Using DNA suspension arrays to identify library-independent markers for bacterial source tracking

ARTICLE IN PRESS WAT E R R E S E A R C H

41 (2007) 3740– 3746

Available at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/watres

Using DNA suspension arrays to identify libraryindependent markers for bacterial source tracking Douglas R. Call, Dennis M. Satterwhite, Marilyn Soule Department of Veterinary Microbiology and Pathology, Washington State University, 402 Bustad Hall, Pullman, WA 99164 7040, USA

ar t ic l e i n f o

abs tra ct

Article history:

We developed a suspension array to enhance the ability to use library-independent genetic

Received 15 January 2007

markers for bacterial source tracking. Six markers from Enterococcus spp. were selected to

Received in revised form

distinguish between cattle, humans, and cervids. Multiplex PCR was used to amplify fecal

2 April 2007

markers and resulting products were biotinylated and fragmented by nick translation

Accepted 10 April 2007

followed by hybridization to polystyrene beads. Six populations of beads were included

Available online 23 May 2007

simultaneously in each assay where beads were labeled with an oligonucleotide probe

Keywords:

complementary to one of the six library-independent markers. Hybridized products were

BST

detected on the beads using a 2-laser flow cytometer in a 96-well format. Testing with

MST

previously characterized strains showed that the assay could achieve 100% diagnostic

Water quality

sensitivity and 495% diagnostic specificity. Results from water samples were congruent for

Bead array

conventional PCR. Serial dilutions of template DNA demonstrated that the bench top

TMDL

analytic sensitivity of the entire assay was equivalent to o1600 cells. Suspension arrays permit greater certainty of product identification and this format can be expanded to include many additional markers. & 2007 Elsevier Ltd. All rights reserved.

1.

Introduction

Efforts to eliminate fecal pollution in water often require identification of sources of pollution prior to implementation of mitigation efforts. Such identification is prudent because limited resources can then be used to control the largest contributors of waste. One strategy to accomplish this is to identify host-specific strains or species of bacteria, which is referred to as bacterial source tracking (BST). Besides providing a means to identify sources of waste, BST can be viewed as an objective methodology, which is important when water managers are trying to convince recalcitrant stakeholders to participate in clean-up efforts. BST methods can be grouped into two categories; libraryindependent and library-dependent methods (Scott et al., 2002; Simpson et al., 2002; Stewart et al., 2007). Librarydependent methods correlate a series of phenotypic or Corresponding author. Tel.: +1 509 335 6313; fax: +1 509 335 8529.

E-mail address: [email protected] (D.R. Call). 0043-1354/$ - see front matter & 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.watres.2007.04.007

genotypic traits to bacteria from specific hosts and then derive a classification function to predict the source of isolates retrieved from water (e.g., Leung et al., 2004; Scott et al., 2003); library-dependent methods are problematic in applied settings (Stoeckel et al., 2004). Herein we focus on library-independent markers that, in theory, should be applicable to identifying sources of fecal pollution across broad spatial and temporal scales. To date most libraryindependent methods rely on amplification of genetic markers that are most closely associated with fecal pollution from specific hosts (e.g., Scott et al., 2005; Shanks et al., 2006a, b; Soule et al., 2006). Testing for genetic markers involves PCR, but if the analytic process includes a large number of samples, each of which must be tested for a battery of genetic markers, then the process becomes laborious and expensive. From a practical standpoint, genetic markers can be used in a binary, semi-quantitative, or quantitative format. Binary

ARTICLE IN PRESS WAT E R R E S E A R C H

4 1 (200 7) 374 0 – 374 6

detection (presence/absence) requires the fewest assumptions for interpretation and usually relies on the detection of an amplification product based on the predicted length as observed with agarose electrophoresis. Semi-quantitative applications can be implemented by collating binary data across multiple site visits. In each of these cases a large number of PCR reactions may be needed and errors in product identification can add to uncertainty to assay interpretation. The goal of this project was to develop a BST assay that permits improved product detection (hybridization) in conjunction with multiplex PCR and a 96-well compatible format. Our assay uses BST specific probes that are coupled to colored beads where each bead color corresponds to a unique probe sequence. After multiplex PCR and product labeling, PCR products are mixed with labeled beads and the resulting hybridization data is collected using a relatively simple 2-laser flow cytometry system (Dunbar, 2005). We targeted a group of enterococci-related BST markers for this assay, but the system is amenable to expansion to the simultaneous detection of 100 distinct markers.

3741

2.

Materials and methods

Genomic DNA used for analytic sensitivity testing was extracted using a modified protocol from a commercial kit (DNeasy tissue extraction kit, QIAGEN, Valencia, CA). Briefly, pelleted cells from overnight culture in BHI media were dispersed in 180 ml of lysis buffer (20 mM Tris-Cl, pH 8.0, 2 mM EDTA, 1.2% Triton X-100) and processed using the Qiagen lysis protocol for Gram-positive bacteria by incubation with 20 mg ml1 of egg white lysozyme (Sigma-Aldrich, St. Louis, MO) for 30 min at 37 1C. Digestion was carried out by adding 20 ml of proteinase K enzyme solution (600 mAU ml1), then incubating at 70 1C for 30 min. RNA was degraded at room temperature for 5 min prior to column loading by adding 10 ml of RNase A (10 mg ml1). The remainder of the isolation procedure followed manufacturer instructions. Genomic DNA obtained from cells grown in mEi medium appeared to be free of media-derived PCR inhibitors by this method. DNA was stored in Qiagen AE elution buffer, sterile DNase free PCR water, or TE buffer. DNA concentrations were determined in 2 mL aliquots using a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE). Genomic DNA extractions with high 260/280 nm absorbance ratios (1.8–2.0) were diluted to 25 ng ml1 for PCR analysis. DNA was freshly prepared and stored at 4 1C for studies of analytic sensitivity.

2.1.

Bacterial isolates

2.3.

Nineteen strains of enterococci were selected from a previous study and were used here for assay development and validation (Soule et al., 2006). An additional strain bearing a genetic marker found regularly in human derived waste streams, E. faecium strain C68 (HEfC68), was generously provided by Dr. Louis B. Rice of the Louis Stokes Cleveland Veterans Affairs Medical Center in Cleveland, OH (Rice, 2001; Scott et al., 2005). These strains were archived at 80 1C and grown in brain–heart infusion (BHI) broth (Difco, B-D & Co., Sparks, MD) as needed.

2.2.

Water samples and genomic DNA extraction

Water samples were collected from the Colville River (Stevens Co., WA, USA) during the summer of 2005 and processed using a modification of EPA standard method 1600 (USEPA, 2002). Water samples (100–1000 ml) were filtered through presterilized 0.45 mm nitrocellulose filters to entrap bacteria. Filters were then placed on mEi agar plates (Difco) and grown 48 h at 41 1C. Colonies were washed from the filter surface with 2 ml of tryptic soy broth after which cells were pelleted by centrifugation, frozen at 80 1C, and genomic DNA was extracted using a commercial kit (UtraClean Soil DNA Kit, MO BIO Laboratories, Carlsbad, CA). DNA extracts were stored at 20 1C. Genomic DNA from individual strains of enterococci was prepared one of two ways. Rapid lysis was used to prepare fresh material for validation testing where cells were retrieved from 80 1C glycerol stocks and cultured overnight (37 1C) in BHI broth (2 ml) and pelleted by centrifugation. Pellets were washed once, re-suspended in sterile water (500 ml), and subjected to six cycles of freeze-thaw (80 1C to 50 1C) before final centrifugation. Supernatant was used for PCR.

Preparation of PCR products

Primers were designed as described by Soule et al. (2006) using sequence data and Vector NTI software (Invitrogen, Carlsbad, CA). Genomic DNA extractions (o75 ng) and lysed cell supernatant (3 mL) were used for PCR template. Reaction volumes were 25 ml with 400 nM of each primer for singleplex PCR. Routine multiplex PCRs contained 12 individual forward and reverse primers each at 200 nM concentration. PCR was performed in 25 ml reaction volumes with 1 unit of Taq polymerase (Fisher Scientific) in buffer containing 50 mM KCl, 10 mM Tris-HCl (pH 9), with 2.5 mM MgCl2. For analysis of analytical sensitivity individual primer concentrations were reduced to 100 nM to limit primer dimer formation. PCR included initial denaturation at 95 1C for 2 min, followed by 35 cycles using a 30 s denaturation at 95 1C, annealing at 52 1C for 45 s, and extension at 72 1C for 90 s. A final 10 min extension ended the synthesis and the reaction was held at 4 1C or frozen until further processing.

2.4.

Suspension array preparation

Oligonucleotide probes approximately 25–30 base pairs in length were designed using Vector NTI 9 software (Table 1) from previously published BST genetic marker sequences (Soule et al., 2006), and synthesized with a 6 carbon amine linker at the 5 prime terminus (Invitrogen; Table 2). Luminex color coded 5.6 mm carboxylated polystyrene microspheres (bead numbers 29–34) were obtained from Bio-Rad Laboratories (Hercules, CA) and linked to the oligonucleotides with a 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) as recommended by the vendor. Briefly, bead stocks were mixed vigorously for 30 s and sonicated for 30 s to resuspend the beads. Aliquots of each bead stock (2.5  106 beads; 200 ml) were transferred into 1.5 ml microcentrifuge tubes under reduced light conditions and centrifuged for

ARTICLE IN PRESS 3742

WAT E R R E S E A R C H

41 (2007) 3740– 3746

Table 1 – BST markers, primer sets, probes, and control strains used in this study Marker namea

Primer nameb

Primer sequence

Positive control strainc

Predicted product size (bp)

Cow15

15F 15R Probe15 19F

AGATACCTTAACACATTACACCCAG TGTGAAACTATCAATCAAACATGAT AAATCTATTTCACATGGACGAATGG AATCGTATTCATTTGCCCAAG

C190

357

Cow19

19R Probe19 48F

GGGGATTTTGTTACGAAAGAAG ATCCCCATTCTTCATTATGTTGATC AGTTCTTATAGAGTAAATCACGTTCATAG

C190

375

Cervid48

48R Probe48 77F

AAAACCTAGTATAATCAATTTTCCATC TTGCTAGGCACTAGAACTCAATTAGG TTTGCCCATCGAGTTACTACTG

E514

319

Human77

77IR Probe77 107F

ATATTGCTTGCTTTGGATTGAC AATTGATCTGACTCAGGATGAGCAC TCTTTTCCTCACTACGCTAAGTG

H421

362

Human107

107R Probe107 Esp#3F

CCTCTCCACTGTAAGGTCAAATC TTTAAGTAACAGTAGAGCCATTAGTGGTAG TATGAAAGCAACAGCACAAGTTG

H437

401

HumanEsp

EspR ProbeEsp

ACGTCGAAAGTTCGATTTCC ACCAGAAGAAGGTTCAACCGTTATT

HEfC68

681

a

Genbank accession numbers for the original marker sequences are DQ071632, DQ071647, DQ071634, DQ071643, DQ071645, and AF444000. All primer sequences were adopted from Soule et al. (2006) except for 77F and Esp#3F primers (Scott et al., 2005), which were redesigned for this study. c Prefix C ¼ cow, E ¼ elk or deer (cervid), and H ¼ human. An additional strain H453 was used as a PCR negative control. Positive control strains represent strains of Enterococcus hirae, E. casseliflavus, E. faecalis, and E. faecium (Soule et al., 2006). b

Table 2 – Example output from a single suspension array assay Strain or samplea

C190 E514 H421 H437 HEfC68 H453 Mix Bkg NTC Threshold

Probes Cow15

Cow19

Cervid48

Human77

Human107

HumanEsp

853b 23 28 21 19 21 479b 24 22 44

795b 27 36 25 30 27 632b 31 31 62

55 425b 64 60 56 63 255b 62 39 78

22 28 575b 567b 24 22 485b 26 26 52

18 27 35 605b 35 34 540b 31 25 50

24 26 24 23 562b 25 207b 26 23 66

Numbers represent the fluorescent intensity units collected after each strain was tested with multiplex PCR followed by product labeling and hybridization to probe-specific, colored beads. a Strains are identified in Table 1. Strain H453 is positive for a human BST marker that is not used in this panel and thus serves as an Enterococcus negative control. The mix sample includes equal concentrations of gDNA from each control strain. Bkg is the signal collected from probe-labeled-beads without a reporter. NTC is the no-template-control PCR reaction that was carried through all steps in the assay. The detection threshold is an empirically selected cutoff for positive and negative detection (42 X NTC; average NTC is calculated from 2 replicate samples). b Indicate ‘‘positive’’ detection events relative to the threshold values.

4 min at 18,000g, after which the supernatant was carefully removed by pipette. The beads were re-suspended in 50 mL of 0.1 M MES (2-(N-morpholino)ethanesulfonic acid) buffer (pH 4.5) by mixing and sonication as before. One nanomole of the appropriate oligonucleotide probe (2 ml, 500 mM in water) was

added and mixed vigorously for 30 s. Two fresh 1.25 mL aliquots of a 10 mg ml1 EDC solution were added at 30 min intervals with moderate agitation in limited lighting. After linkage, the beads were centrifuged to remove the supernatant and washed with 0.5 ml of 0.02% Tween-20. The

ARTICLE IN PRESS WAT E R R E S E A R C H

4 1 (200 7) 374 0 – 374 6

mixtures were centrifuged again and the beads re-suspended in 0.5 ml 0.1% SDS. The beads were then centrifuged and resuspended in 50 mL of TE buffer (pH 8) and stored at 4 1C. Oligonucleotide conjugated beads can be stored for up to 6 months. The oligonucleotide-labeled beads were enumerated using a hemacytometer. Yields of 50–90% total beads were routinely obtained, with losses attributed to supernatant removal. The extent of oligonucleotide labeling was not determined.

2.5.

Biotinylation of PCR products

PCR products were biotinylated using the BioNicks DNA Labeling System (Invitrogen) at half scale. PCR products (20–25 ml) were transferred to 0.5 ml polypropylene PCR tubes and ethanol precipitated (Sambrook et al., 1989). DNA pellets were resuspended in 20 ml of PCR water at 4 1C and augmented with 2.5 ml of cold 10  nick translation buffer and enzyme solution and 2.5 ml of 10  deoxyribonucleotide solution containing 200 mM each dCTP, dGTP and dTTP, 0.1 mM dATP and 0.1 mM biotin-14-dATP. The mixture was incubated for 1 h at 16 1C using a refrigerated thermal block or PCR thermocycler. The reaction was terminated with or without the addition of stop solution (2.5 mL of 0.5 M EDTA) by ethanol precipitation, and re-suspended in 60 mL of TE buffer in preparation for hybridization.

2.6.

Hybridization and analysis

Biotinylated PCR products in 60 ml of TE buffer were individually mixed in 0.5 ml microcentrifuge tubes with 100 ml of 1.5  TMAC buffer [(3 M tetramethylammonium chloride; Sigma), 0.1% SDS, 50 mM Tris-HCl, and 4 mM EDTA (pH 8.0)] containing 5000 oligonucleotide coupled beads per type (beads 29–34) for a total of 30,000 beads per sample. This combination was mixed by re-pipetting 4  in reduced light, centrifuged briefly, then incubated at 95 1C for 5 min followed by incubation at 52 1C for 15 min with occasional agitation. The mixture was centrifuged at 3000g at or above room temperature for 5 min to allow removal of the supernatant. Beads were re-suspended in 200 ml of 1  TMAC buffer containing 5 ng ml1 streptavidin-R-phycoerythrin (Molecular Probes, Eugene, OR) by repeated pipetting and incubated at 52 1C with occasional gentle agitation for 15 min to allow reporter molecule binding. Aliquots of each sample (60 ml) were placed in three adjacent wells (replicates) of a 96 well microreader plate. The plate was maintained at 52 1C while measurements were conducted in the BioPlex 100 flow-cytometer (BioRad). Sample fluorescence intensity data collected by the reader operating software was saved for later analysis using spreadsheet software.

3.

Results

3.1.

Assay description

Optimum conditions for PCR, as defined by total product yield when viewed by gel electrophoresis, varied with primer sets but for the six primer sets used in this study (Table 1) we found that a single set of reaction conditions produced

3743

satisfactory results for all markers. Hybridization results were easy to interpret (Table 2) and we empirically determined that a threshold of detection of approximately 2 times the fluorescent signal from the no-template-control (NTC) was a robust threshold for identifying positive and negative samples. This determination was made by repeated testing of select positive control strains (Table 1) and additional test strains that have been characterized previously (see Section 3.2). In most cases we found that the background fluorescence (beads only) was very similar to the signal collected from NTC wells. The Cervid48 probe was an exception to this observation whereby the background readings were consistently 1.5fold higher than the NTC control signal and the signal for the Cervid48 NTC was typically 1–2-fold higher than the NTC signal for other probes (Table 2). We were unable to determine the reason for this discrepancy and it may be reagent dependent because our original lot of bead 31 conjugated with the Cervid48 probe did not produce this background. Higher background will contribute to limited analytical sensitivity for this type of assay (see Section 3.3).

3.2.

Diagnostic sensitivity and specificity

We compared the results from the bead assay to the expected results for previously characterized strains (Soule et al., 2006). Twenty strains were assessed for a total of 120 test results (Table 3). Assuming that the previously published genotyping data was correct, then the diagnostic sensitivity of the assay (defined here as the ability to detect true positives) was 100%. The diagnostic specificity (defined here as the ability to detect true negatives) was 95.6%. In two instances there were inconsistent results where strains (C5 and H447) were positive for both Cow15 and Cow19 markers in the current assay resulting in an overall accuracy rate of 90% (18/20 strains correctly characterized for six probes) relative to published results (Soule et al., 2006). Testing by single-primer set PCR for markers Cow15 and Cow19 verified that products of a size consistent with these markers was produced for both strains C5 and H447; this indicates that the discrepancies between our test results and published values are probably attributable to the archiving or handling process and the thus the incorrect test results shown here are probably attributable to incorrect strain identification rather than an assay error.

3.3.

Analytic sensitivity

The analytic sensitivity of the assay was assessed by preparing three independent dilution series of pure genomic DNA template and processing each dilution by multiplex PCR, labeling, and bead hybridization. This was repeated for four Enterococcus strains to generate average fluorescence for each of the six BST markers. Five of the markers were consistently detected at a gDNA concentration equivalent to 1600 cells (Table 4). One marker (Cervid48) was only suitable for detecting gDNA at a concentration equivalent to 1.5  105 cells.

ARTICLE IN PRESS 3744

WAT E R R E S E A R C H

41 (2007) 3740– 3746

Table 3 – Diagnostic sensitivity and specificity of the BST assay Straina

Cow15

Cow19

Cervid48

Human77

Human107

HumanEsp

C5 C46 C144 C171 C184 C185 C186 C189 C190 E513 E514 E516 H401 H407 H421 H423 H437 H447 H453 HEfC68

1b 1 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 1 0 0

1 1 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 1 0 0

0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0

0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 1 0 0 0

0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1

Isolates were retrieved from a frozen archive, streaked for isolation, and gDNA was prepared and processed using the multiplex PCR assay and the suspension array. Presence or absence of a marker was determined by fluorescent intensity units relative to two times the no-templatecontrol. Diagnostic sensitivity of the assay was 100% and diagnostic specificity of the assay was 95.6% relative to previously published information (Soule et al., 2006). a All strains were previously characterized by Soule et al. (2006) except for HEfC68, which was generously provided by Dr. Louis B. Rice, Louis Stokes Cleveland Veterans Affairs Medical Center in Cleveland, OH. b Strain C5 originated from a cow, but was previously classified as negative for markers Cow15 and Cow19. H447 originated from a human and was originally negative for Cow15 and Cow19. PCR amplification with marker specific primers yielded products consistent with the suspension array results.

Table 4 – Analytic sensitivity gDNA (g)

1.5E-08 3.0E-09 6.0E-10 1.3E-10 2.5E-11 5.0E-12 1.0E-12 2.0E-13 Threshold

C190

C514

H437

HEfC68

Cow15

Cow19

Cervid48

Human77

Human107

Esp

415b 388b 243b 175b 77b 44b 26 27 43.6

411b 501b 434b 341b 233b 128b 44 47 49.2

266b 204b 157b 75 50 46 46 49 89.2

231b 209b 234b 131b 119b 72b 34 26 50.4

249b 194b 204b 139b 105 50b 41 28 48

311b 289b 200b 88b 77b 61b 34 28 60

Est. cellsa

4.7E+06 9.4E+05 1.9E+05 3.9E+04 7.8E+03 1.6E+03 3.1E+02 6.3E+01

Fluorescence intensity units were averaged for three independent dilution series of template gDNA that were amplified by PCR, labeled by nick translation, and hybridized to the suspension array. All reactions included multiplex primer mixes (0.1 mM concentration of each primer) although gDNA from a single strain was used for each dilution series. The positive detection threshold was 42  NTC. a Estimated cell count is based on the assumption that the average genome size for enterococci strains is 3  106 bp. b Positive detections.

3.4.

Application to water samples

We applied the bead assay to a subset of archived DNA extractions that originated from water samples collected from the Colville River, WA, during the summer of 2005. Results were assessed by comparing the suspension

array results with results from singleplex PCR tests that were conducted immediately after sample collection (Call and Plescia, unpub. data). Under these conditions, we expected to have difficulty detecting all markers with the current assay owing to the age of the extractions, but we also predicted that we would not detect any

ARTICLE IN PRESS WAT E R R E S E A R C H

3745

4 1 (200 7) 374 0 – 374 6

Table 5 – Summary of results when the BST assay was applied to water samples collected from the Colville River, WA (summer 2005)

Total samples Positive Negative False positive False negative Percent error

Cow15

Cow19

Cervid48

Human77

Human107

HumanEsp

30 10 20 0 2 6.7

30 12 18 0 9 30.0

30 3 27 0 18 60.0

30 0 30 0 4 13.3

30 7 23 0 4 13.3

30 0 30 0 8 26.7

Water samples were filtered and enriched in media prior to DNA extraction, multiplex PCR, labeling, and hybridization to beads. The data represents three separate site visits (1 week apart) at ten sites. Numbers shown below represent the summary counts for outcomes listed in the first column for each probe included in the assay. False positives and false negatives are defined relative to results from single-plex PCR assays that were conducted when the samples were first collected (Call and Plescia, unpub. data).

false positives provided that the suspension array was working correctly. A summary of the comparison for 30 samples (three independent visits a week apart at 10 sample locations) confirmed that we were unable to detect all markers previously attributable to these samples (Table 5). Errors were exclusively associated with false negatives (no false positives were detected) with error rates ranging from 6.7% to 60%. The latter was attributable to marker Cervid48 for which we have already demonstrated potential for reduced analytic sensitivity (Table 4).

4.

Discussion

The full assay for detecting the BST markers described herein involves sample collection, DNA extraction, multiplex PCR, product labeling and fragmentation, and hybridization to beads followed by detection with a flow-cytometer. In practice, once reagents are prepared then water samples can be processed in a relatively efficient manner using 96-well format supplies and liquid-handling robotics. In our case, all samples are processed in triplicate wells providing space for 30 samples and two controls for every 96-well plate. Each of the 30 samples is interrogated for each of six markers, although in practice the assay could include many additional markers. The cost of the assay might be improved by using biotinylated primers and avoiding the nick translation step during sample processing, although secondary and tertiary product interactions can prevent hybridization under this scenario and the probability of these interactions is likely to increase with increasing assay complexity (Lane et al., 2004). Ducey et al. (2007) may have circumvented this difficulty using a two-stage PCR process whereupon initial multiplex PCR was followed by single-primer extension PCR that produced single-stranded products for hybridization; although the cost trade-off between these two approaches may be negligible. A full cost analysis for these assays clearly depends on the lab that is conducting the work and the number of samples being processed. If a binary interpretation is desired for BST markers and multiple markers are needed (a prudent strategy), then the multiplex aspect of this assay format is

highly appealing. One significant advantage of the suspension array is that complex PCR product mixtures can be assayed quickly and compared with conventional gel electrophoresis the confidence is much higher for product identification. Multiplex PCR comes with trade-offs, however, whereby some templates may be differentially amplified owing to different primer efficiencies and starting template concentrations (Amann et al., 1995; Polz and Cavanaugh, 1998) as well as differential hybridization efficiencies (Table 4). Nevertheless, we anticipate that the most dominant markers, which presumably represent the most common fecal source, will be easily detected amongst a background of incidental markers. Our assay process relied upon filtration followed by enrichment before gDNA extraction. This choice was made a priori to maximize the probability of detecting fecal markers from water samples. While the diagnostic sensitivity and specificity of the assay are ideal, results from the analytic sensitivity tests support a decision to use pre-enrichment during sample preparation. This is because an estimated 1600 cells bearing a given marker are needed for detection. Depending on the proportion of marker-bearing strains from host animals (an unknown quantity at present), then for marginally contaminated waters either large volumes of water must be filtered or an enrichment step will be needed. Depending on the filtration system any estimates of the total volume of water filtered should take into account the efficiency of recovery from the filtration system being used (Loge et al., 2002). Analytic sensitivity might be improved by an order of magnitude using singleplex PCR and potentially quantitative PCR, although these assays still face the same challenges from PCR inhibition (Stults et al., 2001) and practical limits on the number of markers that can be assayed in a cost-effective manner. Enrichment, however, adds an additional complication if the marker-bearing strains are not recovered proportionately, although this is less problematic for a binary interpretation as long as a sufficient number of marker-bearing strains is recovered. In addition, enrichment may only be practical for aerobic bacteria such as Enterococcus or Escherichia coli. Many new markers are being described for obligate anaerobic bacteria (e.g., Bacteroides; Shanks et al., 2006b) where culturing would be more expensive and not a viable option for some labs.

ARTICLE IN PRESS 3746

5.

WAT E R R E S E A R C H

41 (2007) 3740– 3746

Conclusion

Our study clearly demonstrates the feasibility of markedly increasing sample processing capabilities using multiplex PCR and multiplex suspension arrays when targeting easily recoverable aerobic bacteria such as enterococci. This system is most appropriate for binary detection (presence/absence) when a large number of samples are being tested. Furthermore, the suspension array portion of the assay is capable of detecting an additional 94 nucleic acid targets beyond what is described herein.

Acknowledgments We gratefully acknowledge efforts by M. Krug, M. Oatley, S. LaFrentz, P. Plescia, and E. Kuhn for their technical contributions to earlier portions of this work. This project was funded in part by USDA NRI contract 2002-35102-12374 and by the Agricultural Animal Health Program at the College of Veterinary Medicine, Washington State University, Pullman, WA. R E F E R E N C E S

Amann, R.I., Ludwig, W., Schleifer, K.H., 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59 (1), 143–169. Ducey, T.F., Page, B., Usgaard, T., Borucki, M.K., Pupedis, K., Ward, T.J., 2007. A single-nucleotide-polymorphism-based multilocus genotyping assay for subtyping lineage I isolates of Listeria monocytogenes. Appl. Environ. Microbiol. 73 (1), 133–147. Dunbar, S.A., 2005. Applications of Luminexs xMAP trade mark technology for rapid, high-throughput multiplexed nucleic acid detection. Clin. Chim. Acta 363 (1–2), 71–82. Lane, S., Evermann, J., Loge, F., Call, D.R., 2004. Secondary structure prevents target hybridization to oligonucleotide microarrays. Biosensors Bioelectron. 20 (4), 728–735. Leung, K.T., Mackereth, R., Tien, Y.C., Topp, E., 2004. A comparison of AFLP and ERIC-PCR analyses for discriminating Escherichia coli from cattle, pig and human sources. FEMS Microbiol. Ecol. 47 (1), 111–119. Loge, F.J., Thompson, D.E., Call, D.R., 2002. PCR detection of specific pathogens in water: a risk-based analysis. Environ. Sci. Technol. 35 (12), 2754–2759. Polz, M.F., Cavanaugh, C.M., 1998. Bias in template-to-product ratios in multitemplate PCR. Appl. Environ. Microbiol. 64 (10), 3724–3730.

Rice, L.B., 2001. Emergence of vancomycin-resistant enterococci. Emerg. Infect. Dis. 7 (2), 183–187. Sambrook, L., Fritch, E.F., Maniatis, F., 1989. In: Ford, N., Nolan, C., Ferguson, M. (Eds.), Molecular Cloning: A Laboratory Manual 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA. Scott, T.M., Rose, J.B., Jenkins, T.M., Farrah, S.R., Lukasik, J., 2002. Microbial source tracking: current methodology and future directions. Appl. Environ. Microbiol. 68 (12), 5796–5803. Scott, T.M., Parveen, S., Portier, K.M., Rose, J.B., Tamplin, M.L., Farrah, S.R., Koo, A., Lukasik, J., 2003. Geographical variation in ribotype profiles of E. coli isolates from humans, swine, poultry, beef, and dairy cattle in Florida. Appl. Environ. Microbiol. 69 (2), 1089–1092. Scott, T.M., Jenkins, T.M., Lukasik, J., Rose, J.B., 2005. Potential use of a host associated molecular marker in Enterococcus faecium as an index of human fecal pollution. Environ. Sci. Technol. 39 (1), 283–287. Shanks, O.C., Nietch, C., Simonich, M., Younger, M., Reynolds, D., Field, K.G., 2006a. Basin-wide analysis of the dynamics of fecal contamination and fecal source identification in Tillamook Bay, Oregon. Appl. Environ. Microbiol. 72 (8), 5537–5546. Shanks, O.C., Santo Domingo, J.W., Lamendella, R., Kelty, C.A., Graham, J.E., 2006b. Competitive metagenomic DNA hybridization identifies host-specific microbial genetic markers in cow fecal samples. Appl. Environ. Microbiol. 72 (6), 4054–4060. Simpson, J.M., Santo Domingo, J.W., Reasoner, D.J., 2002. Microbial source tracking: state of the science. Environ. Sci. Technol. 36 (24), 5279–5288. Soule, M., Kuhn, E., Loge, F., Gay, J., Call, D.R., 2006. Using DNA microarrays to identify library-independent markers for bacterial source tracking. Appl. Environ. Microbiol. 72 (3), 1843–1851. Stewart, J.R., Santo Domingo, J.W., Wade, T.J., 2007. Fecal pollution, public health, and microbial source tracking. In: Santo Domingo, J.W., Sadowsky, M.J. (Eds.), Microbial Source Tracking. ASM Press, Washington, DC, pp. 1–32. Stoeckel, D.M., Mathes, M.V., Hyer, K.E., Hagedorn, C., Kator, H., Lukasik, J., O’Brien, T.L., Fenger, T.W., Samadpour, M., Stickler, K.M., Wiggins, B.A., 2004. Comparison of seven protocols to identify fecal contamination sources using E. coli. Environ. Sci. Technol. 38 (22), 6109–6117. Stults, J.R., Snoeyenbos-West, O., Methe, B., Lovley, M.B., Chandler, D.P., 2001. Application of the 50 fluorogenic exonuclease assay (TaqMan) for quantitative ribosomal DNA and rRNA analysis in sediments. Appl. Environ. Microbiol. 67 (6), 2781–2789. USEPA, 2002. Method 1600: Enterococci in Water by Membrane Filtration using Membrane—Enterococcus Indoxyl-b-D-glucoside Agar (mEI). Publication EPA-821-R-02-022. US Environmental Protection Agency, Washington, DC.