Use of Thermostable andEscherichia coliRNase H in RNA Mapping Studies

ANALYTICAL BIOCHEMISTRY ARTICLE NO.

247, 279–286 (1997)

AB972059

Use of Thermostable and Escherichia coli RNase H in RNA Mapping Studies1 Dave Porter and Norman P. Curthoys Department of Biochemistry and Molecular Biology, Colorado State University, Fort Collins, Colorado 80523-1870

Received October 25, 1996

Ribonuclease H (RNase H) [Ribonuclease (in RNA:DNA hybrids) 5*-oligonucleotidohydrolase, E.C.3.1.26.4] activity recognizes an RNA/DNA duplex and specifically digests the RNA strand within the hybrid (reviewed in 1). This enzyme has been useful in the analysis of native mRNA structure, as specific nucleotide sequences within an RNA species can be marked for hydrolysis by the annealing of a complementary DNA strand. The remaining intact RNA sequences flanking the digestion site can then be manipulated or analyzed fur-

ther. The use of a sequence specific oligodeoxyribonucleotide (ODN)2 with RNase H and Northern blotting is analogous to restriction enzyme digestion and Southern blotting of DNA and has been termed ‘‘H blot’’ analysis (2). This method has been used to follow the extent of polyadenylation of eukaryotic mRNAs (2, 3) and the detection of alternative 5* ends of particular mRNAs using an mRNA specific ODN (4). In addition, it has been shown that the results obtained by RNase H mapping of native mRNA sequences in this manner can give direct evidence that a cloned cDNA sequence represents the mRNA from which it is supposedly derived (5, 6). Most reports have employed the Escherichia coli RNase H or calf thymus RNase H which are commercially available. In addition to these enzymes, a thermostable RNase H (Hybridase) is now available which has a half-life of several hours at 707C (7). The thermostable RNase H allows for increased thermal stringency of ODN/RNA binding and thus increased sequence specificity for RNase H digestion. However, its use in the place of the E. coli or calf thymus enzyme in the areas mentioned above has apparently not been reported. Protocols employing the E. coli RNase H can vary widely between specific reports (5, 8, 9). This likely reflects unique properties peculiar to a given ODN/ RNA combination in a given reaction buffer (10). Details about how these procedures were developed or whether conditions were optimal or merely sufficient are not always included. Thus, the protocol used in any given case may not be generally applicable. In this article, a simplified protocol for use in RNase H analysis of native RNA in conjunction with Northern analysis is described. The protocol has been used successfully in our lab for over 2 years using either the E. coli RNase H or Hybridase. Both enzymes are active in the same reaction buffer; this allows direct compari-

1 This work supported in part by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-37124 to N.P.C.

2 Abbreviations used: ODN, single stranded oligodeoxyribonucleotide; GA, glutaminase; Mops, 3-(N-morpholino)propanesulfonic acid.

A recently introduced thermostable RNase H was tested to determine its effectiveness in RNase H mapping reactions. Procedures are described which should have general use with both the thermostable and the Escherichia coli RNase H enzymes. Using the thermostable RNase H at higher temperatures extends the range of oligodeoxyribonucleotide/RNA combinations that yield satisfactory results. Northern blot analyses of total RNA was used to demonstrate that native RNAs can be analyzed by oligodeoxyribonucleotide directed RNase H digestion with minimal sample processing as long as care is taken to maintain thermal stringency both during reaction assembly and termination. Increased thermal stringency allows for higher DNA concentrations to ensure complete site-specific digestion of target RNAs or to permit simultaneous cleavage with multiple oligodeoxyribonucleotides. Partial digests can also be controlled by manipulating oligodeoxyribonucleotide concentrations. In addition, the thermostable RNase H was shown to be active at magnesium ion concentrations as low as 0.1 mM. This allows for optimization of Mg2/ effects on overall sample integrity and DNA/RNA interactions over at least a 20-fold range (2.0–0.1 mM). q 1997 Academic Press

279

0003-2697/97 $25.00 Copyright q 1997 by Academic Press All rights of reproduction in any form reserved.

AID

AB 2059

/

6m2f$$$$41

03-27-97 23:33:00

aba

280

PORTER AND CURTHOYS

son of thermal effects on reaction specificity and overall sample integrity. In addition, the RNase H reaction can be performed in 0.1 mM MgCl2 , which is 100-fold lower than that recommended by the supplier (Ref. 7; Epicentre Technologies, Madison, WI). Thus both thermal and ionic conditions can be significantly adjusted to meet the needs of a particular experiment. The defined protocol also allowed for more consistent results since the handling and order of addition of reagents during reaction assembly and termination can be important to successful analysis. Consistent results and ease of application may encourage wider RNase H analysis and a better understanding of the composition of the bands detected on Northern blots. MATERIALS AND METHODS

RNase H from E. coli and Hybridase, a thermostable RNase H, were from Epicentre Technologies (Madison, WI). Oligodeoxyribonucleotides complementary to rat or pig glutaminase (GA) cDNA (11, 12) were purchased from Macromolecular Resources (Fort Collins, CO). The ODNs were either resuspended in deionized H2O or 5 mM Tris, pH 7.4. The sequences of the ODNs used in this study were as follows: r573, 5*ACCTGGGATCAGATGTTCGC3*; r1952, 5*TCATGGTGTCCAAAGTGCAGTGC3*; r870, 5*GCCTCTGTCCATCTACTGTAC3*; r990, 5*GCTCTTTCCCAACATATCGATGC3*; r1231, 5*GTAATATCCTATTGCAAAATTTCG3*; p3310, 5*CCGAAACAGAACTGTATTGATGCAGACT3 *; and p2310, 5*CATCACTACCAGATAGAAATACACA3*. The designation r573 indicates that this sequence is complementary to the rat GA cDNA sequence (see Fig. 3 in Ref. 11) starting at position 573 of the rat pGA sequence, etc. The designation p3310 indicates that the sequence is complementary to the pig 5.0-kb GA mRNA sequence starting at position 1578 of a partial porcine pGA201 cDNA (12), and p2310 indicates that the sequence is complementary to the pig 5.0-kb GA mRNA sequence starting at position 593 of the same GA cDNA. The 101 reaction buffer for RNase H contains 0.5 M Tris–Cl (pH 7.4), 1.0 M NaCl, 20 mM MgCl2 , and 10 mM dithiothreitol. Total RNA was isolated from either pig tissue or porcine LLC-PK1-F/ cells as described previously (13) and stored at 0207C in buffered formamide (Formazol; Molecular Research Center, Cincinnati, OH). Rat brain total RNA was a gift of Mike Holbrook. Total RNA in formamide was precipitated with 4.6 vol of 100% ethanol, rinsed with 80% ethanol, briefly airdried at room temperature, and resuspended in deionized H2O. Gel loading buffer contained 50% glycerol, 1 mM disodium EDTA, 0.4% bromophenol blue, and 0.4% xylene cyanol. Denaturing buffer, which contained 20 ml of Formozol, 3 ml 101 Mops (see below), and 6 ml of 37% formaldehyde solution (Sigma), was prepared

AID

AB 2059

/

6m2f$$$$41

03-27-97 23:33:00

fresh for each experiment and maintained at room temperature until use. The 101 Mops running buffer contained 0.4 M 3-(N-morpholino)propanesulfonic acid, 80 mM sodium acetate, 10 mM disodium EDTA and was made pH 7.15 with sodium hydroxide. RNA molecular weight standards were from Life Technologies. Northern analysis was as described in (12). A typical RNase H reaction protocol is outlined in Table 1. Initially, RNA and ODN are combined and denatured at 557C in deionized H2O before the addition of buffer. This is intended to allow denaturation at lower temperatures and the addition of subsequent reagents without further manipulation of the samples. Incubation for less than a minute has been sufficient for our reactions. The introduction of the ODN before the addition of buffer promotes access to the annealing sites which may not be available if the buffer components are present beforehand (14). After denaturation, the sample is placed in a water bath at the final reaction temperature and allowed to equilibrate. Minor nonspecific interactions can be minimized by maintaining both the samples and 101 RNase H buffer at this temperature before this buffer is added to the sample. Careless handling and cooling at this stage increases overall degradation, as duplexes formed may not denature in the presence of the 11 reaction buffer if reequilibrated to the final reaction temperature. Short annealing times are sufficient, usually 2 to 5 min or just long enough to dilute stock enzyme to 1 unit per ml in 11 RNase H reaction buffer. Finally, 1 ml of this enzyme mix is added to start the reaction. Typically, a 15-min incubation is sufficient for complete digestion of the target RNAs (see below) without undue random strand scission. However, shorter times may be possible. Two methods are described below that we have used to stop the reactions without allowing additional nonspecific digestion to occur. The reaction mixture can either be used directly in standard formaldehyde/agarose gels for Northern blotting or purified for further manipulations. For samples to be analyzed by Northern blot, 29 ml of denaturing buffer preincubated at 227C is added directly to the 15-ml reaction, mixed quickly, and placed immediately in a 557C water bath. After 5 min (longer times should be avoided) samples are quenched on ice and either stored at 0207C or gel loading buffer is added and samples are loaded directly to a standard formaldehyde/agarose gel. As judged by the lighter color of the loading dyes after mixing, the entire sample is slightly acidic. This is due to the reaction of the Tris base with the formaldehyde (15). The addition of Mops buffer titrated most, but not all of the acid produced from this reaction. However, the sample is stable at the resulting pH, and the final composition of the sample permits adequate migration of the RNA during electrophoresis. Usually, a control sample is made by omitting

aba

THERMOSTABLE RNase H MAPPING REACTIONS

281

TABLE 1

Summary of Standard Protocol, 15-ml Reaction, X7C 1. 2. 3. 4. 5. 6. 7. 8.

Suspend RNA sample in deionized H2O. Add ODN (typically 50 pmol in 1 ml) and deionized H2O to 12.5 ml. Incubate RNA/DNA mixture at 557C for 45 to 60 s. During this time equilibrate several microliters of 101 RNase H buffer to X7C. Place sample directly in X7C water bath. Add 1.5 ml of the X7C 101 buffer. Dilute stock RNase H to about 1 unit/ml in 11 reaction buffer just before use, set at room temperature. Add 1 ml (1 unit) RNase H. Incubate at X7C for 15 min. Stop reaction without allowing sample to cool below X7C by A. Adding 29 ml of denaturing buffer and incubating sample at 557C for 5 min or B. Adding 165 ml of acidic solution D and extracting with water saturated phenol as in the isolation of total RNA (13).

either enzyme or ODN. In addition to controlling for sample integrity during treatment, a more direct comparison of intact target RNA and RNase H treated samples should be made since the presence of reaction buffer in the final gel loading cocktail effects the mobility of the RNA. Poor electrophoretic distribution of the RNA sample results if the manufacturers recommended reaction buffer for Hybridase (contains 10 mM MgCl2 , 7) is used in this protocol. If necessary, RNasin (Promega) can be included in reactions using either the E. coli RNase at 377C or Hybridase at 477C. The RNase H-treated RNA can be purified from the reaction mix by the same protocol used to isolate the initial total RNA (13), with slight modifications. To a 15-ml reaction, 165.5 ml of acidic guanidine thiocyanate solution (150 ml neutral guanidine thiocyanate solution (13) plus 16.5 ml 2M sodium acetate pH 4.0, room temperature) is added directly to the sample at the end of the incubation period and mixed thoroughly. The acidic conditions favor inactivation of the E. coli RNase H (16) and possibly the Hybridase. Next, 165 ml of water saturated phenol is added, followed by 31 ml of chloroform with mixing after each addition. The sample is set on ice for about 5 min or until visible phase separation occurs and then centrifuged in a microfuge at room temperature for 5 min. The RNA is precipitated from the supernatant by the addition of 1 vol of isopropanol and placed at 0707C for 5 min. The RNA pellet is collected by centrifugation at room temperature for 5–10 min, rinsed with 80% ethanol, briefly air-dried, and resuspended in buffered formamide or deionized H2O. Another variation of the above is that after the addition of the acidic denaturing solution, 1 vol of isopropanol can be added directly without phenol extraction. The pellet can be collected and rinsed as above. In all cases complete desiccation was avoided since it was difficult to resuspend a thoroughly dry pellet in formamide. RESULTS AND DISCUSSION

The experiments described below illustrate the use of the RNase H digestion protocol in optimizing reaction

AID

AB 2059

/

6m2f$$$$41

03-27-97 23:33:00

composition and its use in manipulations useful to RNA mapping studies. The results presented demonstrate (i) that ODN concentrations should be optimized for quantitative digestion of target RNAs, (ii) efficient digestion of multiple target RNAs by Hybridase using as low as 0.1 mM MgCl2 in the reaction, (iii) the effects of ODN type and reaction temperature on digestion specificity, and (iv) that relatively higher ODN concentrations can be used successfully, as demonstrated by using multiple ODNs in a single reaction. The RNA samples analyzed contain one or more putative GA mRNA isoforms. Samples in which only a single major band is detected provide simple patterns for analysis. When more target mRNA species are present, the relatedness of the isoforms can be demonstrated by both the hybridization of the probe and the presence of an ODN site common to each isoform. Probes that hybridize to sequences flanking the ODN annealing site will detect both the 5* and 3* fragments of the target RNA(s) except in cases where the resulting fragment is too short to be dectected in these gels or the overlap between the probe and the fragment is insufficient for a distinct signal. In either case cleavage of the target RNA can still be observed. When performing an RNase H reaction, there are two main sources of nonspecific degradation which can be avoided or minimized. These are thermal effects which are mediated by the buffer components during incubation and the cryptic generation of substrate by nonspecific annealing of the ODN within the RNA sample. Random substrate formation can occur since as little as four RNA/DNA base pairs can be recognized by E. coli RNase H (17). To our knowledge the minimum substrate length for Hybridase has not been reported. The following studies were performed using ODNs which are presumably unique to sites within the target RNA. In such instances more than one cleavage may indicate the presence of cryptic or related sites (18). Since random annealing of the ODN to the RNA commences as soon as the mixture is complete, samples should be kept at the reaction temperatures as much as practical during pipetting to maintain the thermal stringency of

aba

282

PORTER AND CURTHOYS

RNA/DNA annealing. In the reaction buffer used in these studies, the degree of random strand scission in the absence of RNase H or ODN is a function of incubation time and temperature. At temperatures ú557C breakdown is extensive after 15 min (data not shown). Thus, in order to balance the need to moderate thermal degradation and still maintain efficient specific ODN/ RNA interactions, it is important to minimize the length of time the RNA is exposed to elevated temperatures but still achieve complete digestion. When initiating RNase H mapping studies using total cellular RNA, the molar amount of the target RNA is usually unknown even though its abundance may be estimated relative to another RNA within the sample such as actin mRNA or ribosomal RNAs. Thus, the initial amount of ODN necessary to saturate the number of binding sites in a sample is also unknown and must be estimated if quantitative cleavage is desired. In general, enough ODN is used for complete digestion while avoiding an excess of single-stranded DNA, which promotes the formation of nonspecific RNA/DNA hybrids. For example, 5 pmol of ODN p3310 was insufficient to completely digest the 5.0-kb mitochondrial GA mRNA detected in 20 mg of total porcine RNA using the E. coli RNase H at 377C (Fig. 1). Increasing the oligomer to 50 pmol per reaction allowed cleavage of all detectable 5.0-kb GA mRNAs. The amount of ODN necessary for a given oligomer/RNA combination will vary between ODNs. In the experiments reported here, usually 50–75 pmol was sufficient. When more ODN is required for complete digestion, nonspecific interactions can be reduced at higher temperatures using a thermostable RNase H (see below). As in restriction enzyme analysis, partial digest conditions may be an advantage in some strategies. If repetitive sites occur within a given sequence, then presumably a subset of these can be hydrolyzed under suitable conditions. For accurate mapping of native RNA sequence using RNase H, it is important to avoid partial digestion of the target RNAs. Incomplete cleavage may lead to the erroneous conclusion that the actual target RNA is a mixture of related RNAs. If the RNA seems refractory to RNase H hydrolysis, it is possible that the digestion of actual target RNA may be complete, with related intact RNAs still detected. Such uncut RNAs could result from (i) a target RNA which lacks sequence complementary to the oligonucleotide; (ii) the formation of a secondary or tertiary structure which prevents access of the ODN to a complementary sequence (19); (iii) incorrect orientation of cDNA sequence relative to the homologous mRNA, or if double-stranded probes are used, the detected signal may be due to the presence of antisense RNA (e.g., 20); or (iv) an unrelated, but similar sized species of RNA which reacts with probe at the stringency employed (5). The fidelity of nucleic acid annealing is significantly

AID

AB 2059

/

6m2f$$$$41

03-27-97 23:33:00

FIG. 1. Quantitative sequence-specific digestion of target RNAs depends on oligonucleotide concentration. (A) A schematic diagram of the 5.0-kb porcine GA mRNA and the 3.2-kb GA cDNA probe is drawn to scale. Putative translational stop codon (UAA) and polyadenylation (PA) signals are shown for reference. A(N) indicates poly(A) tail of unknown length. (B) Total RNA was isolated from LLC-PK1F/ cells grown in normal medium (12) for 6 days and then transferred to acidic medium (pH 6.9, 10 mM NaHCO3) containing 0.5 mM cycloheximide for 16 h. Samples containing 20 mg total RNA, the indicated concentration of ODN p3310, and E. coli RNase H were incubated at 377C for 20 min. The samples were subjected to Northern analysis and probed with the indicated probe.

influenced by both temperature and ionic strength. Divalent cations contribute substantially to the total ionic strength and have a significant influence on nucleic acid interactions. In addition, the involvement of divalent metal ions in random or selective cleavage of RNA has been known for some time (21 and Refs. therein). In this report the buffer composition was usually maintained constant and the effects of increased temperature on reaction efficiency and specificity was examined. However, as little as 100 nM MgCl2 can be used in the reaction using Hybridase, as shown in Fig. 2. Thus, it is possible to manipulate both the thermal and ionic stringency of ODN/RNA annealing using this thermostable RNase H. This in turn allows greater flexibility in minimizing buffer effects during the RNase H digestion and in subsequent manipulations (i.e., electrophoresis). Figure 2 illustrates the digestion pattern obtained when total LLC-PK1-F/ RNA from starved cells is treated with Hybridase and ODN p2310 to cleave several isoforms of GA mRNA. The GA mRNAs are reduced in size to two bands in the Hybridase-treated lane. These two bands correspond to the 2.7-kb 3* poly-

aba

THERMOSTABLE RNase H MAPPING REACTIONS

283

adenylated fragment from the larger GA mRNA species and the 2.3-kb 5* fragments from each of the GA mRNAs shown in the untreated lane. The composition of the RNase digestion pattern is supported by the data in lanes A/ and A0 where the larger 3* fragment from the 5.0-kb GA mRNA remains with the poly(A)/ RNAs after oligo(dT)-cellulose chromatography. The smaller 5* deadenylated fragments from the 5.0-, 3.5-, and 2.5kb GA mRNAs are found in the A0 fraction. Since an identical reaction buffer can be used with both the E. coli RNase and Hybridase, the specificity of the ODN-mediated digestion can be compared directly at different temperatures. This is illustrated in Fig. 3 by ethidium bromide staining of total RNA and by Northern blot analysis of the GA mRNA. It is assumed here that the observed differences depend mainly on ODN/RNA interactions and are not due to differences in enzyme specificity. In Fig. 3B, ODNs

FIG. 2. Efficient RNase H activity by Hybridase in 0.1 mM MgCl2 . (A) Schematic diagram of the 5.0-kb GA mRNA and the 3.2-kb GA cDNA probe is drawn to scale. Putative translational stop codon (UAA) and polyadenylation (PA) signals are shown for reference. A(N) indicates poly(A) tail of unknown length. (B) Total RNA was isolated from LLC-PK1-F/ cells incubated in depleting medium (starved) for 4 days to enhance the levels of several putative GA mRNAs (12). A sample containing 100 mg total RNA and 200 pmol ODN p2310 (see A) was treated with Hybridase at 477C in the standard reaction buffer, except the MgCl2 concentration was 0.1 mM, and then subjected to Northern analysis. An aliquot of the digested RNA was fractionated by oligo(dT)-cellulose chromatography. The lanes contain untreated total RNA (unt), RNase H digested (RH) RNA, and RNA from the poly(A)/ (A/) or poly(A)0 (A0) fractions. The upper band in the RH lane is the 3* 2.7-kb fragment from the 5.0-kb GA mRNA and the lower band is the 5* 2.3-kb GA mRNA fragments from each mRNA; smaller 3* fragments from the 3.5- and 2.5-kb bands are not resolved on this gel.

AID

AB 2059

/

6m2f$$$$41

03-27-97 23:33:00

FIG. 3. Specificity of oligonucleotide directed RNase H cleavage is oligomer dependent and is significantly improved at higher temperatures. (A) Schematic diagram of the 5.0-kb porcine GA mRNA and the porcine 1.1-kb GA cDNA probe is drawn to scale. Putative translational stop codon (UAA) and polyadenylation (PA) signals are shown for reference. A(N) indicates poly(A) tail of unknown length. (B) Samples containing 15 mg of total RNA isolated from pig kidney tissue were incubated for 15 min with 50 pmol of the indicated ODNs which are complementary to the rat GA cDNA sequence. The RNase H digests were performed using the E. coli enzyme at 377C or Hybridase at 477C as indicated at the bottom of the gel. The digested samples were subjected to formaldehyde/agarose gel electrophoresis and stained with ethidium bromide. (C) Northern blot of the gel in B probed with a 32P-labeled porcine GA cDNA which overlaps the predicted digestion sites as indicated in A. The ODN and temperature used in each digest is indicated between B and C. In lanes r870 thru r1231 the bands below the 18s rRNA represent fragments from the 5* end of 5.0-kb GA mRNA; larger, less-intense bands migrating nearer to the 28s rRNA represent the 3* ends of the GA mRNA; the image is somewhat overexposed to better view these fragments. Control samples were either untreated (unt) or incubated at 37 or 477C in the absence of ODN.

r870 and r990 produced substantial random strand scission in most of the RNA sample when the reactions were performed at 377C, whereas with ODN r1231 the sample remains mostly intact at this temperature. At 477C, however, each reaction shows marked improvement in sample integrity as indicated by the distribu-

aba

284

PORTER AND CURTHOYS

tion of the RNA in the gel and by comparing the intensity of the ribosomal RNA bands to those of the control reactions without ODNs. Figure 3C analyzes digestion directed to a single site on the target GA mRNA. Each digest is expected to produce two GA mRNA fragments, a band at 3.5 kb or greater representing the 3 * fragment and a smaller band of 1.1 kb or greater representing the 5* fragment which will migrate below the 18s rRNA. Digestion of the GA mRNA is apparently complete in each sample, but there is a marked difference in how well individual ODNs performed. At 377C, the r870 ODN does not produce discreet GA mRNA fragments except for a barely recognizable band within the smear in the lower half of the gel which may be the 5* GA mRNA fragment. This band is better resolved in the 477C digest, as well as smaller secondary band not predicted from the known cDNA sequence; near the 28s rRNA position a band barely detected is what appears to be the expected 3 * fragment. In the r990 ODN digests an ambiguous pattern results at 377C. However, at 477C the expected bands at about 3.8 and 1.25 kb are easily distingquished. The r1231 ODN digest yields the expected bands of about 3.5 and 1.5 kb at 477C; at 377C minor bands appear midway between the two expected bands which are not seen at 477C. In general, the results shown in Figs. 3B and 3C demonstrate that different degrees of specificity of RNA cleavage can be obtained with different ODNs, and that both the specificity of digestion within the target RNA and the integrity of the total RNA sample can be greatly improved when the RNase H reaction is performed at higher temperatures. In previous reports using E. coli RNase H, the appearance of cleavage products not predicted from previously known sequence were attributed to partially complementary segments within the target RNA (5, 6, 18), although the nature of the by-products were not analyzed in detail. Minimum duplex substrate requirements for a given RNase H reaction are dependent on reaction conditions, but have been reported to be as low as 4 bp for the E. coli RNase H at 327C (17) and 6 bp at 377C (18). In Fig. 3, bands not predicted by cDNA sequence and not detected at the higher reaction temperature are most likely due to side reactions. However, if such products persist in higher stringency reactions the possibility of natural variants of the target RNA should be considered, especially when analyzing total cellular RNAs (e.g., 4). It is reasonable to expect only highly conserved sequences to direct specific RNase H cleavage. RNase H digests were suggested to be very sensitive to mismatches by Lamperti et al. (6). In their study, incomplete digestion of target mRNA and the generation of other by-products of RNase H hydrolysis were attributed to a 1 bp mismatch between rat and mouse vaso-

AID

AB 2059

/

6m2f$$$$41

03-27-97 23:33:00

active intestinal polypeptide mRNA sequences. While using ODNs derived from rat GA cDNA sequence to map potential binding sites on the 5.0-kb GA mRNA from pig kidney tissue, it was noticed that the use of some ODNs gave poorer results than others (Fig. 3). Subsequent cloning of the pig glutaminase cDNA covering these oligonucleotide binding sites (not shown) confirms the sequence similarity between the rat and pig GA mRNAs at these positions, as well as revealing several base changes within the RNA sequence targeted for ODN binding and RNase H digestion. The number of internal mismatches in each of the ODNs used in Fig. 3 are r870, three base changes; r990, two base changes; and r1231, no changes between the pig and rat sequences. Examination of the reactions employing these ODNs and the E. coli RNase H at 377C indicates that the ODNs with an increased number of mismatches produced the greatest amount of nonspecific ODN/RNA annealing and digestion as seen by ethidium bromide staining of the samples (Fig. 3B) and also in the generation of secondary or side reactions within the GA mRNA (Fig. 3C). In other experiments, ODNs derived from the pig sequence which should complement the pig GA mRNA exactly have produced poor results similar to r870 (not shown). Thus, the correlation between the extent of mismatched base pairing and promiscuous RNase H hydrolysis observed in Fig. 3 and by Lamperti et al. (6) may be fortuitous. The effects of number and distribution of mismatches tolerated in RNase H reactions as functions of temperature and solvent conditions were not systematically investigated. Oligodeoxyribonucleotides which are A/T or G/C rich, or contain a sequence motif of frequent occurrence, may appear to react in a ubiquitous manner and allow for extensive hydrolysis of the RNA sample. Sequence-dependent inappropriate activity of ODNs in an in vitro system was investigated using the E. coli RNase H at 377C and a single buffer (18). As observed in our results, it was noted in this report that the propensity for secondary or side reactions varied substantially between sequences. It should be noted that differences in the quality of the results obtained by different ODNs could also be attributed to the quality of the ODN preparations themselves. For instance, less specific annealing may be expected if a substantial amount of shorter DNA strands contaminate the ODN preparation, such as the products of incomplete synthesis or the hydrolysis of ODN strands during storage and use. Whatever the cause(s) for promiscuous binding of a particular ODN, these effects are greatly reduced using the thermostable RNase H at higher temperatures. The RNase H digestion can be extended to multiple target sites by using the thermostable Hybridase to suppress background degradation which is likely to occur at higher ODN concentrations. The analysis of RNase H products using two different ODNs in the

aba

THERMOSTABLE RNase H MAPPING REACTIONS

FIG. 4. RNase H digestion using two ODNs. (A) Schematic diagram of the 4.6-kb rat GA mRNA and the rat GA cDNA probe is drawn to scale. Putative translational stop codon (UAA) and polyadenylation (PA) signals are shown for reference. A(N) indicates poly(A) tail of unknown length. (B) ODNs r573 and r1952 derived from the rat GA cDNA were hybridized to 5 mg of rat brain total RNA either individually or in combination (50 pmol of each ODN or 100 pmol combined ODNs). These samples were treated with 2 units Hybridase at 457C for 15 min and characterized by Northern analysis using a 32P-labeled cDNA probe which contains the sequence between positions r573 and r1952, as shown in A. The control sample (uncut) was subjected to the same reaction conditions but in the absence of oligonucleotide and RNase H.

same reaction is illustrated in Fig. 4. Oligodeoxyribonucleotides based on rat brain GA cDNA sequence (11) were used to direct cleavage of the 4.6-kb GA mRNA in total rat brain RNA using Hybridase. Quantitative digestion is indicated by the absence of any detectable intact GA mRNA in RNase H treated samples and the appearance of the smaller mRNA fragments predicted from the GA cDNA sequence (Fig. 4A). Additional bands or products from alternative sites which are more likely using higher ODN concentrations are not detected. Thus, the stringency of the reaction conditions for this DNA/mRNA combination allowed for specific hybridization and RNase H hydrolysis of the GA mRNA being analyzed. Minor higher molecular weight bands also are cut in these samples and are thus related or possible precursor GA mRNAs. It should be noted that in Fig. 4B the combined total ODN concen-

AID

AB 2059

/

6m2f$$$$41

03-27-97 23:33:00

285

tration was doubled to 100 pmol without noticeable effect on overall sample integrity relative to the single ODN digests. Higher reaction temperatures favor successful use of higher ODN concentrations and allow multiple sites to be digested in the same reaction. However, the success of this strategy may be dependent on the specificity of the particular oligomers. In a similar experiment presented in (22), side products were observed using the E. coli RNase H at 377C. Another advantage to using multiple ODNs is that if reaction conditions are suspected as the cause of a failure to cut a target RNA, it should be possible to add another ODN to the reaction which binds to a known RNA within the sample (i.e., actin mRNA) which can be probed for separately to show that the RNase H reaction proceeded as expected. Alternatively, site-specific cleavage of a ribosomal RNA could be visualized after electrophoresis by ethidium bromide staining to demonstrate the fidelity of the reaction before proceeding to Northern analysis. The protocol for RNase H digestion described in this study was applicable to both the E. coli RNase H and the commercially available thermostable RNase H.3 The results obtained with both enzymes were compared using identical substrates and buffers. For more accurate results the Hybridase is preferable, although it is currently more expensive to use than the E. coli RNase H. As shown in Figs. 1, 3B, and 3C, the E. coli RNase H may be substituted satisfactorily in some cases. The quality of the results seem to be largely a function of the given ODN/RNA combination. The ability of a given ODN and target RNA to interact after denaturing treatments and subsequent annealing conditions will depend on the nature and stability of secondary and tertiary interactions within and between molecules under the solvent conditions used (19). We expect that the procedures described will provide a starting point for further optimization tailored to specific experiments. REFERENCES 1. Hostomsky, Z., Hostomska, Z., and Matthews, D. A. (1993) in Nucleases, pp. 341–376, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 2. Carrazana, E. J., Pasieka, K. B., and Majzoub, J. A. (1988) Mol. Cell. Biol. 8, 2267–2274. 3. Kleene, K. C., Distel, R. J., and Hecht, N. D. (1984) Dev. Biol. 105, 71–79. 4. Brouillet, A., Darbouy, M., Okamoto, T., Chobert, M., Lahuna, O., Garlatti, M., Goodspeed, D., and Laperche, Y. (1994) J. Biol. Chem. 269, 14878–14884. 5. Berger, S. L. (1987) Anal. Biochem. 161, 272–279. 6. Lamperti, E. D., Rosen, K. M., and Villa-Komaroff, L. (1991) Mol. Brain Res. 9, 217–231. 3

It may also be possible to substitute the RNase H from Thermus thermophilus HB8 (23) in the protocol presented above.

aba

286

PORTER AND CURTHOYS

7. Epicentre Technologies. (1995) Product Specifications for Hybridase, Epicentre Technologies, Madison, WI. 8. Goodwin, E. C., and Rottman, F. M. (1992) Nucleic Acids Res. 20, 916. 9. Baker, C., Holland, D., Edge, M., and Colman, A. (1990) Nucleic Acids Res. 18, 3537–3543. 10. Lorenz, S., Hartmann, R. K., Piel, N., Ulbrich, N., and Erdmann, V. A. (1987) Eur. J. Biochem. 163, 239–246. 11. Shapiro, R. A., Farrell, L., Srinivasan, M., and Curthoys, N.P. (1991) J. Biol. Chem. 266, 18792–18796. 12. Porter, D., Hansen, W. R., Taylor, L., and Curthoys, N. P. (1995) Am. J. Physiol. 269, F363–F373. 13. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156– 159. 14. Hayase, Y., Hideo, I., and Ohtsuka, E. (1990) Biochemistry 29, 8793–8797.

AID

AB 2059

/

6m2f$$$$41

03-27-97 23:33:00

15. Walker, J. F. (1964) Formaldehyde. Reinhold, New York. 16. Berkower, I., Leis, J., and Hurwitz, J. (1973) J. Biol. Chem. 248, 5914–5921. 17. Donnis-Keller, H. (1979) Nucleic Acids Res. 7, 179–192. 18. Giles, R. V., and Tidd, D. M. (1992) Nucleic Acids Res. 20, 763– 770. 19. Uhlenbeck, O. C. (1995) RNA 1, 4–6. 20. Kimmelman, D., and Kirschner, M. W. (1989) Cell 59, 687–696. 21. Pan, T., Long, D. M., and Uhlenbeck, O. C. (1993) in The RNA World (Gesteland, R. F., and Atkins, J. F., Eds.), pp. 271–302. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 22. Murtagh, J. J., Jr., Moss, J., and Vaughan, M. (1994) Nucleic Acids Res. 22, 842–849. 23. Itaya, M., and Kondo, K. (1991) Nucleic Acids Res. 19, 4443– 4449.

aba