Ursodeoxycholic acid protects against cisplatin-induced acute kidney injury and mitochondrial dysfunction through acting on ALDH1L2

Journal Pre-proof Ursodeoxycholic acid protects against cisplatin-induced acute kidney injury and mitochondrial dysfunction through acting on ALDH1L2 Yunwen Yang, Suwen Liu, Huiping Gao, Peipei Wang, Yue Zhang, Aihua Zhang, Zhanjun Jia, Songming Huang PII:

S0891-5849(19)31732-0

DOI:

https://doi.org/10.1016/j.freeradbiomed.2020.01.182

Reference:

FRB 14587

To appear in:

Free Radical Biology and Medicine

Received Date: 14 October 2019 Revised Date:

20 January 2020

Accepted Date: 24 January 2020

Please cite this article as: Y. Yang, S. Liu, H. Gao, P. Wang, Y. Zhang, A. Zhang, Z. Jia, S. Huang, Ursodeoxycholic acid protects against cisplatin-induced acute kidney injury and mitochondrial dysfunction through acting on ALDH1L2, Free Radical Biology and Medicine (2020), doi: https:// doi.org/10.1016/j.freeradbiomed.2020.01.182. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier Inc.

Ursodeoxycholic Acid protects against cisplatin-induced acute kidney injury and mitochondrial dysfunction through acting on ALDH1L2 Yunwen Yang1, 2, 3*, Suwen Liu1, 2, 3*, Huiping Gao1, 2, 3, Peipei Wang1, 2, 3, Yue Zhang1, 2, 3

, Aihua Zhang1,2,3, Zhanjun Jia1, 2, 3, and Songming Huang1, 2, 3

1.Department of Nephrology, Children’s Hospital of Nanjing Medical University, 72 Guangzhou Road, Nanjing 210008, P. R. of China 2. Nanjing Key Laboratory of Pediatrics, Children’s Hospital of Nanjing Medical University, Nanjing 210008, China 3. Jiangsu Key Laboratory of Pediatrics, Nanjing Medical University, Nanjing 210029, China. *: These authors equally contributed to this work. Correspondence to: Songming Huang, Department of Nephrology, Children’s Hospital of Nanjing Medical

University,

72

Guangzhou

Road,

Nanjing

210008,

China,

Tel:

0086-25-8311-7309, Fax: 0086-25-8330-4239, Email: [email protected]. Zhanjun Jia, Department of Nephrology, Children’s Hospital of Nanjing Medical University, 72 Guangzhou Road, Nanjing 210008, China, Tel: 0086-25-8311-7309, Fax: 0086-25-8330-4239, Email: [email protected]. Aihua Zhang, Department of Nephrology, Children’s Hospital of Nanjing Medical University, 72 Guangzhou Road, Nanjing 210008, China, Tel: 0086-25-8311-7309, Fax: 0086-25-8330-4239, Email: [email protected].

1

Highlights: Ursodeoxycholic acid (UDCA) ameliorated cisplatin-induced acute kidney injury. UDCA protected against cisplatin-induced mitochondrial dysfunction. UDCA protected against redox imbalance induced by cisplatin in renal tubule cells through acting on ALDH1L2

2

Abstract Mitochondrial dysfunction plays an important role in acute kidney injury (AKI). Thus, the agents improving the mitochondrial function could be beneficial for treating AKI. Ursodeoxycholic acid (UDCA) has been demonstrated to prevent mitochondrial dysfunction under pathology, however, its role in AKI and the underlying mechanism remain unknown. This study aimed to evaluate the effect of UDCA on cisplatin-induced AKI. In vivo, C57BL/6J mice were treated with cisplatin (25 mg/kg) for 72 h to induce AKI through a single intraperitoneal (i.p.) injection with or without UDCA (60 mg/kg/day) administration by gavage. Renal function, mitochondrial function and oxidative stress were analyzed to evaluate kidney injury. In vitro, mouse proximal tubular cells (mPTCs) and human proximal tubule epithelial cells (HK2) were treated with cisplatin with or without UDCA treatment for 24 h. Transcriptomic RNA-seq was preformed to analyze possible targets of UDCA. Our results showed that cisplatin-induced increments of serum creatinine (Scr), blood urea nitrogen (BUN), and cystatin C were significantly reduced by UDCA along with ameliorated renal tubular injury evidenced by improved renal histology and blocked upregulation of neutrophil gelatinase associated lipocalin (NGAL) and kidney injury molecule 1 (KIM-1). Meanwhile, the apoptosis induced by cisplatin was also markedly attenuated by UDCA administration. In vitro, UDCA treatment protected against tubular cell apoptosis possibly through antagonizing mitochondrial dysfunction and oxidative stress by targeting ALDH1L2 which was screened out by an RNA-seq analysis. Knockout of ALDH1L2 by CRISPR/Cas9 greatly blunted the protective effects of 3

UDCA in renal tubular cells. Moreover, UDCA did not diminish cisplatin’s antineoplastic effect in human cancer cells. In all, our results demonstrated that UDCA protects against cisplatin-induced AKI through improving mitochondrial function through acting on the expression of ALDH1L2, suggesting a clinical potential of UDCA for the treatment of AKI. Key words: Cisplatin; AKI; UDCA; ALDH1L2; mitochondrial dysfunction

4

1. Introduction Acute kidney injury (AKI) is a worldwide public health problem with increasing morbidity and mortality (1-3). Clinical studies have reported that AKI affected more than 13.3 million patients, leading to about 1.7 million deaths of the world every year (4, 5). Ischemia and cellular toxicity induced by clinical drugs such as cisplatin are major pathological factors of AKI (6). Cisplatin is a chemotherapeutic agent which is widely used in treatment of some solid tumors including head and neck, lungs, bladder, and other organs tumors (7). However, the severe side effects of cisplatin especially nephrotoxicity significantly hindered its clinical application (8). Although several underlying mechanisms of cisplatin-induced nephrotoxicity have been reported during the past decades (9), the details are still elusive, which results in no specific and satisfactory therapies in clinic. It is well documented that cisplatin induces massive tubular cell death including necrosis and apoptosis, which serves as the main pathological factor of cisplatin toxicity (10-12). Multiple signaling pathways afford to the injury and death of renal tubular cells induced by cisplatin (9, 13, 14). In the last decade, accumulating evidence suggest that mitochondrial dysfunction plays an important role in cisplatin-induced kidney injury (15, 16). Because tubule cells in the kidney are rich in mitochondria(17) and the positively charged cisplatin metabolites can easily cross-link with the negatively charged mitochondrial DNA and disrupt mitochondrial structure and function(15, 18). Mitochondria are the major source of energy 5

production and play key roles in the metabolism of cells (19, 20). Cisplatin-induced mitochondria damage was always characterized by increased reactive oxygen species (ROS) production, reduced mitochondrial membrane potential and ATP production (15, 21). Overproduction of ROS induced by cisplatin disrupts the balance of redox homeostasis in renal tubule cells which contributes to cisplatin-induced cell death and is crucial to the progression of cisplatin-induced nephrotoxicity (14, 22, 23). Thus, targeting the improvement of mitochondrial function could be a novel therapeutic strategy in protecting against cisplatin nephrotoxicity. Ursodeoxycholic acid (UDCA) is a type of hydrophilic bile acid extracted from animal bile and has been used as a hepatoprotective drug for cholestasis and chronic hepatitis; additionally, it is also a drug approved by FDA for the treatment of primary biliary cholangitis (24, 25). Several early reports indicate that UDCA with anti-apoptotic, immunomodulation, anti-oxidative stress and anti-inflammatory activities can improve metabolic disorders in several metabolic diseases including obesity and diabetes (26-28). Recently, UDCA has shown to regulate macrophages polarization(29), protect against Alzheimer’s disease(30), Parkinson’s disease(31) and alcohol-induced hepatotoxicity(32), by improving mitochondrial function in vivo or in vitro. However, the mechanism of the direct protective effects of UDCA in improving mitochondria dysfunction remains elusive. In addition, whether UDCA could protect against cisplatin-induced nephrotoxicity is still unknown. A genome-wide transcriptomic analysis from our study showed the expression of ALDH1L2 (Aldehyde dehydrogenase family 1 member L2) was upregulated 6

significantly after treatment with UDCA in renal tubule cells. ALDH1L2, a member of aldehyde dehydrogenase family and ALDH1L subfamily, is the mitochondrial homolog of 10-Formyltetrahydrofolate dehydrogenase (mtFDH) (33), playing an essential role in the folate metabolism and NADPH regeneration in mitochondria (34). NADPH is needed to transform GSSG to GSH and is of importance in maintaining redox homeostasis and energy metabolism (35, 36). Previous studies indicated that ALDH1L2 deficiency resulted in enhanced sensitivity of cells to oxidative injury (37). Although UDCA could improve mitochondrial dysfunction and attenuate oxidative stress under multiple pathological conditions, whether such protective effects are mediated by ALDH1L2 remain unknown. Therefore, this study was to investigate whether UDCA could target ALDH1L2 to protect against AKI induced by cisplatin.

2. Materials and Methods 2.1 Establishment of cisplatin-induced AKI mouse model Adult male C57BL/6J mice, about 8 weeks old, were obtained from Laboratory Animal Center of Nanjing Medical University (Nanjing, China). Mice were maintained under a standard SPF animal room with a 12:12-h light/dark cycle and free access to food and water. In a dose-response experiment, UDCA (MedChemExpress, HY-13771) at the doses of 20mg/kg, 40mg/kg, and 60mg/kg was used to pretreat the mice for 72 h, followed by cisplatin challenge (a single intraperitoneal (i.p.) injection (25 mg/kg)) for additional 72 h (UDCA treatment was continued once daily). Then we fully estimated the therapeutic effects of UDCA (60mg/kg) on cisplatin-induced acute 7

injury. Mice were assigned to four groups: vehicle (10% PEG400 in saline) group (vehicle, n=8), UDCA group (UDCA, n=8), cisplatin-treated group (vehicle + cisplatin, n=8) and cisplatin plus UDCA group (UDCA + cisplatin, n=8). The mice were treatment with cisplatin (Sigma-Aldrich, 15663-27-1) by a single intraperitoneal (i.p.) injection (25 mg/kg), in both cisplatin and UDCA + cisplatin groups, vehicle and UDCA group received an equal amount of saline. Mice in UDCA treatment groups were treated with 60 mg/kg/d UDCA in 10% PEG400 in saline once daily by oral gavage 72 h before cisplatin treatment, and the UDCA treatment was continued once daily until the mice were sacrificed. The mice in other groups received an equal amount of vehicle (10% PEG400 in saline) once daily. The mice of all groups were euthanized after they received cisplatin treatment for 72 h. The blood samples were collected through posterior vena cava using 25G needles and kidneys were collected when the mice were anesthetized through continuous isoflurane by using a calibrated anesthetic delivery machine as previously described (38). Serum and kidneys were obtained and stored at −80°C for further analyses. The tissues collected for histology were fixed in 4% paraformaldehyde. The levels of serum creatinine (Scr) and blood urea nitrogen (BUN) were evaluated using an automatic biochemical analyzer in Children’s Hospital of Nanjing Medical University. All animal experiments were approved by the Institutional Animal Care and Use Committee of Nanjing Medical University (registration number: IACUC 14030112-2). 2.2 Cell culture and treatment A human proximal tubule epithelial cell line (HK2), mouse renal proximal tubule 8

cells (mPTCs), human hepatocarcinoma cells (HepG2), human medulloblastoma cells (Daoy) and human non-small cell lung cancer cells (A549) were obtained from American Type Culture Collection (ATCC, Manassas, VA). HK2 and mPTCs were cultured in DMEM/F-12 medium (Gibco, 319-075-CL), and HepG2, Daoy and A549 cells were cultured in DMEM medium. The medium was supplemented with 10% fetal bovine serum (FBS, GIBCO, 26170035), penicillin (100 U/mL) and streptomycin (100 µg/mL), and the cells were maintained at 37 °C in 5% CO2 in a humidified incubator. Cells were deprived from FBS when grown to 70% confluence and pretreated with UDCA (dissolved in DMSO) for 3 h. Then cisplatin was added to treat mPTCs (5 µg/mL cisplatin), HK2 (10 µg/mL cisplatin) or tumor cell lines (different concentration) for 24 h. 2.3 Quantitative real-time PCR Total RNA was extracted from kidney tissues or cells using TRIzol (TAKARA, Dalian, China; 9108) following the manufacturer’s instructions. cDNA was obtained from 1µg total RNA using a reverse transcriptase M-MLV kit (TAKARA, 2641A). The primers (Table 1) were designed and synthesized by Generay Biotech (Shanghai, China). Real-time PCR amplification was performed using the SYBR Green master mix (Vazyme, Nanjing, China; q111-02/03) in a QuantStudio 3 Real-time PCR System (Applied Biosystems, Foster City, CA, USA). Cycling conditions were 95°C for 10 minutes, followed by 40 repeats of 95°C for 15 s and 60°C for 1 minute. β-actin was used as an internal control and the relative threshold cycle values (∆Ct) was used to analyze and calculate the relative levels of messenger RNA (mRNA) 9

expression, then converted to fold changes using 2−∆∆Ct method as described previously (39). 2.3 Western Blotting The kidney tissues or cells were lysed in protein lysis buffer(50 mM Tris–HCl, 250 mM NaCl, 0.5% Triton X-100, 50 mM NaF, 2 mM EDTA and 1 mM Na3VO4) supplemented with 1 × protease inhibitor cocktail (Roche, 04693132001) for 20 min on ice, then centrifuged for 15 min at 4ºC, 12,000 rpm. The protein concentration was measured using the Bradford method. 30 µg of total protein was used for Western blotting analysis following standard methods. The primary antibodies against cleaved caspase-3 (Cell Signaling Technology; 9664, 1:1000), NGAL(Abcam; ab63929, 1:1000), BAX (Proteintech; 50599-2-Ig, 1:1000), KIM-1 (R&D systems, AF1817, 1:1000), ATPB (Proteintech; 17247-1-AP, 1:1000), SOD2 (Proteintech; 24127-1-AP, 1:1000),

ND1

(Proteintech;

19703-1-AP,

1:1000),

ALDH1L2

(Proteintech;

21391-1-AP, 1:1000), β-actin (Biogot; AP0060, 1:1000) were diluted in 3% nonfat milk prepared in TBST (Tris-buffered saline, 0.1% Tween 20). Peroxidase-conjugated goat anti-rabbit secondary antibodies (Beyotime; A0208) were used at 1:1000 dilution. The enhanced chemiluminescence detection system (Bio-Rad, Hercules, CA, USA) was used to detect immunoblotted band. Densitometric analysis was performed by using Image J (Wayne Rasband National Institutes of Health, USA). 2.4 Kidney histology The kidney tissues were fixed in 4% paraformaldehyde overnight and embedded in paraffin wax. Then 4 µm thick sections were prepared for periodic acid-Schiff (PAS) 10

staining. Renal histology was analyzed, and the histological changes was evaluated by calculating the percentage of renal tubules that displayed cell lysis, loss of brush border, and cast formation. A score from 0 to 4 was given for tissue pathological damage: 0, no abnormalities; 1+, <25%; 2+, 25–50%; 3+, 50–75%; 4+, >75% (6, 40). Sections were examined under microscopy and the images were captured with an Olympus BX51 microscopy (Olympus, Center Valley, PA). 2.5 Immunohistochemistry The paraffin-embedded kidney slides (4 µm) were deparaffinized and rehydrated, then boiled in 300 ml 1 × improved Citrate Antigen Retrieval Solution (Beyotime, P0083) for 1 min and cooled for 30 min. After blocked with 3% H2O2 for 15 min, sections were incubated with 10% normal goat serum for 60 min at room temperature and then incubated with primary rabbit monoclonal antibody against ALDH1L2 (Proteintech; 21391-1-AP, 1:100) and NGAL (Abcam; ab63929, 1:100) overnight at 4 °C. After washing with TBST buffer for three times, sections were incubated at room temperature with horseradish peroxidase-conjugated secondary antibody for 60 min. After washing with TBST for three times, a DAB kit (ZLI-9018, zsbio, China) was used to detect the localization of peroxidase conjugates. 2.6 TUNEL assay In situ cell death was measured by using a TUNEL BrightGreen Apoptosis Detection Kit as instructed by the manufacture (A112-01/02/03, Vazyme, China). Sections were examined under microscopy and images were acquired by laser scanning confocal microscopy (CarlZeiss LSM710, Germany). Five randomly visual 11

fields of blinded samples were checked, and the number of apoptotic cells was counted. 2.7 Transmission electron microscopy To evaluate the mitochondrial morphology, kidney tissues were collected, fixed in 1.25% glutaraldehyde/0.1 M phosphate buffer, and post fixed in 1% OsO4/ 0.1 M phosphate buffer. Ultrathin sections (60 nm) were cut on a microtome, placed on copper grids, stained with uranyl acetate and lead citrate, and examined in an electron microscope (JEOL JEM-1010,Tokyo, Japanese). Five randomly visual fields of blinded samples were checked, and the percentage of damaged mitochondria (characterized by swollen and disrupted cristae) was quantified and analyzed as described previously (13). 2.8 Enzyme linked immunosorbent assay (ELISA) Serum levels of inflammatory factors including IL-6 and TNF-α were measured by ELISA kits (DAKEWEI, Shenzhen, China) in accordance with the manufacturer's instructions. The levels of Cystatin C in the serum were also detected by a mouse Cystatin C ELISA kit (E-EL-M0389C, Elascience, China). 2.9 Measurement of malondialdehyde (MDA) Malondialdehyde (MDA) is an indicator of lipid oxidation and is a natural product of lipid oxidation. In our study, the levels of MDA in tissues of kidney were measured by using a commercially available lipid peroxidation MDA Assay Kit (Beyotime; S0131) based on the reaction with thiobarbituric acid according to the manufacturer’s instructions. 12

2.10 Cell counting kit-8 (CCK-8) assay Cell viability was analyzed by a CCK-8 assay kit (KGA317, KeyGen Biotech, China). Briefly, mPTCs or cancer cells were seeded in 96 well plate. At 70% confluence, cells were treated with UDCA (6.25 to 100 µg/ml) in serum free medium for 24 h, and then 10 µL CCK-8 reagent was added to the medium and incubated for 2 h. The absorbance was detected at 450 nm with a Multiskan FC microplate reader (Thermofisher, Shanghai, China). 2.11 Cell apoptosis assay After treatment, mPTCs or HK2 cells were washed for three times with cold PBS, then trypsinized with EDTA free trypsin, and the cell concentration was adjusted to 5×104/mL and double-stained with annexin V-FITC and PI using an apoptosis detection Kit (BD Biosciences, 556547, San Diego, CA) according to the manufacturer’s instructions. After incubation for 20 min at room temperature in the dark, the apoptosis was measured using a flow cytometer (BD Biosciences, San Diego, CA) and the results were analyzed using FlowJo software (TreeStar, Ashland, OR, USA). 2.12 RNA sequencing Analysis For RNA sequencing (RNA-seq), RNA samples were collected from mPTCs treatment with or without UDCA (20 µg/ml) for 24 h. RNA isolation, library construction, and sequencing were performed by BGI on a BGISEQ-500 RNA-seq platform

(Beijing

Genomic

Institution,

www.genomics.org.cn,

BGI).

The

GRCm38.p5 reference genome of mouse was used to map with clean tags. For gene 13

expression analysis, the significance of the differential expression genes among different groups was analyzed and defined by the bioinformatics service of BGI according to the combination of the absolute value of log2-Ratio ≥ 1and FDR ≤ 0.001. All original sequence datasets have been submitted to the database of NCBI Sequence Read

Archive

(SRA)

and

the

reviewer

link

(https://dataview.ncbi.nlm.nih.gov/object/PRJNA552037?reviewer=osaberd6v7l7av2b eqo49cu9po). 2.13 Luciferase reporter assay The promoter sequence of human ALDH1L2 was amplified by PCR and the primer sequences were list in Table1. PCR products were purified and constructed into pGL3 basic vector (Promega Corporation) by using a ClonExpress Ultra One Step Cloning Kit (Vazyme, china, C115-01). The ALDH1L2 luciferase reporter plasmids were co-transfected with PRL (Renilla luciferase) into HK2 cells with Lipofectamine® 2000 reagent (Thermo Fisher Scientific, Inc.).

After transfection for

24 h, cells were treated with UDCA at different concentration for another 24 h. Luciferase activity was measured using a Dual-Luciferase Reporter Assay System (Promega Corporation) according to the protocol of the manufacturer (Promega Corporation). The activity of renilla luciferase was used as an internal control. 2.14 CRISPR/Cas9 CRISPR/Cas9 was carried out similar as described in previous study (41). Briefly, the sgRNAs target mouse ALDH1L2 were designed from a web interface of CRISPR design (http://crispr.mit.edu/). The oligonucleotides were synthesized by Generay 14

Biotech (Shanghai, China) and the sequences were listed in Table1. Then the oligonucleotides were annealed into double chains after phosphorylated and cloned into pSpCas9(BB)-2A-Puro (PX459) v2.0 which was a gift from Feng Zhang (Addgene plasmid # 62988). The sequenced CRISPR/Cas9 plasmids targeting ALDH1L2 were transfected into mPTCs with Lipofectamine® 2000 and positive cells were selected using puromycin (2 µg/ mL) for three days prior to clonal expansion. Empty vector was used as negative control. 2.15 Mitochondrial membrane potential The Mitochondrial membrane potential (MMP) of mPTCs or HK2 was detected with tetramethylrhodamine, methyl ester (TMRM, Thermofisher, I34361) which is a cell-permeant dye that accumulates in active mitochondria with intact membrane potentials according to the manufacturer’s instructions. Briefly, the mPTCs or HK2 cells were seeded on sterile polylysine-coated glass flakes and treated with cisplatin for 24 h with or without UDCA treatment. Then the cells were incubated with TMRM in the dark for 30 min at 37 °C and washed with PBS for three times. Fluorescence images were captured by laser scanning confocal microscopy (CarlZeiss LSM710, Germany) and the mean fluorescence intensity of TMRM was analyzed by Image J software. 2.16 Measurement of mitochondrial ROS production After treatment with cisplatin for 12 h, mitochondrial ROS production in mPTCs or HK2 was measured by staining with MitoSOX™ Red mitochondrial superoxide indicator (Thermofisher, M36008) according to the manufacturer’s instructions. 15

Briefly, the mPTCs or HK2 cells were incubated with MitoSOX™ in the dark for 30 min at 37 °C. The fluorescent intensity was measured using a flow cytometer (BD Biosciences, San Diego, CA) and the results were analyzed using FlowJo software (TreeStar, Ashland, OR, USA). 2.17 Measurement of GSH and GSSG A commercially GSH and GSSG Assay Kit (Beyotime, China, S0053) was used to measure reduced glutathione levels (GSH) and oxidized glutathione disulfide (GSSG) in mPTCs and HK2 cells. Briefly, cultured cells were collected, washed with ice-cold PBS and suspended in the lysis buffer, and the supernatant was used for GSH and GSSG analysis. The total GSH level was measured by the method of DTNB-GSSG recycling assay. 2.18 Measurement of ATP production ATP content in HK2 or mPTCs was analyzed by a luciferase-based bioluminescence enhanced ATP assay Kit (Beyotime, S0027) using a Luciferase Reporter Assay System (Promega Corporation) according to the instructions of the manufacturer. Total ATP levels were calculated by normalizing to protein concentrations. 2.19 Statistical analysis The data were presented as the mean ± standard deviation (S.D.). Statistical analyses were determined by ANOVA followed by a Bonferroni multiple comparison test or Student's t-test using GraphPad Prism 6 software. A value of P< 0.05 was considered significant. 16

3. Results 3.1 UDCA ameliorated cisplatin-induced acute kidney injury in mice In the dose-response experiment, UDCA at 60 mg/kg showed better effect on protecting against cisplatin-induced renal dysfunction (Figure 1A &1B). Thus, mice were pretreated with UDCA (60 mg/kg) or vehicle (10% PEG400 in saline) by gavage once daily for 3 consecutive days before cisplatin administration. As shown in Figure 1C-E, the renal function after 72 h cisplatin treatment was significantly impaired as shown by increased serum creatinine (from 4.33 ± 0.33 to 131.20 ± 12.35 µM, P < 0.001) (Figure 1C), blood urea nitrogen (from 8.93 ± 0.93 to 70.08 ± 3.71 mM, P < 0.001) (Figure 1D), and serum cystatin C (from 8.83 ± 0.65 to 18.96 ± 0.66 ng/ml, P < 0.001) (Figure 1E). Renal PAS staining indicated that obvious tubular injury was induced by cisplatin as shown by tubular cell necrosis, renal tubule dilation and protein cast formation in renal tubules (Figure 1F). Strikingly, 60mg/kg UDCA treatment remarkably improved renal function as shown by reduced serum creatinine (from 131.20 ± 12.35 to 41.33 ± 8.17 µM, P<0.001) (Figure 1C), blood urea nitrogen (from 70.08 ± 3.71 to 43.80 ± 4.03, P<0.001) (Figure 1D), and serum cystatin C (from 18.96 ± 0.66 to 13.06 ± 1.12, P<0.01) (Figure 1C). Figure 1F & 1G showed that renal morphological abnormalities were also significantly attenuated by UDCA treatment. To further clarify the reno-protective effects of UDCA against cisplatin-induced renal tubule injury, the protein levels of renal tubular injury markers of neutrophil gelatinase associated lipocalin (NGAL) and kidney injury molecule 1 (KIM-1) were 17

also examined. Immunohistochemical staining showed that NGAL were increased significantly in the tubules of mice treated with cisplatin, which was significantly blunted after UDCA treatment (Figure 2A). Additionally, the results of Western blotting showed that the protein levels of NGAL and KIM-1 in kidneys of cisplatin-treated mice were markedly reduced when treated with UDCA (Figure 2B-E). All of these data suggested that pretreatment with UDCA could attenuate cisplatin-induced renal dysfunction and pathological damage. Furthermore, we did not find any obvious side effects of UDCA on kidneys of normal mice (Figure 1 & Figure 2).

3.2 UDCA treatment attenuated apoptosis and inflammatory response in the kidneys of mice treated with cisplatin TUNEL staining and Western blotting were used to analyze apoptosis induced by cisplatin. As shown in Figure 3A&B, the number of TUNEL positive cells were increased significantly in renal tubules of cisplatin-treated mice, which were markedly decreased by UDCA treatment. The results of Western blotting showed that the enhanced protein levels of bax and cleaved caspase-3 in the kidneys of cisplatin-treated mice were markedly decreased by UDCA treatment (Figure 3C & D). These findings suggested that UDCA treatment could prevent cisplatin-induced apoptosis in mouse kidney. Inflammatory response is another significant pathological feature of cisplatin nephrotoxicity. In this study, the effect of UDCA treatment on cisplatin-induced renal 18

inflammation was also analyzed. QRT-PCR results showed that the expression of inflammatory factors including IL-1β, IL-6, TNFα, and COX-2 was greatly induced by cisplatin, which was significantly blunted after UDCA treatment (Figure 3E). Additionally, ELISA data showed that the enhanced protein levels of IL-6 and TNFα in circulation were significantly reduced by UDCA (Figure 3F & G). These data indicated that UDCA treatment inhibited inflammatory response in cisplatin-induced nephrotoxicity.

3.3 ALDH1L2 was modulated by UDCA in renal tubular cells To explore the mechanism of UDCA in protecting against cisplatin-induced tubular injury, we conducted a genome-wide transcriptomic consequences of UDCA treatment in cultured mouse proximal tubular epithelial cell line (mPTCs). Firstly, cell viability of mPTCs treatment with UDCA at increasing concentrations from 6.25 µg/mL to 100 µg/mL for 24 h was determined by a CCK8 assay. The results showed that the concentrations of UDCA without exceeding 50 µg/mL did not decrease cell viability of mPTCs compared to the vehicle group (Figure 4A). Next, RNA sequencing analysis was performed on mPTCs treatment with 20 µg/mL UDCA or cisplatin (5 µg/mL) for 24 h. The results of microarray analysis revealed approximately 179 genes that were markedly regulated by UDCA and more than 3900 genes were regulated by cisplatin. A Venn diagram shows that about 88 differentially expressed genes were both regulated by UDCA and cisplatin (Figure 4B). Several studies showed that UDCA 19

treatment improved cellular metabolic pathways including mitochondrial metabolism (29) which plays an important role in cisplatin nephrotoxicity (42). Thus, we performed KEGG pathway analysis for metabolic pathways which were related to both UDCA and cisplatin treatment. A heat map of KEGG pathway clustering of metabolism pathways genes included in above 88 genes showed that only one gene, ALDH1L2 (highlighted by red box), which is an mitochondrial isoform of 10-Formyltetrahydrofolate

dehydrogenase

(FDH)

was

positively

regulated

(upregulated by more than 2 folds, P<0.01) by UDCA treatment while negatively regulated (decreased by more than two folds, P<0.01) by cisplatin treatment (Figure 4C). For further validation of the results of RNA-seq, cultured mouse tubular cell line (mPTCs) and human tubular cell line (HK2) were treated with UDCA and/or cisplatin. QRT-PCR analysis showed the mRNA levels of ALDH1L2 both in mPTCs and HK2 were upregulated by UDCA treatment at a dose dependent manner. However, the mRNA levels of ALDH1L2 both in mPTCs and HK2 were markedly decreased after treatment with cisplatin, which was entirely restored by UDCA treatment in HK2 but partly restored in mPTCs (Figure 4D). To confirm whether Aldh1l2 is regulated by UDCA at transcription level, luciferase reporter plasmids carrying the promoter of human ALDH1L2 was constructed and transfected into HK2 cells, then treated with 10 or 20 µg/ml UDCA. Compared with the control, UDCA treatment significantly increased the luciferase activity of cells transfected with ALDH1L2 promoter luciferase reporter plasmids (Figure 4E). All of these results suggested UDCA directly 20

regulated the expression of ALDH1L2 at transcriptional level which is consistent with the findings from RNA-Seq. Furthermore, Western blotting was performed to analyze the dose effects of UDCA treatment on regulating the protein levels of ALDH1L2 in HK2. The results showed that the concentration of UDCA less than 20 µg/ml could upregulate the protein levels of ALDH1L2 at a dose dependent manner. However, the concentration of UDCA more than 30 µg/ml couldn’t further upregulate the protein levels of ALDH1L2, suggesting that 20-30 µg/ml of UDCA reached its highest capability in driving the protein expression or such high doses caused cellular toxicity to some extent (Figure 4F&G). All of above results suggested ALDH1L2 perhaps play an important role in mediating UDCA effect on protecting against cisplatin-induced renal tubular injury.

3.4 UDCA treatment upregulated the expression of ALDH1L2 and attenuated cisplatin-induced mitochondrial dysfunction in mice To further clarify the role of UDCA in upregulating the expression of ALDH1L2 in vivo，we examined the protein levels of ALDH1L2 in kidneys of cisplatin-treated mice. As shown by the results of Western blotting, the protein levels of ALDH1L2 were decreased significantly by cisplatin, which were remarkably restored by UDCA treatment (Figure 5A&B). Similarly, qRT-PCR analysis showed the mRNA levels of ALDH1L2 were also upregulated after UDCA treatment as compared with vehicle group (Figure 5C). Immunohistochemical staining showed that ALDH1L2 mainly expressed in renal tubules and UDCA treatment could upregulate or restore the 21

expression of ALDH1L2 in renal tubules (Figure 5D). ALDH1L2 is a mitochondrial isoform of 10-Formyltetrahydrofolate dehydrogenase (mtFDH) which plays an essential role in folate metabolism via NADPH-regenerating manner and consequently modulates mitochondrial redox balance to maintain mitochondrial function (43, 44). Thus, we examined whether cisplatin-induced mitochondrial damage could be prevented by UDCA treatment. Electron microscopy of renal proximal tubular cells revealed that mitochondria with swollen and disrupted cristae in renal tubular cells of cisplatin-treated mice were strikingly attenuated by UDCA treatment (Figure 5E & 5F). Then real-time PCR was performed to analyze the mRNA levels of mitochondrial DNA-encoded genes including mt-Nd1, mt-Nd2, mt-Nd3, mt-Nd4, mt-Nd5, mt-Nd6, mt-cox1, mt-cox2, mt-cox3, mt-cytb, mt-ATP6, and mt-ATP8. The results showed the expression of all of these genes were markedly decreased by cisplatin challenge, which was consistent with previous observations (16). Interestingly, the reduced expression of these genes was partially or completely restored by UDCA treatment (Figure 5G). Additionally, the results of Western blotting showed UDCA treatment completely prevented cisplatin-induced downregulation of the expression of mitochondrial respiratory chain–associated proteins such as mitochondrial SOD (SOD2), ATPB and mt-ND1 (Figure 5H & 5I). The levels of MDA, an index of mitochondria dysfunction and oxidative stress, were also examined in this study. As expected, UDCA administration reduced MDA content in kidneys of cisplatin-treated mice (Figure 5J). All these data demonstrated a potent effect of UDCA treatment on protecting against cisplatin-induced renal mitochondrial injury. 22

3.5 UDCA improved mitochondrial function and protected against renal tubular cell apoptosis induced by cisplatin in vitro We further investigated whether cisplatin-induced oxidative stress and mitochondrial dysfunction could improve by UDCA treatment in vitro. Firstly, the GSH activities were investigated, the results showed the ratio of GSH to GSSH was decreased significantly when challenged with cisplatin, which was entirely restored by treatment with UDCA in cultured HK2 (Figure 6A). Next, we checked the levels of ATP production in cells and found cisplatin markedly reduced the production of ATP both in HK2 (Figure 6B) and mPTCs (Figure 7E), which was partly restored by UDCA treatment (Figure 6B & Figure 7E). Additionally, the reduced mitochondrial membrane potential in cisplatin-treated HK2 cells was recovered by treatment with UDCA (Figure 6C & D). Given that cisplatin treatment markedly increases the production of mitochondrial ROS, we investigated the levels of mitochondrial ROS by mitosox staining to clarify the status of mitochondrial oxidative stress. As shown in Figure 6E & F, UDCA treatment largely normalized mitochondrial ROS induced by cisplatin. All these results demonstrated a potent role of UDCA in antagonizing oxidative stress and mitochondrial dysfunction in vitro. Next, we further evaluated the effect of UDCA treatment on cisplatin-induced apoptosis in HK2 cells and mPTCs. Flow cytometry was performed to detect the apoptotic response in cisplatin-treated mPTCs or HK2 cells with or without UDCA pretreatment. The results showed that the apoptosis of HK2 cells induced by cisplatin was significantly inhibited by pretreatment with UDCA at a dose dependent manner 23

(Figure 6G & H). In agreement with the protective effect on cell apoptosis, UDCA treatment significantly decreased the levels of cleaved caspase-3 induced by cisplatin in a dose-dependent manner (Figure 6I & 6J). In mPTCs, similar protective effects were observed (Figure 7A-D) along with the upregulation of ALDH1L2 protein. All of these results suggested a protective effect of UDCA against renal tubular cell apoptosis induced by cisplatin.

3.6 Knockout of ALDH1L2 by CRISPR/cas9 greatly blunted the protective effect of UDCA in renal tubular cells ALDH1L2 is a possible target of UDCA in protecting against cisplatin-induced tubular injury based on above results. To elucidate the role of ALDH1L2 in mediating the protective effect of UDCA in cisplatin-induced acute renal tubular injury, ALDH1L2-deficient mPTCs (ALDH1L2-/-) was constructed by CRISPR/cas9 method and Western blotting was performed to confirm the successful construction of ALDH1L2-/- mPTCs (Figure 8A & B). Then ALDH1L2-/- mPTCs and control cells were used in a cisplatin-induced cell model. Given that ALDH1L2 is an enzyme located in mitochondria and plays important role in maintain mitochondrial function, we studied whether ALDH1L2-deficiency could blunt the protective effect of UDCA against cisplatin-induced mitochondrial dysfunction. The GSH activity was examined and the results showed ALDH1L2-deficiency decreased the ratio of GSH to GSSH slightly

compared

with

control

mPTCs

at

basal

condition.

Strikingly,

ALDH1L2-deficiency aggravated the reduction of the ratio of GSH to GSSH when 24

challenged with cisplatin compared with control cells (the relative ratio: 0.33 ± 0.03 in cisplatin-treated ALDH1L2-deficiency cells vs. 0.59 ± 0.05 in cisplatin-treated control cells) (Figure 8C). Importantly, the reduction of GSH to GSSH ratio induced by cisplatin was almost entirely restored by treatment with UDCA in control cells, while such a reduction was only slightly restored in ALDH1L2-deficient cells (Figure 8D & E). Similarly, mitosox staining showed ALDH1L2-deficiency abolished the protective effect of UDCA on inhibiting the overproduction of mitochondrial ROS induced by cisplatin compared with control cells (Figure 8F & G). All of these results suggested the protective effect of UDCA on improving mitochondrial function in renal tubular cells could be through ALDH1L2. Furthermore, the results of apoptosis analyzed by flow cytometry demonstrated that ALDH1L2-deficiency greatly blunted the protective effect of UDCA on inhibiting the apoptosis induced by cisplatin (20 µg/ml UDCA treatment slightly decreased the percentage of apoptotic cells from 65.6 ± 1.26 to 60.1 ± 0.94 in ALDH1L2-/- cells, while such a dose of UDCA lowered the percentage of apoptotic cells from 54.7 ± 1.28 to 37.1 ± 1.59 in control cells) (Figure 9A & B). TUNEL staining further confirmed the protective effect of UDCA in antagonizing cisplatin-induced tubular cell apoptosis, which was greatly blunted by ALDH1L2 knockout in mPTCs (Figure 9C & D). Additionally, ALDH1L2 knockout also blunted UDCA effect on lowering protein levels of cleaved caspase-3 in cisplatin-treated mPTCs. These results suggested UDCA protected the renal tubular cell from injury induced by cisplatin mainly but not entirely through targeting ALDH1L2. 25

3.7 UDCA effect on the antineoplastic activity of cisplatin in tumor cell lines Finally, we evaluated the UDCA effect on the antineoplastic activity of cisplatin. By CCK8 assay, we found that UDCA alone dose-dependently reduced cell viability in several tumor cell lines including HepG2 (Human Hepatocarcinoma Cells), Daoy (Human Medulloblastoma Cells), and A549 (Human Non-Small Cell Lung Cancer Cells) (Figure 10A-C), suggesting an anticancer potential. Under the cisplatin treatment, the reduced cell viability in HepG2 and Daoy cells was not influenced by UDCA (Figure 10D & E), while the cell viability in A549 cells was further lowered by UDCA (Figure 10F). By flow cytometry analysis, we observed that UDCA did not affect cisplatin-induced cell apoptosis in Daoy cells (Figure 10G & H). However, UDCA promoted cell apoptosis in cisplatin-treated A459 cells (Figure 10I & J). Interestingly, although we showed that the protein levels of ALDH1L2 were upregulated in renal tubular cells after UDCA treatment, it was not upregulated in tumor cell lines (Figure 10K & L), suggesting a cell type-dependent response. All these data suggested that UDCA might not diminish the antineoplastic activity of cisplatin.

4. Discussion Although cisplatin has powerful anti-cancer effect, its clinical use is limited by the side effects including nephrotoxicity (7). Renal tubule cells are reported to be the main target of cisplatin toxicity because they are rich in mitochondria (17). 26

Mitochondrial dysfunction induced by cisplatin results in impaired tubular mitochondrial enzyme activity (45) and overproduction of mitochondria ROS suppressing the activities of endogenous antioxidant enzymes such as superoxide dismutase (SOD), glutathione (GSH) and disrupting the redox homeostasis of renal tubule cells, which contribute to the cell injury induced by cisplatin (46, 47). A number of antioxidants such as melatonin, selenium, vitamin E, etc. have been investigated and showed protective effect against cisplatin-induced nephrotoxicity (48). Moreover, Mukhopadhyay et al. found that mitochondria-targeted antioxidants such as Mito-CP dose-dependently prevented cisplatin-induced renal dysfunction through improving mitochondrial function, suggesting that mitochondria-targeted antioxidants may serve as effective therapeutic agents against cisplatin nephrotoxicity (49). UDCA, a hydrophilic bile acid, has been reported to be a powerful antioxidant and is currently used as a ‘panacea’ for the pharmacological treatment of a wide range of hepatic diseases (29). In the present study, we demonstrated that UDCA could ameliorate cisplatin-induced nephrotoxicity in mice. Our results showed that UDCA treatment at a dose of 60 mg/kg by gavage significantly protected renal tubular cells against cisplatin-induced apoptosis, inflammation, oxidative stress, and mitochondrial abnormality. Additionally, we observed that cisplatin-induced morphological disruption of kidney tubules was markedly attenuated by UDCA treatment. Consistently, in vitro experiments also showed that treatment with UDCA protected against cisplatin-induced renal tubular cell apoptosis, oxidative stress and 27

mitochondrial dysfunction. These evidences strongly suggested a potential of UDCA clinically in treating cisplatin-induced renal tubular cell injury. Although the protective action of UDCA in other diseases have been confirmed by several previous studies, perhaps through inhibiting ER stress(31), improving mitochondrial function(29) or anti-inflammatory effects(27), however, the mechanisms of UDCA in playing such roles are still elusive and need further investigation. Thus, we investigated the possible mechanisms underlying the reno-protective effect of UDCA on cisplatin-induced nephrotoxicity via a whole genome transcriptomic analysis performed in renal proximal tubule cell after treating with UDCA or cisplatin. RNA-seq and luciferase reporter assay suggested that ALDH1L2, a mitochondrial homolog of 10-formyltetrahydrofolate dehydrogenase (33), was regulated by UDCA at transcription level and perhaps play an important role in mediating UDCA effect on protecting against cisplatin-induced tubular injury. Consistent with above result, both mRNA and protein levels of ALDH1L2 were also upregulated after UDCA alone treatment in vivo and in vitro. These results suggested that UDCA treatment increased the protein level of ALDH1L2 perhaps through regulating the transcription of ALDH1L2 in a direct or indirect manner. Importantly, knockout of ALDH1L2 by CRISPR/cas9 greatly blunted the protective effect of UDCA in renal tubular cells in response to cisplatin challenge. Although ALDH1L2 deficiency didn’t entirely abolish the protective effect of UDCA on cisplatin-induced renal tubule cell injury and there was no strong evidence showing the direct interaction between UDCA and ALDH1L2, our results still demonstrated that the enhanced ALDH1L2 could be a downstream 28

contributor of UDCA in protecting kidney in the present study. Interestingly, we found that UDCA did not upregulate the protein levels of ALDH1L2 in tumor cell lines including A549 and Daoy cells, suggesting a cell type-dependent regulation of ALDH1L2 by UDCA. ALDH1L2, a NADPH-regenerating folate metabolism enzyme (34), has been reported with a positive impact on glucose and energy homeostasis (29, 50), improving insulin sensitivity(51), accelerating bile acid enterohepatic circulation(52), and playing an important role in cellular redox homeostasis (37). Additionally, our results and previous studies showed no obvious side effects of UDCA on disturbing cellular homeostasis and others (29, 53). Under the normal conditions, UDCA-induced upregulation of ALDH1L2 could be rebalanced by other signaling pathways in function. Although the roles of ALDH1L2 in regenerating NADPH and keeping cellular redox homeostasis all benefit kidney during kidney injury, the function of ALDH1L2 in the pathogenesis of AKI has not been reported. Our study demonstrated that the downregulation of ALDH1L2 in kidneys undergoing cisplatin-induced injury could afford to the mitochondrial dysfunction and renal tubule cell damage, and upregulation or activation of ALDH1L2 could improve mitochondrial function, ameliorating AKI. In present study, we demonstrated that ALDH1L2 might serve as a new target in treatment of cisplatin-induced nephrotoxicity. Moreover, several previous studies reported that UDCA could be combined with anticancer drugs to enhance the anticancer activities (54, 55). In the present study, we also evaluated UDCA effect on the anticancer effect of cisplatin and found that UDCA 29

did not diminish the anticancer activity of cisplatin in HepG2 and Daoy cells. Interestingly, UDCA further reduced cell viability and enhanced cell apoptosis in A549 cells treated with cisplatin, which agrees with previous report (56). These data and previous reports highly suggested that UDCA could not diminish the anticancer activity of cisplatin. 5. Conclusion The importance of this study is that we demonstrate a very potent effect of UDCA, an FDA approved antioxidant agent for the treatment of primary biliary cirrhosis and other cholestatic liver diseases (24, 25), on treating cisplatin-induced nephrotoxicity. And such a protection against AKI could be through improving mitochondrial function by targeting ALDH1L2. Our findings definitely offered a clinical potential of UDCA in treating AKI although further animal and clinical studies are still needed.

Abbreviations AKI: acute kidney injury; Cis.: Cisplatin; UDCA: Ursodeoxycholic acid; mPTCs: mouse proximal tubular cells; HK2: human proximal tubule epithelial cells; Scr: Serum creatinine; BUN: blood urea nitrogen; ALDH1L2: Aldehyde dehydrogenase family 1 member L2; NADPH: nicotinamide adenine dinucleotide phosphate; ELISA: Enzyme linked immunosorbent assay; ATP: adenosine triphosphate; ROS: reactive oxygen species；GSH: reduced glutathione; GSSG: oxidized glutathione disulfide; TUNEL: Terminal deoxynucleotidyl transferase dUTP nick end labeling; TNF-α: Tumor necrosis factor-α; IL: interleukin; PAS: periodic acid-Schiff. TEM: Transmission 30

electron microscopy.

Funding This work was supported by grants from the National Natural Science Foundation of China (81700642, 81670647, 81625004, 81830020, 81530023, 81700604, 81873599, and

81800598),

the

National

Key

Research

and

Development

Program

(2016YFC0906103), the Natural Science Foundation of Jiangsu Province (No. BK20170150), the China Postdoctoral Science Foundation (2018M640505) and Jiangsu Postdoctoral Science Foundation (2018K042A). Jiangsu Province Science and Education Qiang Wei Project (No. ZDRCA2016074)

Authors’ contributions YY, SL, HG and WP performed the experiments and prepared the figures. SH, ZJ and YY designed the experiments, analyzed data, and wrote the main manuscript text. AZ and YZ offered assistance for this manuscript and all authors reviewed the manuscript.

Competing Interests On behalf of all authors, the corresponding authors state that there is no conflict of interest.

References: 1.

Rewa O, Bagshaw SM. Acute kidney injury-epidemiology, outcomes and

economics. Nature reviews Nephrology. 2014;10(4):193-207. 31

2.

Waikar SS, Liu KD, Chertow GM. Diagnosis, epidemiology and outcomes of acute

kidney injury. Clinical journal of the American Society of Nephrology : CJASN. 2008;3(3):844-61. 3.

Kellum JA. Acute kidney injury. Critical care medicine. 2008;36(4 Suppl):S141-5.

4.

Morigi M, Rota C, Remuzzi G. Mesenchymal Stem Cells in Kidney Repair.

Methods in molecular biology. 2016;1416:89-107. 5.

Section 3: Prevention and Treatment of AKI. Kidney international supplements.

2012;2(1):37-68. 6.

Weidemann A, Bernhardt WM, Klanke B, Daniel C, Buchholz B, Campean V, et al.

HIF activation protects from acute kidney injury. Journal of the American Society of Nephrology : JASN. 2008;19(3):486-94. 7.

Pabla N, Dong Z. Cisplatin nephrotoxicity: mechanisms and renoprotective

strategies. Kidney international. 2008;73(9):994-1007. 8.

Arany I, Safirstein RL. Cisplatin nephrotoxicity. Seminars in Nephrology.

2003;23(5):460-4. 9.

Volarevic V, Djokovic B, Jankovic MG, Harrell CR, Fellabaum C, Djonov V, et al.

Molecular mechanisms of cisplatin-induced nephrotoxicity: a balance on the knife edge between renoprotection and tumor toxicity. Journal of biomedical science. 2019;26(1):25. 10. Ramesh G, Reeves WB. TNFR2-mediated apoptosis and necrosis in cisplatin-induced acute renal failure. American journal of physiology Renal physiology. 2003;285(4):F610-8. 32

11. Faubel S, Ljubanovic D, Reznikov L, Somerset H, Dinarello CA, Edelstein CL. Caspase-1-deficient mice are protected against cisplatin-induced apoptosis and acute tubular necrosis. Kidney international. 2004;66(6):2202-13. 12. Li J, Xu Z, Jiang L, Mao J, Zeng Z, Fang L, et al. Rictor/mTORC2 protects against cisplatin-induced tubular cell death and acute kidney injury. Kidney international. 2014;86(1):86-102. 13. Oh CJ, Ha CM, Choi YK, Park S, Choe MS, Jeoung NH, et al. Pyruvate dehydrogenase kinase 4 deficiency attenuates cisplatin-induced acute kidney injury. Kidney international. 2017;91(4):880-95. 14. Pabla N, Dong G, Jiang M, Huang S, Kumar MV, Messing RO, et al. Inhibition of PKCdelta reduces cisplatin-induced nephrotoxicity without blocking chemotherapeutic efficacy in mouse models of cancer. The Journal of clinical investigation. 2011;121(7):2709-22. 15. Bajwa A, Rosin DL, Chroscicki P, Lee S, Dondeti K, Ye H, et al. Sphingosine 1-phosphate receptor-1 enhances mitochondrial function and reduces cisplatin-induced tubule injury. Journal of the American Society of Nephrology : JASN. 2015;26(4):908-25. 16. Morigi M, Perico L, Rota C, Longaretti L, Conti S, Rottoli D, et al. Sirtuin 3-dependent mitochondrial dynamic improvements protect against acute kidney injury. The Journal of clinical investigation. 2015;125(2):715-26. 17. Hovater MB, Olteanu D, Welty EA, Schwiebert EM. Purinergic signaling in the lumen of a normal nephron and in remodeled PKD encapsulated cysts. Purinergic 33

signalling. 2008;4(2):109-24. 18. Miller RP, Tadagavadi RK, Ramesh G, Reeves WB. Mechanisms of Cisplatin nephrotoxicity. Toxins. 2010;2(11):2490-518. 19. Dhingra R, Kirshenbaum LA. Regulation of mitochondrial dynamics and cell fate. Circulation journal : official journal of the Japanese Circulation Society. 2014;78(4):803-10. 20. Devin A, Rigoulet M. Mechanisms of mitochondrial response to variations in energy demand in eukaryotic cells. American journal of physiology Cell physiology. 2007;292(1):C52-8. 21. Zhan M, Brooks C, Liu F, Sun L, Dong Z. Mitochondrial dynamics: regulatory mechanisms and emerging role in renal pathophysiology. Kidney international. 2013;83(4):568-81. 22. Arany I, Safirstein RL. Cisplatin nephrotoxicity. Seminars in nephrology. 2003;23(5):460-4. 23. dos Santos NA, Carvalho Rodrigues MA, Martins NM, dos Santos AC. Cisplatin-induced nephrotoxicity and targets of nephroprotection: an update. Archives of toxicology. 2012;86(8):1233-50. 24. Hirschfield GM, Dyson JK, Alexander GJM, Chapman MH, Collier J, Hubscher S, et al. The British Society of Gastroenterology/UK-PBC primary biliary cholangitis treatment and management guidelines. Gut. 2018;67(9):1568-94. 25. Ali AH, Tabibian JH, Carey EJ, Lindor KD. Emerging drugs for the treatment of Primary Biliary Cholangitis. Expert opinion on emerging drugs. 2016;21(1):39-56. 34

26. Dosa PI, Ward T, Castro RE, Rodrigues CM, Steer CJ. Synthesis and evaluation of water-soluble prodrugs of ursodeoxycholic acid (UDCA), an anti-apoptotic bile acid. ChemMedChem. 2013;8(6):1002-11. 27. Bellentani S. Immunomodulating and anti-apoptotic action of ursodeoxycholic acid: where are we and where should we go? European journal of gastroenterology & hepatology. 2005;17(2):137-40. 28. Lefebvre P, Cariou B, Lien F, Kuipers F, Staels B. Role of bile acids and bile acid receptors in metabolic regulation. Physiological reviews. 2009;89(1):147-91. 29. Chen YS, Liu HM, Lee TY. Ursodeoxycholic Acid Regulates Hepatic Energy Homeostasis

and

White

Adipose

Tissue

Macrophages

Polarization

in

Leptin-Deficiency Obese Mice. Cells. 2019;8(3). 30. Bell SM, Barnes K, Clemmens H, Al-Rafiah AR, Al-Ofi EA, Leech V, et al. Ursodeoxycholic Acid Improves Mitochondrial Function and Redistributes Drp1 in Fibroblasts from Patients with Either Sporadic or Familial Alzheimer's Disease. Journal of molecular biology. 2018;430(21):3942-53. 31. Abdelkader NF, Safar MM, Salem HA. Ursodeoxycholic Acid Ameliorates Apoptotic Cascade in the Rotenone Model of Parkinson's Disease: Modulation of Mitochondrial Perturbations. Molecular neurobiology. 2016;53(2):810-7. 32. Manley S, Ding W. Role of farnesoid X receptor and bile acids in alcoholic liver disease. Acta pharmaceutica Sinica B. 2015;5(2):158-67. 33. Krupenko NI, Dubard ME, Strickland KC, Moxley KM, Oleinik NV, Krupenko SA. ALDH1L2 is the mitochondrial homolog of 10-formyltetrahydrofolate dehydrogenase. 35

The Journal of biological chemistry. 2010;285(30):23056-63. 34. Fan J, Ye J, Kamphorst JJ, Shlomi T, Thompson CB, Rabinowitz JD. Quantitative flux

analysis

reveals

folate-dependent

NADPH

production.

Nature.

2014;510(7504):298-302. 35. Gorrini C, Harris IS, Mak TW. Modulation of oxidative stress as an anticancer strategy. Nature reviews Drug discovery. 2013;12(12):931-47. 36. Elena Piskounova2 MA, Malea M. Murphy2. Oxidative stress inhibits distant metastasis by human melanoma cells. Nature. 2015;527(7577):186-91. 37. Ducker GS, Chen L, Morscher RJ, Ghergurovich JM, Esposito M, Teng X, et al. Reversal of Cytosolic One-Carbon Flux Compensates for Loss of the Mitochondrial Folate Pathway. Cell metabolism. 2016;24(4):640-1. 38. Overmyer KA, Thonusin C, Qi NR, Burant CF, Evans CR. Impact of anesthesia and euthanasia on metabolomics of mammalian tissues: studies in a C57BL/6J mouse model. PloS one. 2015;10(2):e0117232. 39. Rajeevan MS, Ranamukhaarachchi DG, Vernon SD, Unger ER. Use of real-time quantitative PCR to validate the results of cDNA array and differential display PCR technologies. Methods. 2001;25(4):443-51. 40. Yang Y, Yu X, Zhang Y, Ding G, Zhu C, Huang S, et al. Hypoxia-inducible factor prolyl hydroxylase inhibitor roxadustat (FG-4592) protects against cisplatin-induced acute kidney injury. Clinical science. 2018;132(7):825-38. 41. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nature protocols. 2013;8(11):2281-308. 36

42. Townsend DM, Tew KD, He L, King JB, Hanigan MH. Role of glutathione S-transferase Pi in cisplatin-induced nephrotoxicity. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie. 2009;63(2):79-85. 43. Strickland KC, Krupenko NI, Dubard ME, Hu CJ, Tsybovsky Y, Krupenko SA. Enzymatic properties of ALDH1L2, a mitochondrial 10-formyltetrahydrofolate dehydrogenase. Chemico-biological interactions. 2011;191(1-3):129-36. 44. Ye J, Fan J, Venneti S, Wan YW, Pawel BR, Zhang J, et al. Serine catabolism regulates

mitochondrial

redox

control

during

hypoxia.

Cancer

discovery.

2014;4(12):1406-17. 45. Zsengeller ZK, Ellezian L, Brown D, Horvath B, Mukhopadhyay P, Kalyanaraman B, et al. Cisplatin nephrotoxicity involves mitochondrial injury with impaired tubular mitochondrial enzyme activity. The journal of histochemistry and cytochemistry : official journal of the Histochemistry Society. 2012;60(7):521-9. 46. Stoyanoff TR, Todaro JS, Aguirre MV, Zimmermann MC, Brandan NC. Amelioration of lipopolysaccharide-induced acute kidney injury by erythropoietin: involvement of mitochondria-regulated apoptosis. Toxicology. 2014;318:13-21. 47. Srivastava S, Sinha D, Saha PP, Marthala H, D'Silva P. Magmas functions as a ROS regulator and provides cytoprotection against oxidative stress-mediated damages. Cell death & disease. 2014;5:e1394. 48. Oh GS, Kim HJ, Shen A, Lee SB, Khadka D, Pandit A, et al. Cisplatin-induced Kidney Dysfunction and Perspectives on Improving Treatment Strategies. Electrolyte & blood pressure : E & BP. 2014;12(2):55-65. 37

49. Mukhopadhyay P, Horvath B, Zsengeller Z, Zielonka J, Tanchian G, Holovac E, et al. Mitochondrial-targeted antioxidants represent a promising approach for prevention of

cisplatin-induced

nephropathy.

Free

radical

biology

&

medicine.

2012;52(2):497-506. 50. Sanchez-Garcia A, Sahebkar A, Simental-Mendia M, Simental-Mendia LE. Effect of ursodeoxycholic acid on glycemic markers: A systematic review and meta-analysis of clinical trials. Pharmacological research. 2018;135:144-9. 51. Ma H, Sales VM, Wolf AR, Subramanian S, Matthews TJ, Chen M, et al. Attenuated Effects of Bile Acids on Glucose Metabolism and Insulin Sensitivity in a Male Mouse Model of Prenatal Undernutrition. Endocrinology. 2017;158(8):2441-52. 52. Zhang Y, Jiang R, Zheng X, Lei S, Huang F, Xie G, et al. Ursodeoxycholic acid accelerates bile acid enterohepatic circulation. British journal of pharmacology. 2019;176(16):2848-63. 53. Ozcan U, Yilmaz E, Ozcan L, Furuhashi M, Vaillancourt E, Smith RO, et al. Chemical chaperones reduce ER stress and restore glucose homeostasis in a mouse model of type 2 diabetes. Science. 2006;313(5790):1137-40. 54. van Heumen BW, Roelofs HM, Te Morsche RH, Marian B, Nagengast FM, Peters WH. Celecoxib and tauro-ursodeoxycholic acid co-treatment inhibits cell growth in familial adenomatous polyposis derived LT97 colon adenoma cells. Experimental cell research. 2012;318(7):819-27. 55. Lee S, Cho YY, Cho EJ, Yu SJ, Lee JH, Yoon JH, et al. Synergistic effect of ursodeoxycholic acid on the antitumor activity of sorafenib in hepatocellular carcinoma 38

cells via modulation of STAT3 and ERK. International journal of molecular medicine. 2018;42(5):2551-9. 56. Goossens JF, Bailly C. Ursodeoxycholic acid and cancer: From chemoprevention to chemotherapy. Pharmacology & therapeutics. 2019;203:107396.

Figure legends Figure 1. UDCA treatment protected against cisplatin-induced acute kidney injury. (A) Serum creatinine (Scr) levels in mice treated with different doses of UDCA after 72h cisplatin administration. (B) Blood urea nitrogen (BUN) levels in mice treated with different doses of UDCA after 72h cisplatin administration. Data were shown as means ± S.D. of each group (n = 6 mice of each group); ns: no significant, ***P<0.001, **P<0.01, *P<0.05 (ANOVA with multiple comparison). (C-E) Scr (C), BUN (D) and serum cystatin C (E) of mice treated with 60mg/kg UDCA after 72h cisplatin administration (n = 8 mice of each group); ***P<0.001, **P<0.01(ANOVA with multiple comparison). (F) Representative images of periodic acid-Schiff staining (magnification ×400, scale bar: 20 µm) of kidneys after 72h cisplatin administration. (G) Analysis of tubular injury score in mice. Data were shown as means ± S.D. of 5 random fields from each mouse (n = 8 mice of each group). Cis.: Cisplatin; ***P<0.001, **P<0.01(unpaired t test). 39

Figure 2. The upregulated expression of NGAL and Kim-1 induced by cisplatin was

decreased

by

UDCA

treatment.

(A)

Representative

images

of

immunohistochemistry staining of NGAL in kidneys from different groups (magnification 400×, scale bar: 20 µm) after 72h cisplatin administration. (B) Representative western blotting analysis of NGAL protein levels in the kidneys of each group. (C) Densitometry analysis of the Western blots of NGAL. (D) Representative western blotting analysis of Kim-1 protein levels. (E) Densitometry analysis of the western blots of Kim-1. The quantitative results were shown as the means ± S.D. from 8 mice of each group (n=8 in each group). Cis.: Cisplatin; ***P<0.001, **P<0.01, *P < 0.05(unpaired t test).

Figure 3. UDCA treatment ameliorated apoptosis and inflammatory response in the kidneys of mice treated with cisplatin. (A) Representative images of TUNEL staining of kidney slides from mice with 72h cisplatin administration (original magnification

400×;

green:

TUNEL;

blue:

DAPI).

(B) The

number of

TUNEL-positive cells of 5 random fields from each kidney. (C & D) The protein levels of Bax and cleaved caspase-3 in the kidneys of cisplatin-treated mice with or without UDCA administration were analyzed by Western blotting. β-actin was used as the internal control and the densitometry analysis was shown (D). (E) qRT-PCR was performed to analysis the mRNA levels of renal IL-1β, IL-6, MCP-1, TNF-α and COX-2. (F & G) The levels of circulating IL-6 (F) and TNF-α (G) was analyzed by 40

ELISA. The quantitative results were shown as the means ± S.D. from 8 mice of each group (n=8 in each group), *P<0.05, **P < 0.01, ***P<0.001(ANOVA with multiple comparison).

Figure 4. ALDH1L2 was modulated by UDCA in renal tubular cells. (A) CCK8 assay was performed to analysis cell viability of mPTCs after treatment with UDCA for 24 h at increasing concentrations ranging from 6.25 to 100 µM. The data from quantitative analyses were expressed as means ± S.D. **P<0.01(ANOVA with multiple comparison). (B) Venn diagram comparing differentially expressed genes in different groups of mPTCs as assessed by RNA-seq and microarray analysis using the samples with UDCA or cisplatin treatment for 24h. The indicated in the diagram are the numbers of genes regulated by UDCA or cisplatin in mPTCs. (C) KEGG pathway clustering analysis from RNA sequencing and heat map showing changes in the expression of metabolic genes among three groups: control, UDCA treatment, and cisplatin treatment. Red box highlighted that ALDH1L2 was one of the most notable metabolic gene upregulated by UDCA but decreased by cisplatin treatment. (D) qRT-PCR validation of the mRNA levels of ALDH1L2 both in mPTCs and HK2 cells treated by cisplatin with or without UDCA. β-actin was used as internal control. (E) Luciferase reporter assay in HK2 cells. Following co-transfection of cells with ALDH1L2 promoter plasmid or pGL3 basic vector and PRL, the cells were treated with 10 and 20 µg/ml UDCA for 24 h. (F & G) Western blotting analysis of protein levels of ALDH1L2 in HK2 cells treated with UDCA at increasing concentrations 41

ranging from 0 to 40 µg/ml for 24 h. (F), and the results of densitometry analysis were shown in G. For above cell experiments, three independent experiments were performed. The data from quantitative analyses were expressed as means ± S.D. Statistical analyses were compared with ctrl or vehicle group, ctrl: control; ***P<0.001, **P<0.01, *P < 0.05 (ANOVA with multiple comparison), n=3 in each group.

Figure 5. UDCA treatment upregulated the expression of ALDH1L2 and attenuated

cisplatin-induced

mitochondrial

dysfunction

in

vivo.

(A)

Representative western blotting analysis of ALDH1L2 in the kidneys of cisplatin-treated mice (72h) with or without UDCA treatment. (B) Densitometry analysis of the Western blots of ALDH1L2, the data from quantitative analyses were shown as the means ± S.D. from 8 mice of each group. (C) qRT-PCR analysis of ALDH1L2 in the kidneys of cisplatin-treated mice with or without UDCA treatment, the quantitative results were shown as the means ± S.D. from 8 mice of each group. (D) Representative Immunohistochemistry (IHC) staining of ALDH1L2 in the kidneys of cisplatin-treated mice (72h) with or without UDCA treatment (original magnification 200×; scale bar: 20 µm). (E) Representative electron microscopy images of renal mitochondria in renal proximal tubular cells after 72h cisplatin exposure. (Upper panel, scale bar: 2 µm and lower panel, scale bar: 1 µm). M: mitochondria; red arrow: damaged mitochondria; TEM: Transmission electron microscopy. (F) Graph represented the results of quantitative analysis of damaged 42

mitochondria (characterized by swollen and disrupted cristae) from electron microscopy images. Data are the means ± S.D. of 5 random fields of 3 mice from each group. ***P<0.001 (unpaired t test). (G) qRT-PCR analysis of genes encoded by the mitochondrial genome, the quantitative results were shown as the means ± S.D. from 8 mice of each group. (H & I) Representative western blots of SOD2, ATPB, and ND1 protein levels in the kidneys of mice and the results of densitometry analysis were shown as the means ± S.D. from 8 mice of each group (I). (J) The levels of MDA in the kidneys of mice was measured by using a commercial kit, the quantitative results were shown as the means ± S.D. from 8 mice of each group. ***P<0.001, **P<0.01, *P < 0.05 (ANOVA with multiple comparison), n=8 in each group.

Figure 6. UDCA improved mitochondrial function and protected against apoptosis in HK2 cells treated with cisplatin. (A) The relative GSH/GSSG ratio (compared with ctrl group) was analyzed in HK2 cells treated by cisplatin (24h) with or without UDCA administration. (B) ATP production was detected in HK2 cells by a commercial kit. (C) Representative fluorescence images of mitochondrial membrane potential (TMRM) in HK2 cells (Original magnification 400x; scale bar: 20 µm). (D) Graph showing the results of quantitative analysis of MFI (mean fluorescence intensity) of TMRM. (E) Representative FACS analysis of MitoSOX staining of HK2 cells. HK2 cells were pretreated with UDCA, then cultured with cisplatin (10 µg/ml) for 12 h. (F) The MFI of MitoSOX was quantified. (G) Representative FACS analysis 43

of Annexin V and PI staining. HK2 cells were pretreated with UDCA, then cultured with cisplatin (10 µg/ml) for 24 h. (H) Quantification of the percentage of apoptotic cells induced by cisplatin. (I) Representative western blots of cleaved caspase-3 induced by cisplatin in HK2 cells. β-actin was used as internal control. (J) Densitometry analysis of the western blots of cleaved caspase-3 was shown. For above cell experiments, three independent experiments were performed. The data from quantitative analyses of three independent experiments were expressed as means ± S.D. Statistical analyses were compared with ctrl or vehicle groups, ctrl: control; ***P<0.001, **P<0.01, *P < 0.05 (ANOVA with multiple comparison), n=3 in each group.

Figure 7. UDCA protected mPTCs against apoptosis induced by cisplatin. (A) Representative flow cytometry analysis of Annexin V and PI staining. mPTCs were pretreated with UDCA for 3 h, then cisplatin (5.0 µg/ml) was added and treated for 24 h. (B) Quantification of flow cytometry.

(C) The protein levels of ALDH1L2 and

cleaved caspase-3 in mPTCs challenged by cisplatin with or without UDCA were analyzed by Western blotting. (D) Densitometry analysis of the Western blots of ALDH1L2 and cleaved caspase-3. (E) ATP production was detected in mPTCs by using a commercial kit. For above cell experiments, three independent experiments were performed. The data from quantitative analyses of three independent experiments were expressed as means ± S.D. Statistical analyses were compared with ctrl groups, ctrl: control; ***P<0.001, **P<0.01, *P < 0.05 (ANOVA with multiple 44

comparison), n=3 in each group.

Figure 8. ALDH1L2-deficiency blunted the protective effect of UDCA against cisplatin-induced mitochondrial dysfunction. (A) Representative western blotting was performed to verify the deletion of ALDH1L2 by CRISPR/Cas9 strategy in mPTCs. (B) Densitometry analysis of the Western blots of ALDH1L2. (C) The GSH/GSSG ratio was analyzed in ALDH1L2 deficient cells (mPTC ALDH1L2-/-) and its control cells (mPTC ctrl) challenged by cisplatin (24h) with or without UDCA treatment. (D) Representative fluorescence images of mitochondrial membrane potential (TMRM) in mPTC ALDH1L2-/- cells and mPTC ctrl cells (Original magnification 400x; scale bar: 20 µm). (E) MFI of TMRM was analyzed. (F) Representative images of FACS analysis of MitoSOX staining in mPTC ALDH1L2-/cells and mPTC ctrl cells. Cells were pretreated with UDCA, then cultured with cisplatin (5 µg/ml) for 12 h. (G) Graph shows the quantification of the MFI of MitoSOX in three independent experiments. For above cell experiments, three independent experiments were performed. The data from quantitative analyses of three independent experiments were expressed as means ± S.D. ctrl: control; ***P<0.001, **P<0.01, *P < 0.05 (ANOVA with multiple comparison).

Figure 9. ALDH1L2-deficiency blunted the protective effect of UDCA against cisplatin-induced apoptosis. (A) Representative images of flow cytometry analysis of Annexin V and PI staining of the cells after treating with cisplatin (24h) with or 45

without UDCA treatment. (B) Quantification of flow cytometry. (C) Representative images of TUNEL staining (original magnification 200×, scale bar: 50 µm; green: TUNEL; blue: DAPI). (D) Quantification of the number of TUNEL-positive cells. Data were presented as means ± S.D. of 5 random fields from three independent experiments. (E) The protein levels cleaved caspase-3 in mPTC ALDH1L2-/- cells and mPTC ctrl cells challenged by cisplatin with or without UDCA treatment were analyzed by western blotting. (F) Densitometry analysis of the Western blots of cleaved caspase-3. For above cell experiments, three independent experiments were performed. The data from quantitative analyses of three independent experiments were expressed as means ± S.D. ns: no significant, ***P<0.001, **P<0.01, *P < 0.05 (ANOVA with multiple comparison).

Figure 10. UDCA effect on the antineoplastic activity of cisplatin in tumor cell lines. (A-C) Effect of UDCA on the cell viability of three tumor cell lines after treatment for 24 h (three independent experiments). (D-F) Effect of UDCA (20 µg/ml, pretreatment for 3 h) on the anti-cancer activity of cisplatin (24 h) in HepG2 cells (D), Daoy cells (E) and A549 cells (F). (G) Representative flow cytometry analysis of Daoy apoptosis. Daoy cells were pretreated with UDCA for 3 h, then treated with cisplatin (50µM) for 24 h. (H) Graph shows quantification of flow cytometry. (I) Representative flow cytometry analysis of A549 apoptosis. A549 cells were pretreated with UDCA for 3 h, then treated with cisplatin (50µM) for 24 h. (J) Graph shows quantification of flow 46

cytometry. (K & L) Western blotting analysis of protein levels of ALDH1L2 in Daoy cells (K) and A549 cells (L) treated with UDCA for 24 h. For above cell experiments, three independent experiments were performed. The data from quantitative analyses of three independent experiments were expressed as means ± S.D. ns: no significant, ***P<0.001, **P<0.01, *P < 0.05 (ANOVA with multiple comparison).

47

Table 1. Primer Sequences Gene Mouse MCP-1 Mouse IL-1β Mouse IL-6 Mouse TNF-α Mouse Cox-2 Mouse ALDH1L2 Mouse mt-ND1 Mouse mt-ND2 Mouse mt-ND3 Mouse mt-ND4 Mouse mt-ND5 Mouse mt-ND6 Mouse mt-COX1 Mouse mt-COX2 Mouse mt-COX3 Mouse mt-ATP6 Mouse mt-ATP8 Mouse mt-cytb Mouse β-actin Human ALDH1L2 Human β-actin

Primer Sequence (5’-3’) F: GCTCTCTCTTCCTCCACCAC R: ACAGCTTCTTTGGGACACCT F: ACTGTGAAATGCCACCTTTTG R: TGTTGATGTGCTGCTGTGAG F: ACAAAGCCAGAGTCCTTCAGAGAG R: TTGGATGGTCTTGGTCCTTAGCCA F: TCCCCAAAGGGATGAGAAG R: CACTTGGTGGTTTGCTACGA F: AGGACTCTGCTCACGAAGGA R: TGACATGGATTGGAACAGCA F: ACCAGCCGGGTTTATTTCAAA R: ACTCCCACTACTCGGTGGC F: ACACTTATTACAACCCAAGAACACAT R: TCATATTATGGCTATGGGTCAGG F: CCATCAACTCAATCTCACTTCTATG R: GAATCCTGTTAGTGGTGGAAGG F: CCCCAAATAAATCTGTA R: CTCATGGTAGTGGAAGT F: GCTTACGCCAAACAGAT R: TAGGCAGAATAGGAGTGAT F: GCCAACAACATATTTCAACTTTTC R: ACCATCATCCAATTAGTAGAAAGGA F: GGGAGATTGGTTGATGTA R: ATACCCGCAAACAAAGAT F: CAGACCGCAACCTAAACACA R: TTCTGGGTGCCCAAAGAAT F: GCCGACTAAATCAAGCAACA R: CAATGGGCATAAAGCTATGG F: CGTGAAGGAACCTACCAAGG R: ATTCCTGTTGGAGGTCAGCA F: CCATAAATCTAAGTATAGCCATTCCAC R: AGCTTTTTAGTTTGTGTCGGAAG F: ACATTCCCACTGGCACC R: GGGGTAATGAATGAGGC F: TTCTGAGGTGCCACAGTTATT R: GAAGGAAAGGTATTAGGGCTAAA F: GAGACCTTCAACACCCCAGC R: ATGTCACGCACGATTTCCC F: TAGTCCAAAGCACGGCTCTAT R: GGTCCTGTATCCAAGCCATCA F: CATGTACGTTGCTATCCAGGC 48

Mouse ALDH1L2 sgRNA-1 Mouse ALDH1L2 sgRNA-2 Human ALDH1L2 promoter

R: CTCCTTAATGTCACGCACGAT F: CACCGTGAACACTCCCACTACTCGG R: AAACCCGAGTAGTGGGAGTGTTCAC F: CACCGCAAGGGTAAAACCATCAAGG R: AAACCCTTGATGGTTTTACCCTTGC F: tgctagcccgggctcgagAGTGCTAGATACTGTAAATC R: taccggaatgccaagcttGCTGGAGAGGAGCGCTAGC

49