- Email: [email protected]
Use of T7 RNA polymerase to produce capped RNA transcripts
technical tips
TIC, - - October 1986
A discontinuous-pHelectmphoresissystemfor RNA
Discontinuous buffer systems are often used in the ~eparation of proteins by SDS-polyacrylamide gel ele.~ax)phoresis, where they have ~e effect of improving ~solution. TI,J~ report descries the use of a discontinuous buffer system in the presence of 8 M urea, to enhance separation of linear and
non-linear RNA molecules of shnilar size. If the pH of the numing bufferis kept constant at 8.3, and the pH of the gel buffer varied between5.5 and 9.5, mobility d drc~Jar RNA mole* cules does not vary appreciably, but the mob'dityof liuear forms increases as the gel pH is decreased, thus effectively
separating the two types of molecule. Separation may be further improve~, if a different buffer m used for the gel and numingbuff~s, ,suggestingthat a salt discontinuitymay enhance the effect. The report claims that the method is very effective in separating the circular form of plant-viroid RNAs beth from linearforms and from host RNAs of similar size. In addition, since
Detectionof singlebasechangesin a regionof knownsequencebycolonyprobingof chromosomalDNA
base changes m a codon of the gene of Sagmonelle~kim u u . Conditions for growth Seven different probes have ofthebacteda, transfertol~ters, been used to investigate single lysisof cells, 6xationof the DNA
In studying the effects of mutagens on bacteria it may often be usefulto determinethe spectrum of mutations (usuanysingle base Ala changes) caused in a particular Codon codon of a target gene. The usual method b to cloneandseque~e the region of interest in e.~ch 5' GGCGTGGTCGATGCCGGTATTATC~GC3' 3' CAGCTACGGCCATAA * 5' mutant. An alternative method involves constructing a set of Ala oligonucleotide probes. The anLicodon probes are complementaryto the DNA re,on under investigation 3, - - - AGG- - - * 5' except that eschprobe containsa different triplet complementary Ser to a differentsingle.basevariant anLicodon of the eodonof interest ~ Lhe original DNA (Fig. 1). Fig. 1. E=arOks# otigonuc~eideProbes.
Original DNA
8 M ~ denatures the i~A, it can be transferred directly to nylon-basedmembranes without add.:,lional deasturation treat. merit It is also suggested that this method may have wider applications, such as in pudf~g lariat RNAs formed during mRNA splicin~
Riviem-Bummante,IL F., Ok R. and ~mancik, J.S, (1986),amd. B~/em. 156, 91-95
onthet~zs andprobingwith the oligenudeotide are desm~ed, and it is daimed tlmt a positive signalin obtainedonly whenthe oligonucleotide matdm the ~ seque~ pe~e~y. The c~m~ advamgesfor ~e metbed are that it in raldd (once probes have been synthesized), u ~ , and allows simul. taneous amlysis of a Im'ge numhar ofmutms. Most hnportantly, s b ~ dmximoml DNA isusedthereis noneed fordonhw or recombination steps.
Exae~ples of otLgonuc~eotide probes ldmer, J. K. aud Barnes, W. M. (1986) Prec. Nat/AaM. SaL USA 83, 1026.-1030
e
A rapid assayfor chloramphenicolacetyltransferase The d
~
aceMU'ms- ~ A . At the end of the assay, incubation mixtures are commonlyusedmarkergene br extracted with ethyl acetate. analysisof transcriptionandreg- The only radioactive molecule
The erratic career of cytoplasmic inheritance Trends in Genetics 1,298-300 (November 1985)
ferase (CAT) gene is the n-~t
ubtion signals of eukaryotic genes. A rapid assay has been desml~l recen~ for analysisof the CAT gene product in ceB extracts. It involves acetylatinn of unlabelledcbloramphenlcolby UC-labellodacetyl coenzyme & An important step is he~ting of cell extracts at 65°C before the assay, to avoid degradation of the limitingsubstmte, acetyi co==
_ _
extracted is :4C.labelled acetyl d ~ Thus enzyne
activity can be assessed by counting the extract directly, avoiding the lengthy chrmnatography zqd autoradiography steps of the. assay method used previously.
Sleigh,M. J. (1986)Am1/.B/ockem. 156,~I-256
Dr Jonathan Ha~ood wishesto point out that, in the above article, his discussionof the 'career' of cytoplasmic inheritance in Germany between the wars was based upon his own publishedpapers,but the discussionof evenlsin Franceand the USA relied entirely upon the work of Dr Jan Sapp (De~,t of History and Philosophyof Science, University of Melbou,'ne, Australia). This work formed the basis of Or Sapp's PhD dissertation from the University of Mo,'::eal. Although Dr 5app's thesis was listed as 'Further Reading' at the end of Dr Harwood'sarticle, itwas not referredto explicitly in thetext and thusm~sunderstandingscould havearisenasto the sourceof the relevant material.
innu
Useof T7 RNApolymeraseto producecapped RNAtranscripts Capped RNAs synthesized in v/bo are useful for studies on processing of eukaryotic RNA and on protein synthesis beth in vitro and after injection into X e ~ u s oocytes, The enzyme SP6 RNA polymerase is usually used to produce capped transcripts but this report describes the useofbactedoplmgel"Ti~JqA polymerase to incorporate the cap analogue 5' 7Me GpppG 3'
254
into RNAs. Incorpomtion~ is claimed to be efficient and possiblyto enhancethe fidelityof initiations. 1"7 RNA polymemse has been cloned, can be obtained from overproducmg bacterial cells and is commerciallyavailableo Nielson, D. A. and Shapiro, D.J. (1986)N~/eic AcidsRes. 14, 5.9-36
~) 1986,ElsevierSciencePuldisbemB.V.,Amstexdam0168- 9525/86/t0.200
TIC, - - October 1986
A discontinuous-pHelectmphoresissystemfor RNA
Discontinuous buffer systems are often used in the ~eparation of proteins by SDS-polyacrylamide gel ele.~ax)phoresis, where they have ~e effect of improving ~solution. TI,J~ report descries the use of a discontinuous buffer system in the presence of 8 M urea, to enhance separation of linear and
non-linear RNA molecules of shnilar size. If the pH of the numing bufferis kept constant at 8.3, and the pH of the gel buffer varied between5.5 and 9.5, mobility d drc~Jar RNA mole* cules does not vary appreciably, but the mob'dityof liuear forms increases as the gel pH is decreased, thus effectively
separating the two types of molecule. Separation may be further improve~, if a different buffer m used for the gel and numingbuff~s, ,suggestingthat a salt discontinuitymay enhance the effect. The report claims that the method is very effective in separating the circular form of plant-viroid RNAs beth from linearforms and from host RNAs of similar size. In addition, since
Detectionof singlebasechangesin a regionof knownsequencebycolonyprobingof chromosomalDNA
base changes m a codon of the gene of Sagmonelle~kim u u . Conditions for growth Seven different probes have ofthebacteda, transfertol~ters, been used to investigate single lysisof cells, 6xationof the DNA
In studying the effects of mutagens on bacteria it may often be usefulto determinethe spectrum of mutations (usuanysingle base Ala changes) caused in a particular Codon codon of a target gene. The usual method b to cloneandseque~e the region of interest in e.~ch 5' GGCGTGGTCGATGCCGGTATTATC~GC3' 3' CAGCTACGGCCATAA * 5' mutant. An alternative method involves constructing a set of Ala oligonucleotide probes. The anLicodon probes are complementaryto the DNA re,on under investigation 3, - - - AGG- - - * 5' except that eschprobe containsa different triplet complementary Ser to a differentsingle.basevariant anLicodon of the eodonof interest ~ Lhe original DNA (Fig. 1). Fig. 1. E=arOks# otigonuc~eideProbes.
Original DNA
8 M ~ denatures the i~A, it can be transferred directly to nylon-basedmembranes without add.:,lional deasturation treat. merit It is also suggested that this method may have wider applications, such as in pudf~g lariat RNAs formed during mRNA splicin~
Riviem-Bummante,IL F., Ok R. and ~mancik, J.S, (1986),amd. B~/em. 156, 91-95
onthet~zs andprobingwith the oligenudeotide are desm~ed, and it is daimed tlmt a positive signalin obtainedonly whenthe oligonucleotide matdm the ~ seque~ pe~e~y. The c~m~ advamgesfor ~e metbed are that it in raldd (once probes have been synthesized), u ~ , and allows simul. taneous amlysis of a Im'ge numhar ofmutms. Most hnportantly, s b ~ dmximoml DNA isusedthereis noneed fordonhw or recombination steps.
Exae~ples of otLgonuc~eotide probes ldmer, J. K. aud Barnes, W. M. (1986) Prec. Nat/AaM. SaL USA 83, 1026.-1030
e
A rapid assayfor chloramphenicolacetyltransferase The d
~
aceMU'ms- ~ A . At the end of the assay, incubation mixtures are commonlyusedmarkergene br extracted with ethyl acetate. analysisof transcriptionandreg- The only radioactive molecule
The erratic career of cytoplasmic inheritance Trends in Genetics 1,298-300 (November 1985)
ferase (CAT) gene is the n-~t
ubtion signals of eukaryotic genes. A rapid assay has been desml~l recen~ for analysisof the CAT gene product in ceB extracts. It involves acetylatinn of unlabelledcbloramphenlcolby UC-labellodacetyl coenzyme & An important step is he~ting of cell extracts at 65°C before the assay, to avoid degradation of the limitingsubstmte, acetyi co==
_ _
extracted is :4C.labelled acetyl d ~ Thus enzyne
activity can be assessed by counting the extract directly, avoiding the lengthy chrmnatography zqd autoradiography steps of the. assay method used previously.
Sleigh,M. J. (1986)Am1/.B/ockem. 156,~I-256
Dr Jonathan Ha~ood wishesto point out that, in the above article, his discussionof the 'career' of cytoplasmic inheritance in Germany between the wars was based upon his own publishedpapers,but the discussionof evenlsin Franceand the USA relied entirely upon the work of Dr Jan Sapp (De~,t of History and Philosophyof Science, University of Melbou,'ne, Australia). This work formed the basis of Or Sapp's PhD dissertation from the University of Mo,'::eal. Although Dr 5app's thesis was listed as 'Further Reading' at the end of Dr Harwood'sarticle, itwas not referredto explicitly in thetext and thusm~sunderstandingscould havearisenasto the sourceof the relevant material.
innu
Useof T7 RNApolymeraseto producecapped RNAtranscripts Capped RNAs synthesized in v/bo are useful for studies on processing of eukaryotic RNA and on protein synthesis beth in vitro and after injection into X e ~ u s oocytes, The enzyme SP6 RNA polymerase is usually used to produce capped transcripts but this report describes the useofbactedoplmgel"Ti~JqA polymerase to incorporate the cap analogue 5' 7Me GpppG 3'
254
into RNAs. Incorpomtion~ is claimed to be efficient and possiblyto enhancethe fidelityof initiations. 1"7 RNA polymemse has been cloned, can be obtained from overproducmg bacterial cells and is commerciallyavailableo Nielson, D. A. and Shapiro, D.J. (1986)N~/eic AcidsRes. 14, 5.9-36
~) 1986,ElsevierSciencePuldisbemB.V.,Amstexdam0168- 9525/86/t0.200