at least in monocytes and/or lymphocytes of X. laevis (Fig. 9). Inflammatory stimulation by LPS increased the gene expression of UII and UTR in Xenopus leukocytes, suggesting that the UII–UTR system is activated in response to inflammation. However, we could not confirm in Xenopus leukocytes whether the upregulation of UII and UTR gene expression is mediated via Toll-like receptor 4 (TLR4), which has been known as the LPS receptor. Recently, Ishii et al. (2007) identified the putative TLR4, which is homologous to mammalian TLR4, from X. laevis. Furthermore, immunoblotting with TLR4 antibody demonstrated that the receptor expresses in frog leukocytes (Nikolaeva et al., 2012), although the function of the LPS receptor of the Xenopus TLR4 remains unclear. We also revealed that the UII–UTR system not only promoted the migration of monocytes and lymphocytes via the RhoA/Rho kinase signaling pathway but also upregulated the expression of some cytokine genes. It is likely that the UII– UTR system plays an important role in the regulation of two immune functions (migration and probably cytokine production) in amphibian leukocytes, although we could not detect a release of cytokines at the protein level. However, whether these immune functions act in both monocytes and lymphocytes or in distinct cells remains unknown. Moreover, the regulatory factor and the mechanism of UII expression are unknown in vertebrates. Understanding the roles and the mechanism of the UII–UTR system in inflammatory responses of vertebrates awaits further study. Acknowledgments This work was supported by a Grant-in-Aid for Scientific Research (C) (25440152) to N.K. from the Japan Society for the Promotion of Science (JSPS) and the Sasakawa Scientific Research Grant (26-527) to S. T. from The Japan Science Society. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ygcen.2015.04. 009. References Aiyar, N., Johns, D.G., Ao, Z., Disa, J., Behm, D.J., Foley, J.J., Buckley, P.T., Sarau, H.M., van-der-Keyl, H.K., Elshourbagy, N.A., Douglas, S.A., 2005. Cloning and pharmacological characterization of the cat urotensin-II receptor (UT). Biochem. Pharmacol. 69, 1069–1079. Aizawa, Y., Nogawa, N., Kosaka, N., Maeda, Y., Watanabe, T., Miyazaki, H., Kato, T., 2005. Expression of erythropoietin receptor-like molecule in Xenopus laevis and erythrocytopenia upon administration of its recombinant soluble form. J. Biochem. 138, 167–175. Ames, R.S., Sarau, H.M., Chambers, J.K., Willette, R.N., Aiyar, N.V., Romanic, A.M., Louden, C.S., Foley, J.J., Sauermelch, C.F., et al., 1999. Human urotensin-II is a potent vasoconstrictor and agonist for the orphan receptor GPR14. Nature 401, 282–286. Balment, R.J., Song, W., Ashton, N., 2005. Urotensin II: ancient hormone with new functions in vertebrate body fluid regulation. Ann. N. Y. Acad. Sci. 1040, 66–73. Barrette, P.O., Schwertani, A.G., 2012. A closer look at the role of urotensin II in the metabolic syndrome. Front. Endocrinol. 3, 165. Bousette, N., Patel, L., Douglas, S.A., Ohlstein, E.H., Giaid, A., 2004. Increased expression of urotensin II and its cognate receptor GPR14 in atherosclerotic lesions of the human aorta. Atherosclerosis 176, 117–123. Chadzinska, M., Plytycz, B., 2004. Differential migratory properties of mouse, fish, and frog leukocytes treated with agonists of opioid receptors. Dev. Comp. Immunol. 28, 949–958. Chai, S.B., Li, X.M., Pang, Y.Z., Qi, Y.F., Tang, C.S., 2010. Increased plasma levels of endothelin-1 and urotensin-II in patients with coronary heart disease. Heart Vessels 25, 138–143.

Conlon, J.M., O’Harte, F., Smith, D.D., Tonon, M.C., Vaudry, H., 1992. Isolation and primary structure of urotensin II from the brain of a tetrapod, the frog Rana ridibunda. Biochem. Biophys. Res. Commun. 188, 578–583. Coulouarn, Y., Jégou, S., Tostivint, H., Vaudry, H., Lihrmann, I., 1999. Cloning, sequence analysis and tissue distribution of the mouse and rat urotensin II precursors. FEBS Lett. 457, 28–32. Coulouarn, Y., Lihrmann, I., Jegou, S., Anouar, Y., Tostivint, H., Beauvillain, J.C., Conlon, J.M., Bern, H.A., Vaudry, H., 1998. Cloning of the cDNA encoding the urotensin II precursor in frog and human reveals intense expression of the urotensin II gene in motoneurons of the spinal cord. Proc. Natl. Acad. Sci. U.S.A. 95, 15803–15808. Cui, X., Han, Y., Pan, Y., Xu, X., Ren, W., Zhang, S., 2011. Molecular cloning, expression and functional analysis of interleukin-8 (IL-8) in South African clawed frog (Xenopus laevis). Dev. Comp. Immunol. 35, 1159–1165. Dai, H.Y., He, T., Li, X.L., Xu, W.L., Ge, Z.M., 2011. Urotensin-2 promotes collagen synthesis via ERK1/2-dependent and ERK1/2-independent TGF-b1 in neonatal cardiac fibroblasts. Cell Biol. Int. 35, 93–98. Dai, H.Y., Kang, W.Q., Wang, X., Yu, X.J., Li, Z.H., Tang, M.X., Xu, D.L., Li, C.W., Zhang, Y., Ge, Z.M., 2007. The involvement of transforming growth factor-beta1 secretion in urotensin II-induced collagen synthesis in neonatal cardiac fibroblasts. Regul. Pept. 140, 88–93. Do-Rego, J.C., Chatenet, D., Orta, M.H., Naudin, B., Le Cudennec, C., Leprince, J., Scalbert, E., Vaudry, H., Costentin, J., 2005. Behavioral effects of urotensin-II centrally administered in mice. Psychopharmacology 183, 103–117. Douglas, S.A., Ohlstein, E.H., 2000. Human urotensin-II, the most potent mammalian vasoconstrictor identified to date, as a therapeutic target for the management of cardiovascular disease. Trends Cardiovasc. Med. 10, 229–237. Etienne-Manneville, S., Hall, A., 2002. Rho GTPases in cell biology. Nature 420, 629– 635. Evans, D.H., Hyndman, K.A., Cornwell, E., Buchanan, P., 2011. Urotensin II and its receptor in the killifish gill: regulators of NaCl extrusion. J. Exp. Biol. 214, 3985– 3991. Gruson, D., Rousseau, M.F., Ketelslegers, J.M., Hermans, M.P., 2010. Raised plasma urotensin II in type 2 diabetes patients is associated with the metabolic syndrome phenotype. J. Clin. Hypertens. 12, 653–660. Hadji-Azimi, I., Coosemans, V., Canicatti, C., 1987. Atlas of adult Xenopus laevis laevis hematology. Dev. Comp. Immunol. 11, 807–874. Hassan, G.S., Douglas, S.A., Ohlstein, E.H., Giaid, A., 2005. Expression of urotensin-II in human coronary atherosclerosis. Peptides 26, 2464–2472. Ishii, A., Kawasaki, M., Matsumoto, M., Tochinai, S., Seya, T., 2007. Phylogenetic and expression analysis of amphibian Xenopus Toll-like receptors. Immunogenetics 59, 281–293. Konno, N., Fujii, Y., Imae, H., Kaiya, H., Mukuda, T., Miyazato, M., Matsuda, K., Uchiyama, M., 2013. Urotensin II receptor (UTR) exists in hyaline chondrocytes: a study of peripheral distribution of UTR in the African clawed frog, Xenopus laevis. Gen. Comp. Endocrinol. 85, 44–56. Lee, C.Y., Tsai, Y.T., Loh, S.H., Liu, J.C., Chen, T.H., Chao, H.H., Cheng, T.H., Chen, J.J., 2014. Urotensin II induces interleukin 8 expression in human umbilical vein endothelial cells. PLoS ONE 9, e90278. Liang, D.Y., Liu, L.M., Ye, C.G., Zhao, L., Yu, F.P., Gao, D.Y., Wang, Y.Y., Yang, Z.W., Wang, Y.Y., 2013. Inhibition of UII/UTR system relieves acute inflammation of liver through preventing activation of NF-jB pathway in ALF mice. PLoS ONE 8, e64895. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. Lu, W., Greenwood, M., Dow, L., Yuill, J., Worthington, J., Brierley, M.J., McCrohan, C.R., Riccardi, D., Balment, R.J., 2006. Molecular characterization and expression of urotensin II and its receptor in the flounder (Platichthys flesus): a hormone system supporting body fluid homeostasis in euryhaline fish. Endocrinology 147, 3692–3708. Maguire, J.J., Kuc, R.E., Wiley, K.E., Kleinz, M.J., Davenport, A.P., 2004. Cellular distribution of immunoreactive urotensin-II in human tissues with evidence of increased expression in atherosclerosis and a greater constrictor response of small compared to large coronary arteries. Peptides 25, 1767–1774. Marchese, A., Heiber, M., Nguyen, T., Heng, H.H., Saldivia, V.R., Cheng, R., Murphy, P.M., Tsui, L.C., Shi, X., Gregor, P., et al., 1995. Cloning and chromosomal mapping of three novel genes, GPR9, GPR10, and GPR14, encoding receptors related to interleukin 8, neuropeptide Y, and somatostatin receptors. Genomics 29, 335–344. Morales, H., Muharemagic, A., Gantress, J., Cohen, N., Robert, J., 2003. Bacterial stimulation upregulates the surface expression of the stress protein gp96 on B cells in the frog Xenopus. Cell Stress Chaperones 8, 265–271. Mori, A., Satsu, H., Shimizu, M., 2003. New model for studying the migration of immune cells into intestinal epithelial cell monolayers. Cytotechnology 43, 57– 64. Nagata, S., Nishiyama, S., Ikazaki, Y., 2013. Bacterial lipopolysaccharides stimulate production of XCL1, a calcium-dependent lipopolysaccharide-binding serum lectin, in Xenopus laevis. Dev. Comp. Immunol. 40, 94–102. Nikolaeva, S., Bachteeva, V., Fock, E., Herterich, S., Lavrova, E., Borodkina, A., Gambaryan, S., Parnova, R., 2012. Frog urinary bladder epithelial cells express TLR4 and respond to bacterial LPS by increase of iNOS expression and L-arginine uptake. Am. J. Physiol. Regul. Integr. Comp. Physiol. 303, R1042– R1052. Nobata, S., Donald, J.A., Balment, R.J., Takei, Y., 2011. Potent cardiovascular effects of homologous urotensin II (UII)-related peptide and UII in unanesthetized eels

S. Tomiyama et al. / General and Comparative Endocrinology 216 (2015) 54–63 after peripheral and central injections. Am. J. Physiol. Regul. Integr. Comp. Physiol. 300, R437–R446. Pearson, D., Shively, J.E., Clark, B.R., Geschwind, I.I., Barkley, M., Nishioka, R.S., Bern, H.A., 1980. Urotensin II: a somatostatin-like peptide in the caudal neurosecretory system of fishes. Proc. Natl. Acad. Sci. U.S.A. 77, 5021–5024. Robert, J., Ohta, Y., 2009. Comparative and developmental study of the immune system in Xenopus. Dev. Dyn. 238, 1249–1270. Rodrigo, R., González, J., Paoletto, F., 2011. The role of oxidative stress in the pathophysiology of hypertension. Hypertens. Res. 34, 431–440. Romanelli, R.G., Laffi, G., Vizzutti, F., Del Bene, R., Marra, F., Caini, P., Guerra, C.T., La Villa, G., Barletta, G., 2011. Elevated plasma levels of urotensin II do not correlate with systemic haemodynamics in patients with cirrhosis. Dig. Liver Dis. 43, 314–318. Segain, J.P., Rolli-Derkinderen, M., Gervois, N., Raingeard de la Blétière, D., Loirand, G., Pacaud, P., 2007. Urotensin II is a new chemotactic factor for UT receptorexpressing monocytes. J. Immunol. 179, 901–909. Singh, R., Rai, U., 2011. Immunomodulatory role of urotensins in teleost Channa punctatus. Gen. Comp. Endocrinol. 170, 613–621. Song, W., Abdel-Razik, A.E., Lu, W., Ao, Z., Johns, D.G., Douglas, S.A., Balment, R.J., Ashton, N., 2006. Urotensin II and renal function in the rat. Kidney Int. 69, 1360– 1368. Sugo, T., Murakami, Y., Shimomura, Y., Harada, M., Abe, M., Ishibashi, Y., Kitada, C., Miyajima, N., Suzuki, N., Mori, M., Fujino, M., 2003. Identification of urotensin IIrelated peptide as the urotensin II-immunoreactive molecule in the rat brain. Biochem. Biophys. Res. Commun. 310, 860–868. Tian, L., Li, C., Qi, J., Fu, P., Yu, X., Li, X., Cai, L., 2008. Diabetes-induced upregulation of urotensin II and its receptor plays an important role in TGF-beta1-mediated

63

renal fibrosis and dysfunction. Am. J. Physiol. Endocrinol. Metab. 295, E1234– E1242. Tostivint, H., Joly, L., Lihrmann, I., Parmentier, C., Lebon, A., Morisson, M., Calas, A., Ekker, M., Vaudry, H., 2006. Comparative genomics provides evidence for close evolutionary relationships between the urotensin II and somatostatin gene families. Proc. Natl. Acad. Sci. U.S.A. 103, 2237–2242. Vicente-Manzanares, M., Cabrero, J.R., Rey, M., Pérez-Martínez, M., Ursa, A., Itoh, K., Sánchez-Madrid, F., 2002. A role for the Rho-p160 Rho coiled-coil kinase axis in the chemokine stromal cell-derived factor-1alpha-induced lymphocyte actomyosin and microtubular organization and chemotaxis. J. Immunol. 168, 400–410. Watanabe, T., Suguro, T., Kanome, T., Sakamoto, Y., Kodate, S., Hagiwara, T., Hongo, S., Hirano, T., Adachi, M., Miyazaki, A., 2005. Human urotensin II accelerates foam cell formation in human monocyte-derived macrophages. Hypertension 46, 738–744. Xu, S., Jiang, H., Wu, B., Yang, J., Chen, S., 2009. Urotensin II induces migration of endothelial progenitor cells via activation of the RhoA/Rho kinase pathway. Tohoku J. Exp. Med. 219, 283–288. Yano, K., Hicks, J.W., Vaudry, H., Conlon, J.M., 1995. Cardiovascular actions of frog urotensin II in the frog, Rana catesbeiana. Gen. Comp. Endocrinol. 97, 103–110. Yano, K., Vaudry, H., Conlon, J.M., 1994. Spasmogenic actions of frog urotensin II on the bladder and ileum of the frog, Rana catesbeiana. Gen. Comp. Endocrinol. 96, 412–419. Zhou, C.H., Wan, Y.Y., Chu, X.H., Song, Z., Xing, S.H., Wu, Y.Q., Yin, X.X., 2012. Urotensin II contributes to the formation of lung adenocarcinoma inflammatory microenvironment through the NF-jB pathway in tumor-bearing nude mice. Oncol. Lett. 4, 1259–1263.