- Email: [email protected]
Using EGFP as a reporter to confirm the function of phytoene desaturase promoter in Duanliella bardawil
Algal Research 20 (2016) 16–21
Contents lists available at ScienceDirect
Algal Research journal homepage: www.elsevier.com/locate/algal
Short communication
Using EGFP as a reporter to confirm the function of phytoene desaturase promoter in Duanliella bardawil Hao-Hong Chen, Shan-Li Chen, Yong-Ming Lao, Ming-Hua Liang, Jian-Guo Jiang ⁎ College of Food and Bioengineering, South China University of Technology, Guangzhou 510640, China
a r t i c l e
i n f o
Article history: Received 9 June 2016 Received in revised form 9 August 2016 Accepted 11 September 2016 Available online xxxx Keywords: Dunaliella bardawil Phytoene desaturase Promoter Carotenogenesis EGFP
a b s t r a c t Phytoene desaturase (PDS) is an upstream key enzyme of carotenoid metabolic pathway in Dunaliella bardawil. This research attempts to clone the Pds gene and its promoter and terminator from D. bardawil and identify the promoter activity. Using LA-PCR based genomic walking approach and semi-nested PCR method, the DbPds gene was cloned and its structure was analyzed. 5′ RACE technique was used to determine its transcriptional start site. The bioinformatics analysis hypothesized that DbPds is one of the isoenzyme genes in D. bardawil. The full length of DbPds gene isolated included 8113 bp coding region (from ATG to TAA), 3010 bp upstream sequence and 1555 bp downstream sequence. By constructing the DbPds promoter-EGFP-DbPds terminator exogenous gene expression cassette to drive EGFP expression in D. bardawil, the activities of promoter and terminator of DbPds upstream and downstream sequence separated in this experiment were confirmed. Online promoter analysis tool PlantPAN was utilized to analyze the potential related osmotic stress-regulated elements in DbPds promoter. The result suggested that DbPds promoter does not contain any related elements about salt regulation. Furthermore, through in vivo detection of the responsive transcriptional level of DbPds genes under different salt concentrations, it was found that salt stress could not apparently affect DbPds expression, indicating that DbPds genes does not participate in the response to salt stress. © 2016 Elsevier B.V. All rights reserved.
1. Introduction In the carotenoid metabolism pathway, PDS is a key enzyme regulating the conversion of phytoene into ξ-carotene in plants. When norflurazon and fluridone bind to PDS active site, PDS will lose its catalytic activity, which leads to a lot of phytoene accumulation [1,2]. Currently, PDS cDNA sequences have been cloned and studied in some plants' flower and fruit, such as Lycopersicon esculentum [3], Citrus reticulata, Gentiana lutea, and Calendula officinalis [4]. Numerous studies have shown that the expression of the pds gene could promote the accumulation of carotenoids in flowers and fruits [5]. It was found that the increase of PDS gene expression will promote the accumulation of carotenoids during fruit ripening in citrus fruits [6]. The pds mRNA of D. bardawil (DbPds, GenBank: Y14807.1) has been cloned by RT-PCR and RACE-PCR methods on the basis of a modified switching mechanism at 5′ end of the RNA transcript (SMART) technology. Full-length cDNA DbPds is 2198 bp, which predicts its reading frame 1752 bp, encoding a polypeptide of 583 amino acids with a protein molecular weight of 64.889 kDa [7]. Recently, GFP has been widely used in molecular biology research. Naoki et al. used maize polyubiquitin promoter to drive gfp gene expression in transgenic rice [8]. ubi21 promoter can drive the gfp gene in maize
⁎ Corresponding author. E-mail address: [email protected] (J.-G. Jiang).
http://dx.doi.org/10.1016/j.algal.2016.09.012 2211-9264/© 2016 Elsevier B.V. All rights reserved.
embryogenic callus, and the transgenic plants and their progeny can stably express GFP [9]. Cucumber mosaic virus 3a movement and GFP fusion protein (3aMPBGFP) could be transformed into Nicotiana tabacum, and 3aMPBGFP did not transported by the major inter plasmodesmata, but into the complex inter-secondary plasmodesmata system [10]. The cDNA of DbPds has been cloned in our previous work [7], in the present research, the promoter and terminator of pds were isolated and cloned for the first time, and then the obtained nucleotide sequences and predicted the corresponding protein structure of DbPds were analyzed using various bioinformatics tools. The potential cis-acting element candidates in the DbPds promoter were identified by PlantPAN tools. Subsequently, promoter and terminator of DbPds were used to express the enhanced green fluorescent protein (EGFP) in D. bardawil in order to verify the activity of DbPds promoter and terminator. Finally, since the molecular basis of PDS regulation in response to salt stress has not yet been studied, we tried to detect the transcript of DbPds in response to salt stress to explore the relationship between the PDS expression and NaCl regulation. 2. Material and methods 2.1. Strains, plasmids and cultivation conditions Dunaliella bardawil strain FACHB-847, is the same strain of D. salina [11], obtained from the Institute of Hydrobiology, Chinese Academy of
H.-H. Chen et al. / Algal Research 20 (2016) 16–21
Y.C. Cao (Schoolof Biological Science and Engineering, South China University of Technology).
Table 1 Primers used in this study. Operation
Primers
Forward and reverse primers (5′ → 3′)
Gene isolation
g1PdSP1 g1PdSP2 g1PdSP3 g2PdSP1 g2PdSP2 g2PdSP3 nPd-F nPd-R1 nPd-R2 pPdSP1 pPdSP2 pPdSP3 tPdSP1 tPdSP2 tPdSP3 qGapdh-F qGapdh-R qDbPds-F qDbPds-R
AACACCTCTCAGCCAGTTTAGGA AGAACCAAGGGAAGGTGACTGC AAGGTGACTGCCTCGGTCAACACT AGACAAGAGCAAGCCCAATCCT GCCTCAGGGGCTTCAAAGGTCACA CTCAGGGGCTTCAAAGGTCACAGGA AGGGCACATGCTCAGACACT CGGACTAAGTTGCTCCAATCTC GGTCTCAGAGTCTGGGATGGT CCTCTAGTTCAATCCAAGGTGTTCAT ACAAAGAGCCACAGCCCACTAA ATTGGTTCAGAAGAGCCGTGAGTCC GCTTGCGAGCAGGTGGTAGAT TGTTGACCGAGGCAGTCACCTT TAAACTGGCTGAGAGGTGTTTTCGT TGCCACCCAGAAGCCTGTAGA ACCCGTGGAGGAAGGAATG ACATCCCTGCCCCCTGGAATGG ATACTTCTGGCCGAAGATGATAGC
Flanking sequence isolation
qRT-PCR
17
Science, were grown in defined medium [12], containing 2 M NaCl and were cultivated for 10 day at 26 °C and 8000 lx under a 16/8 h dark/light cycle with shaking at 96 rpm [13]. 2 M NaCl was the normal condition. As for stress treatment, cell of D. bardawil cultivated in normal condition was accumulated by centrifugation at 5000g for 8 min at 26 °C, transferred to 100 mL of fresh medium containing 1.0, 1.5, 2.0, 2.5, 3.0, 3.5 and 4.5 M NaCl, and cultivated for 21 d (log or late log phase) under the normal condition as above for further experiments. Approximately 107 exponential phase cells phase were used for real-time quantitative PCR assay. About 106 nuclear transformed cells exponentially cultured in 2 M NaCl medium were accumulated by centrifugation at 5000g for 8 min at 26 °C in the expression study of egfp. E. coli GT-116 was host bacteria for plasmids. Clone vector pCR2.1 was purchased from Invitrogen. pcDNA6 myc-his-EGFP B vector was kindly provided by
2.2. Isolation of genomic DNA and total RNA Genomic DNA of D. bardawil was isolation in the log or late log phase using the OMEGA HP Plant DNA Kit. Total RNA isolated from approximately 107 D. bardawil cells was perfromed according to E.Z.N.A. Total RNA Kit II (Omega). Genomic walking kit (TaKaRa) was usded for isolation of pds and its promoter and terminator. SMARTer™ RACE cDNA Amplification Kit (Clontech) was used to for performing both 5′-rapid amplification of cDNA ends, in order to vertify the 5′ coding sequence. All primer was shown in Table 1. 2.3. Sequence analysis BLAST program was used to compare the similarity of sequence (http://blast.ncbi.nlm.nih.gov/). The protein sequence alignment was performed using ClustalX2 software. Conserved domains of protein or nucleotide in DbPds were detected using the Conserved Domains Search tool (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi). Promoter component prediction was revealed by PlantPAN (http://plantpan.mbc. nctu.edu.tw/). ORF Finder on NCBI (http://www.ncbi.nlm.nih.gov/gorf/ gorf.html) was used to analyze the ORF in DbPds. Subcellular localization presumption was performed using WoLF PSORT (http:// wolfpsort.org/). 2.4. Construction of plasmids Firstly, we amplified 1509 bp of DbPds promoter fragment fPDSPro from plasmid pPropds containing DbPds promoter as a template. This fragment was introduced downstream AscI cleavage site through the primer to facilitate subsequent vector construction. The use of this fragment was ligated to the TA cloning vector pCR2.1 to construct. This plasmid was named pPDSPro. Then pUC-EGFP plasmid as a template, fEGFP
Fig. 1. Schematic diagram of construction of foreign expression cassette pPdsET. A: pCR2.1 vector. B: The DbPds promoter was connected to the pCR2.1 by TA cloning. C: The egfp gene was ligated into the pPDSPro plasmid. D: The DbPds terminator was ligated into the pPDSProEGFP plasmid. E: Negative control plasmid.
18
H.-H. Chen et al. / Algal Research 20 (2016) 16–21
Fig. 2. The analysis of PDS protein conserved domain on NCBI. Conserved domains of DbPDS locate at 250–440. HpeE domain lacated at 260–430.
fragments was amplified containing ends of AscI and SacII-XhoI (Series connection) restriction sites. At the same time we used AscI and XhoI to digested plasmid pPDSPro and fEGFP fragments, and do ligation, the constructed plasmid was designated as pPDSProEGFP. Finally, pPDSProEGFP plasmid was digested with SacII and XhoI step by step. Since SacI restriction fragment is blunt, DbPds terminator only through XhoI to digest. We got sticky ends with complementary XhoI fragment. DbPds terminator fragment was cloned from plasmid pTerpds, where XhoI restriction sites are introduced in downstream sequence by PCR. Exogenous expression cassette plasmid was named pPdsET. Finally, BamHI and XhoI were used to digested pPdsET to get negative control plasmid pETpds. The construction of the plasmids used in this study was shown in Fig. 1.
2.5. Nuclear transformation of D. bardawil Nuclear transformation of D. bardawil cells was used the method modified by Lao et.al [14]. Firstly, 4–6 × 106 cells mL D. bardawil cells in log or late log phase were accumulated by centrifuging at 1000g for 5 min, wash, and suspended twice to 2 × 108 in electroporation buffer (1.4 M glycerol, 30 mM Tris-Cl, 50 mM NaCl, 6 mM CaCl2, and pH 7.5). Secondly, recombinant plasmids and carrier DNA (sheared and denatured salmon sperm DNA) were added to 0.5 mL of the cell suspension and mixed. The final concentration of recombinant plasmids is 10 mg L−1 and the final concentration of carrier DNA is 200 mg L−1. Next, 100 μL of mixture were transferred to a prechilled electroporation cuvette (with 2 mm gap) and were immersing in ice for 10 min before
Fig. 3. The genomic walking reaction for acquirement of DbPds promoter and terminator. A: Promoter region of DbPds. M: DNA marker (200 bp DNA ladder); From left to right, 1, 2 and 3: 1st, 2nd and 3rd nested PCR; B: Terminator region of DbPds. M: DNA marker (200 bp DNA ladder); From left to right, 1, 2 and 3: 1st, 2nd and 3rd nested PCR.
H.-H. Chen et al. / Algal Research 20 (2016) 16–21
19
Fig. 4. The microholography and fluorography of nomal D. bardawil cells and transformed D. bardawil cells. A: D.bardawil under the white light; B: The fluorography of D. bardawil extricated by blue light. C: The fluorography of D. bardawil transformed by pETpds plasmid (negative control); D: The 48 h-later fluorography of D. bardawil transformed by pPdsET plasmid; E: The 96 h-later fluorography of D. bardawil transformed by pPdsET plasmid. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
electroporation. Subsequently, electroporation was performed using the Bio-rad MicroPulser system. The electrical field strength is 1000 V cm−1 and the capacitance is 1000 μF. Next, the nuclear transformation cells were kept on ice for 10 min and then moved to 10 mL liquid culture medium at 25 °C for a 12 h incubation in the dark without antibiotics. Finally, the nucler transformation was move to liquid medium in the normal condition.
2.6. Expression studies of DbPds Real-time quantitative PCR was performed by using the PrimeScript RT Reagent Kit with gDNA Eraser and the SYBR Green PCR Kit (TaKaRa). Quantitative real-time PCR (qRT-PCR) was analyzed with a 7500 RealTime PCR System (Applied Biosystems) and SDS software (Applied Biosystems). The relative abundance of D. bardawil glyceraldehyde-3phosphate dehydrogenase gene (DbGapdh) was determined under salt stress, as an internal control [14]. All the manipulations of qRT-PCR were accoding to previous reports [14,15]. All reactions were set up in triplicate, and every sample was replicated for three parallels. All results were normalized to the DbGapdh. All the data of the transcription levels were expressed as mean ± SD of three parallel measurements (t-test, p b 0.05). According DbPds target gene and the reference DbGapdh fragment gene primers, qDbPds-F and qDbPds-R, qGapdh-F and qGapdh-R were designed. All were shown in Table 1.
3. Results and discussion 3.1. Isolation and sequence analysis of the DbPds The 3′-end genomic sequence of DbPds was obtained using Genomic walking kit. Firstly, three primers g1PdSP1, g1PdSP2, g1PdSP3 was design according to the 100 bp sequence before 3′UTR of DbPds. The amino acid sequences of Pds from green algae and higher plants were aligned by ClustalX2 to obtain the conserved sequence, then upstream primer nPd-F was designed. According to the sequence obtained by the first genomic walking, downstream primers nPd-R1 and nPd-R2 were designed. Semi-nested PCR was performed to obtain the middle sequence by using primers nPd-F, nPd-R1 and nPd-R2. Finally, second genomic walking primers g2PdSP1, g2PdSP2, g3PdSP3 were designed according to the middle sequence. After twice genomic walking and once semi-nested PCR we isolated the full-length genomic sequence of DbPds. The 5′-end of DbPds isolated in this experiment was different from the previous DbPds (GenBank: Y14807), so we used 5′-end rapid amplification of cDNA ends (5′-RACE) technology to determine the transcription start site ATG. The result showed that 288 bp sequence including initiation codon ATG in 5′-end coding region is consistent with the sequence isolated by genomic walking. The DbPds gene of 8113 bp contains 12 exons interrupted by 11 introns. The complete coding sequence (CDS) of DbPds was 1725 bp encoding a putative protein sequence of 574 amino acids. Theoretical
Fig. 5. Part of cis-acting elements in DbPds promoter. GT1CONSENSUS, ACGTATERD1, GATA box, and MYCCONSENSUSAT were at position −1300, −735, −320 and −94, correspondingly.
20
H.-H. Chen et al. / Algal Research 20 (2016) 16–21
Table 2 Potential regulation elements of DbPds promoter. Regulation elements
Funtions
Characteristic sequence
Referenced species
Reference
GATA box MYCCONSENSUSAT GT1CONSENSUS ACGTATERD1 ANAERO2CONSENSUS MNB1A OSE2ROOTNODULE SORLIP1AT WRKY71OS
GATA CANNTG GGAAAA ACGT AGCAGC AAAGH CTCTT GCCAC TGAC
Light regulation, tissue-specific expression Cold stress regulation Light regulation Drought-induced yellowing expression Anaerobic fermentation pathway Dof transcription factor recognition sequence Pathogen-induced Light regulation Transcriptional repressor factor
Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana, Oryza sativa Arabidopsis thaliana Arabidopsis thaliana Zea mays Glycine max, Vicia faba Arabidopsis thaliana Oryza sativa
[19] [20] [21] [22] [23] [24] [25] [26] [27]
molecular weight is about 62.1 kD. Nucleotide Blast result showed that there was a high homology between DbPds CDS and the Pds mRNA of D. bardawil (GenBank: Y14807), Chlamydomonas reinhardtii, and Haematococcus pluvialis, respectively for the identities of 1201/1359 (88%), 875/1151 (76%), and 286/366 (78%). However, despite the high similarities between these nucleotide sequences, DbPDS protein sequence was quite different from the corresponding protein sequences of the above species, with similarities of 172/370 (46%), 104/312 (33%) and 105/311 (34%), respectively. Using Conserved Domain Search (NCBI) to analyze conserved domains of proteins, we found that N terminal DbPDS did not contain any conserved domains. But C-terminal DbPDS was a typical conserved domain, associated with FAD-dependent dehydrogenase (domain HpnE) in carotenoid synthesis pathway, and is part of Pfam01593 superfamily (Fig. 2). 3.2. DbPDS subcellular localization analysis Membrane proteins have subcellular localization signal peptides which generally locate in the N-terminus. The online sever WoLF PSORT was used to analyze DbPDS and the previous DbPDS protein (GenBank: CAA75094.1). We found the possibility of DbPDS located in chloroplasts (chlo: 7.0, plas: 4.0, nucl: 1.0, ER: 1.0) higher than the previous DbPDS (chlo: 6.0, mito: 6.0, plas: 1.0). PDS subcellular localization has an important influence on the regulation of carotenoid synthesis. N terminus influence localization and dimerization of protein and it's also crucial to maintaining the stability and activity of the protein [16,17]. Further experiments are needed to clarify whether the gene expression of DbPds is relative to the subcellular location of carotenoid synthesis. 3.3. Cloning of the DbPds promoter and terminator According to the genomic sequence of DbPds, the promoter and terminator region were isolated by genomic walking. The primers were shown in Table 1. Sequence analysis by Blast showed that the third nested PCR products (3 kb in Fig. 3-A) possess identical region (80 bp
in length) as expected with the 5′-end DbPds. Likewise, a candidate terminator fragment shares 35 bp identical nucleotides with the 3′-end DbPds (1.6 kb in Fig. 3-B). 3.4. Activity verification of DbPds promoter and termiator In order to verify the expression activity of the DbPds promoter and terminator, the plasmids pETpds (negative control) and pPdsET were constructed and transformed to D. bardawil by electroporation, respectively. Under the blue excitation light, D. bardawil cell without EGFP perform red color. After the electroporation for 48 h, D. bardawil cells were observed under fluorescence microscope. The result was shown in Fig. 4. The negative control in blue excitation light did not perform green fluorescent. This proved that with no promoter expression plasmid failed to express EGFP. After 48 h, the D. bardawil cells transformed by pPdsET produced green fluorescence protein and can be excited. The highest activity was on the sixth day that it had a significant increase of green fluorescence D. bardawil cells. However, green fluorescent cells subsequently declined, which indicated that EGFP promoted by DbPds promoter was transient expression in D. bardawil. Consequently, we suspected that DbPds upsteam and downstream sequence were authentic DbPds promoter and terminator sequences, and they had a promoter and terminator basic activity. 3.5. DbPds promoter including potential cis-acting elements In order to analyze the potential cis-acting element in DbPds promoter, PlantPAN online server was utilized and six species (Arabidopsis, Zea mays, Oryza sativa, Glycine max, Solanum lycopersicum, Triticum aestivum) were chosen for the research. We found DbPds promoter sequence contained several regulatory elements (Fig. 5), including drought-induced plant yellow reaction element ACGTATERD1, cold stress element MYCCONSENSUSAT and light regulation element GATA box, etc. Herbicides inhibit the activity of PDS at the protein level through the competition with PDS coenzyme NAD (P) or plastoquinone
Fig. 6. Transcriptional analysis of DbPds under long-term salt stress. A: Relative transcriptional level of DbPds gene. Histogram represents mean of three repeats for each sample, the standard deviation (SD) is shown (t-test, p b 0.05). B: Melt curve of PCR amplification products of DbPds and DbGapdh gene.
H.-H. Chen et al. / Algal Research 20 (2016) 16–21
[18], but we did not find any potential herbicide binding site. Moreover, we have not found any element related to the salt regulation in DbPds promoters. Part of cis-acting elements of DbPds promoters are listed in Table 2. 3.6. Analysis of transcript levels Real-time quantitative PCR was performed using the PrimeScript RT Reagent Kit with gDNA Eraser and the SYBR Green PCR Kit (TaKaRa). The internal control is DbGapdh gene which can be relatively stable and efficient expression in cells. The relative expression of DbPds gene was detected in different salinity stress treatments (1.0, 1.5, 2.0, 2.5, 3.0, 3.5 and 4.5 M NaCl). The DbPds gene expression levels was set 1.0 under the 2.0 M NaCl. Quantitative results are shown in Fig. 6. The transcription quantitative PCR level of DbPds gene did not show a clear trend of gradually increasing or decreasing. With respecting to 2 M NaCl sample, 1.5 M, 3.5 M and 4.5 M NaCl DbPds sample transcription slightly increased. Specially, 4.5 M NaCl sample expresses the largest amount, and approximately 1.339 times higher than the 2 M NaCl sample. Other products relative to 2 M NaCl sample has declined. The largest decline was 2.5 M NaCl sample which was approximately 0.769 times loser than the 2 M NaCl sample. t-Test showed that the standard deviations of the test results were within a reasonable range. The results could reflect the salinity gradient expression level under the long-term culture in D. bardawil cell. In addition, the melting curve analysis of PCR products were all single peak, which confirm there was no non-specific amplification phenomenon (Fig. 6-A). There are evidences suggesting that Dunaliella PDS is not a carotenoid biosynthetic key enzyme under the salt stress condition. Under nutrient stress condition pds gene induced by salt stress in Dunaliella cells, however, when returned to normal nutrition, salt stress has been unable to induce transcription of pds [28]. This implies that pds gene is not sensitive to salt stress. 4. Conclusion Bioinformatics analysis showed that the DbPDS had a typical PDS conserved domain C-terminal region, located in the chloroplast, and had homology to other algae. Use the online analysis system, we found DbPds had a variety of potential regulatory elements which might be involved in the regulation of light, plants yellowing and cold stress, but not found any potential regulatory elements element related to salt regulation. This was consistent with the transcript level of DbPds under the salt gradient stress. We hypothesized that the pds gene isolated in this study was not likely induced under salt stress directly. Significantly, by constructing the DbPds promoter-EGFP-DbPds terminator exogenous gene expression cassette to drive EGFP expression in D. bardawil, we confirmed that DbPds upstream and downstream sequence isolated in this experiment were authentic active promoter and terminator. To investigate the molecular mechanism of carotenoids accumulation in D. bardawil, it provided an important theoretical support to further increase carotenoids production by genetic engineering. It is possible to use the stress-responsive genes from Dunaliella to enegineer higher plants and algae to product certain high value carotenoids by genetic engineering and biotechnology. Acknowledgement This project was supported by the National Natural Foundation of China (31171631 and 31571773), Guangdong Province Science and Technology plan project (2011B031200005), and Guangdong Provincial
21
Bureau of Ocean and Fishery Science and Technology to promote a special (A201301C04). References [1] G. Sandmann, G. Mitchell, In vitro inhibition studies of phytoene desaturase by bleaching ketomorpholine derivatives, 49 (2001) 138–141. [2] A.J. Simkin, et al., Comparison of carotenoid content, gene expression and enzyme levels in tomato (Lycopersicon esculentum) leaves, 58 (2003) 371–380. [3] V. Mann, I. Pecker, J. Hirschberg, Cloning and characterization of the gene for phytoene desaturase (Pds) from tomato (Lycopersicon esculentum), Plant Mol. Biol. 24 (1994) 429–434. [4] C. Zhu, et al., cDNA cloning and expression of carotenogenic genes during flower development in Gentiana lutea, Plant Mol. Biol. 48 (2002) 277–285. [5] Z. Sun, F.X. Cunningham, E. Gantt, Differential expression of two isopentenyl pyrophosphate isomerases and enhanced carotenoid accumulation in a unicellular chlorophyte, 95 (1998) 11482–11488. [6] M. Rodrigo, J.F. Marcos, L. Zacarías, Biochemical and molecular analysis of carotenoid biosynthesis in flavedo of orange (Citrus sinensis L.) during fruit development and maturation, 52 (2004) 6724–6731. [7] Y.H. Zhu, et al., Isolation and characterization of phytoene desaturase cDNA involved in the beta-carotene biosynthetic pathway in Dunaliella salina, J. Agric. Food Chem. 53 (2005) 5593–5597. [8] N. Nagatani, et al., Semi-real time imaging of the expression of a maize polyubiquitin promoter-GFP gene in transgenic rice, Plant Sci. 124 (1997) 49–56. [9] A.H.M. Van Der Geest, J.F. Petolino, Expression of a modified green fluorescent protein gene in transgenic maize plants and progeny, Plant Cell Rep. 17 (1998) 760–764. [10] A. Itaya, B. Ding, Developmental regulation of intercellular protein trafficking through plasmodesmata in tobacco leaf epidermis, Plant Physiol. 118 (1998) 373–385. [11] M.A. Borowitzka, C.J. Siva, The taxonomy of the genus Dunaliella (Chlorophyta, Dunaliellales) with emphasis on the marine and halophilic species, J. Appl. Phycol. 19 (2007) 567–590. [12] A. Ben-Amotz, M. Avron, The biotechnology of cultivating the halotolerant alga Dunaliella, Trends Biotechnol. 8 (1990) 121–126. [13] M.H. Liang, et al., Characterization and functional identification of a gene encoding geranylgeranyl diphosphate synthase from Dunaliella bardawil, J. Agric. Food Chem. 63 (2015) 737–741. [14] Y.M. Lao, et al., Hypoosmotic expression of Dunaliella bardawil ζ-carotene desaturase is attributed to a hypoosmolarity-responsive element different from other key carotenogenic genes, Plant Physiol. 165 (2014) 359–372. [15] M.H. Liang, et al., Inhibiting lycopene cyclases to accumulate lycopene in high β-carotene-accumulating Dunaliella bardawil, Food Bioprocess Technol. (2016) 1–8. [16] F.X. Cunningham, E. Gantt, Genes and enzymes of carotenoid biosynthesis in plants, Annu. Rev. Plant Physiol. Plant Mol. Biol. 49 (1998) 557–583. [17] Z. Sun, E. Gantt, F.X. Cunningham, Cloning and functional analysis of the β-carotene hydroxylase of Arabidopsis thaliana, J. Biol. Chem. 271 (1996) 24349–24352. [18] J. Breitenbach, A. Changfu Zhu, G. Sandmann, Bleaching herbicide norflurazon inhibits phytoene desaturase by competition with the cofactors, J. Agric. Food Chem. 49 (2001) 5270–5272. [19] E. Lam, N.H. Chua, ASF-2: a factor that binds to the cauliflower mosaic virus 35S promoter and a conserved GATA motif in cab promoters, Plant Cell 1 (1989) 1147–1156. [20] H. Abe, et al., Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling, Plant Cell 15 (2003) 63–78. [21] W.B. Terzaghi, A.R. Cashmore, Light-regulated transcription, Annu. Rev. Plant Biol. 46 (1995) 445–474. [22] T. Kuroi, K. Nakamoto, Two different novel cis-acting elements of erd1, a clpA homologous Arabidopsis gene function in induction by dehydration stress and darkinduced senescence, Plant Journal for Cell & Molecular Biology 33 (2003) 259–270. [23] B. Mohanty, et al., Detection and preliminary analysis of motifs in promoters of anaerobically induced genes of different plant species, Ann. Bot. 96 (2005) 669–681. [24] S. Yanagisawa, R.J. Schmidt, Diversity and similarity among recognition sequences of Dof transcription factors, Plant Journal for Cell & Molecular Biology 17 (1999) 209–214. [25] M.F. Vieweg, et al., The promoter of the Vicia faba L. leghemoglobin gene VfLb29 is specifically activated in the infected cells of root nodules and in the arbuscule-containing cells of mycorrhizal roots from different legume and nonlegume plants, Mol. Plant-Microbe Interact. 17 (2004) 62–69. [26] M.E. Hudson and P.H. Quail, Identification of Promoter Motifs Involved in the Network of Phytochrome A-Regulated Gene Expression by Combined Analysis of Genomic Sequence and Microarray Data, American Society for Plant Biologists. [27] Z.L. Zhang, et al., A rice WRKY gene encodes a transcriptional repressor of the gibberellin signaling pathway in aleurone cells, Plant Physiol. 134 (2004) 1500–1513. [28] S.N. Coesel, et al., Nutrient limitation is the main regulatory factor for carotenoid accumulation and for Psy and Pds steady state transcript levels in Dunaliella salina (Chlorophyta) exposed to high light and salt stress, Mar. Biotechnol. 10 (2008) 602–611.
Contents lists available at ScienceDirect
Algal Research journal homepage: www.elsevier.com/locate/algal
Short communication
Using EGFP as a reporter to confirm the function of phytoene desaturase promoter in Duanliella bardawil Hao-Hong Chen, Shan-Li Chen, Yong-Ming Lao, Ming-Hua Liang, Jian-Guo Jiang ⁎ College of Food and Bioengineering, South China University of Technology, Guangzhou 510640, China
a r t i c l e
i n f o
Article history: Received 9 June 2016 Received in revised form 9 August 2016 Accepted 11 September 2016 Available online xxxx Keywords: Dunaliella bardawil Phytoene desaturase Promoter Carotenogenesis EGFP
a b s t r a c t Phytoene desaturase (PDS) is an upstream key enzyme of carotenoid metabolic pathway in Dunaliella bardawil. This research attempts to clone the Pds gene and its promoter and terminator from D. bardawil and identify the promoter activity. Using LA-PCR based genomic walking approach and semi-nested PCR method, the DbPds gene was cloned and its structure was analyzed. 5′ RACE technique was used to determine its transcriptional start site. The bioinformatics analysis hypothesized that DbPds is one of the isoenzyme genes in D. bardawil. The full length of DbPds gene isolated included 8113 bp coding region (from ATG to TAA), 3010 bp upstream sequence and 1555 bp downstream sequence. By constructing the DbPds promoter-EGFP-DbPds terminator exogenous gene expression cassette to drive EGFP expression in D. bardawil, the activities of promoter and terminator of DbPds upstream and downstream sequence separated in this experiment were confirmed. Online promoter analysis tool PlantPAN was utilized to analyze the potential related osmotic stress-regulated elements in DbPds promoter. The result suggested that DbPds promoter does not contain any related elements about salt regulation. Furthermore, through in vivo detection of the responsive transcriptional level of DbPds genes under different salt concentrations, it was found that salt stress could not apparently affect DbPds expression, indicating that DbPds genes does not participate in the response to salt stress. © 2016 Elsevier B.V. All rights reserved.
1. Introduction In the carotenoid metabolism pathway, PDS is a key enzyme regulating the conversion of phytoene into ξ-carotene in plants. When norflurazon and fluridone bind to PDS active site, PDS will lose its catalytic activity, which leads to a lot of phytoene accumulation [1,2]. Currently, PDS cDNA sequences have been cloned and studied in some plants' flower and fruit, such as Lycopersicon esculentum [3], Citrus reticulata, Gentiana lutea, and Calendula officinalis [4]. Numerous studies have shown that the expression of the pds gene could promote the accumulation of carotenoids in flowers and fruits [5]. It was found that the increase of PDS gene expression will promote the accumulation of carotenoids during fruit ripening in citrus fruits [6]. The pds mRNA of D. bardawil (DbPds, GenBank: Y14807.1) has been cloned by RT-PCR and RACE-PCR methods on the basis of a modified switching mechanism at 5′ end of the RNA transcript (SMART) technology. Full-length cDNA DbPds is 2198 bp, which predicts its reading frame 1752 bp, encoding a polypeptide of 583 amino acids with a protein molecular weight of 64.889 kDa [7]. Recently, GFP has been widely used in molecular biology research. Naoki et al. used maize polyubiquitin promoter to drive gfp gene expression in transgenic rice [8]. ubi21 promoter can drive the gfp gene in maize
⁎ Corresponding author. E-mail address: [email protected] (J.-G. Jiang).
http://dx.doi.org/10.1016/j.algal.2016.09.012 2211-9264/© 2016 Elsevier B.V. All rights reserved.
embryogenic callus, and the transgenic plants and their progeny can stably express GFP [9]. Cucumber mosaic virus 3a movement and GFP fusion protein (3aMPBGFP) could be transformed into Nicotiana tabacum, and 3aMPBGFP did not transported by the major inter plasmodesmata, but into the complex inter-secondary plasmodesmata system [10]. The cDNA of DbPds has been cloned in our previous work [7], in the present research, the promoter and terminator of pds were isolated and cloned for the first time, and then the obtained nucleotide sequences and predicted the corresponding protein structure of DbPds were analyzed using various bioinformatics tools. The potential cis-acting element candidates in the DbPds promoter were identified by PlantPAN tools. Subsequently, promoter and terminator of DbPds were used to express the enhanced green fluorescent protein (EGFP) in D. bardawil in order to verify the activity of DbPds promoter and terminator. Finally, since the molecular basis of PDS regulation in response to salt stress has not yet been studied, we tried to detect the transcript of DbPds in response to salt stress to explore the relationship between the PDS expression and NaCl regulation. 2. Material and methods 2.1. Strains, plasmids and cultivation conditions Dunaliella bardawil strain FACHB-847, is the same strain of D. salina [11], obtained from the Institute of Hydrobiology, Chinese Academy of
H.-H. Chen et al. / Algal Research 20 (2016) 16–21
Y.C. Cao (Schoolof Biological Science and Engineering, South China University of Technology).
Table 1 Primers used in this study. Operation
Primers
Forward and reverse primers (5′ → 3′)
Gene isolation
g1PdSP1 g1PdSP2 g1PdSP3 g2PdSP1 g2PdSP2 g2PdSP3 nPd-F nPd-R1 nPd-R2 pPdSP1 pPdSP2 pPdSP3 tPdSP1 tPdSP2 tPdSP3 qGapdh-F qGapdh-R qDbPds-F qDbPds-R
AACACCTCTCAGCCAGTTTAGGA AGAACCAAGGGAAGGTGACTGC AAGGTGACTGCCTCGGTCAACACT AGACAAGAGCAAGCCCAATCCT GCCTCAGGGGCTTCAAAGGTCACA CTCAGGGGCTTCAAAGGTCACAGGA AGGGCACATGCTCAGACACT CGGACTAAGTTGCTCCAATCTC GGTCTCAGAGTCTGGGATGGT CCTCTAGTTCAATCCAAGGTGTTCAT ACAAAGAGCCACAGCCCACTAA ATTGGTTCAGAAGAGCCGTGAGTCC GCTTGCGAGCAGGTGGTAGAT TGTTGACCGAGGCAGTCACCTT TAAACTGGCTGAGAGGTGTTTTCGT TGCCACCCAGAAGCCTGTAGA ACCCGTGGAGGAAGGAATG ACATCCCTGCCCCCTGGAATGG ATACTTCTGGCCGAAGATGATAGC
Flanking sequence isolation
qRT-PCR
17
Science, were grown in defined medium [12], containing 2 M NaCl and were cultivated for 10 day at 26 °C and 8000 lx under a 16/8 h dark/light cycle with shaking at 96 rpm [13]. 2 M NaCl was the normal condition. As for stress treatment, cell of D. bardawil cultivated in normal condition was accumulated by centrifugation at 5000g for 8 min at 26 °C, transferred to 100 mL of fresh medium containing 1.0, 1.5, 2.0, 2.5, 3.0, 3.5 and 4.5 M NaCl, and cultivated for 21 d (log or late log phase) under the normal condition as above for further experiments. Approximately 107 exponential phase cells phase were used for real-time quantitative PCR assay. About 106 nuclear transformed cells exponentially cultured in 2 M NaCl medium were accumulated by centrifugation at 5000g for 8 min at 26 °C in the expression study of egfp. E. coli GT-116 was host bacteria for plasmids. Clone vector pCR2.1 was purchased from Invitrogen. pcDNA6 myc-his-EGFP B vector was kindly provided by
2.2. Isolation of genomic DNA and total RNA Genomic DNA of D. bardawil was isolation in the log or late log phase using the OMEGA HP Plant DNA Kit. Total RNA isolated from approximately 107 D. bardawil cells was perfromed according to E.Z.N.A. Total RNA Kit II (Omega). Genomic walking kit (TaKaRa) was usded for isolation of pds and its promoter and terminator. SMARTer™ RACE cDNA Amplification Kit (Clontech) was used to for performing both 5′-rapid amplification of cDNA ends, in order to vertify the 5′ coding sequence. All primer was shown in Table 1. 2.3. Sequence analysis BLAST program was used to compare the similarity of sequence (http://blast.ncbi.nlm.nih.gov/). The protein sequence alignment was performed using ClustalX2 software. Conserved domains of protein or nucleotide in DbPds were detected using the Conserved Domains Search tool (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi). Promoter component prediction was revealed by PlantPAN (http://plantpan.mbc. nctu.edu.tw/). ORF Finder on NCBI (http://www.ncbi.nlm.nih.gov/gorf/ gorf.html) was used to analyze the ORF in DbPds. Subcellular localization presumption was performed using WoLF PSORT (http:// wolfpsort.org/). 2.4. Construction of plasmids Firstly, we amplified 1509 bp of DbPds promoter fragment fPDSPro from plasmid pPropds containing DbPds promoter as a template. This fragment was introduced downstream AscI cleavage site through the primer to facilitate subsequent vector construction. The use of this fragment was ligated to the TA cloning vector pCR2.1 to construct. This plasmid was named pPDSPro. Then pUC-EGFP plasmid as a template, fEGFP
Fig. 1. Schematic diagram of construction of foreign expression cassette pPdsET. A: pCR2.1 vector. B: The DbPds promoter was connected to the pCR2.1 by TA cloning. C: The egfp gene was ligated into the pPDSPro plasmid. D: The DbPds terminator was ligated into the pPDSProEGFP plasmid. E: Negative control plasmid.
18
H.-H. Chen et al. / Algal Research 20 (2016) 16–21
Fig. 2. The analysis of PDS protein conserved domain on NCBI. Conserved domains of DbPDS locate at 250–440. HpeE domain lacated at 260–430.
fragments was amplified containing ends of AscI and SacII-XhoI (Series connection) restriction sites. At the same time we used AscI and XhoI to digested plasmid pPDSPro and fEGFP fragments, and do ligation, the constructed plasmid was designated as pPDSProEGFP. Finally, pPDSProEGFP plasmid was digested with SacII and XhoI step by step. Since SacI restriction fragment is blunt, DbPds terminator only through XhoI to digest. We got sticky ends with complementary XhoI fragment. DbPds terminator fragment was cloned from plasmid pTerpds, where XhoI restriction sites are introduced in downstream sequence by PCR. Exogenous expression cassette plasmid was named pPdsET. Finally, BamHI and XhoI were used to digested pPdsET to get negative control plasmid pETpds. The construction of the plasmids used in this study was shown in Fig. 1.
2.5. Nuclear transformation of D. bardawil Nuclear transformation of D. bardawil cells was used the method modified by Lao et.al [14]. Firstly, 4–6 × 106 cells mL D. bardawil cells in log or late log phase were accumulated by centrifuging at 1000g for 5 min, wash, and suspended twice to 2 × 108 in electroporation buffer (1.4 M glycerol, 30 mM Tris-Cl, 50 mM NaCl, 6 mM CaCl2, and pH 7.5). Secondly, recombinant plasmids and carrier DNA (sheared and denatured salmon sperm DNA) were added to 0.5 mL of the cell suspension and mixed. The final concentration of recombinant plasmids is 10 mg L−1 and the final concentration of carrier DNA is 200 mg L−1. Next, 100 μL of mixture were transferred to a prechilled electroporation cuvette (with 2 mm gap) and were immersing in ice for 10 min before
Fig. 3. The genomic walking reaction for acquirement of DbPds promoter and terminator. A: Promoter region of DbPds. M: DNA marker (200 bp DNA ladder); From left to right, 1, 2 and 3: 1st, 2nd and 3rd nested PCR; B: Terminator region of DbPds. M: DNA marker (200 bp DNA ladder); From left to right, 1, 2 and 3: 1st, 2nd and 3rd nested PCR.
H.-H. Chen et al. / Algal Research 20 (2016) 16–21
19
Fig. 4. The microholography and fluorography of nomal D. bardawil cells and transformed D. bardawil cells. A: D.bardawil under the white light; B: The fluorography of D. bardawil extricated by blue light. C: The fluorography of D. bardawil transformed by pETpds plasmid (negative control); D: The 48 h-later fluorography of D. bardawil transformed by pPdsET plasmid; E: The 96 h-later fluorography of D. bardawil transformed by pPdsET plasmid. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
electroporation. Subsequently, electroporation was performed using the Bio-rad MicroPulser system. The electrical field strength is 1000 V cm−1 and the capacitance is 1000 μF. Next, the nuclear transformation cells were kept on ice for 10 min and then moved to 10 mL liquid culture medium at 25 °C for a 12 h incubation in the dark without antibiotics. Finally, the nucler transformation was move to liquid medium in the normal condition.
2.6. Expression studies of DbPds Real-time quantitative PCR was performed by using the PrimeScript RT Reagent Kit with gDNA Eraser and the SYBR Green PCR Kit (TaKaRa). Quantitative real-time PCR (qRT-PCR) was analyzed with a 7500 RealTime PCR System (Applied Biosystems) and SDS software (Applied Biosystems). The relative abundance of D. bardawil glyceraldehyde-3phosphate dehydrogenase gene (DbGapdh) was determined under salt stress, as an internal control [14]. All the manipulations of qRT-PCR were accoding to previous reports [14,15]. All reactions were set up in triplicate, and every sample was replicated for three parallels. All results were normalized to the DbGapdh. All the data of the transcription levels were expressed as mean ± SD of three parallel measurements (t-test, p b 0.05). According DbPds target gene and the reference DbGapdh fragment gene primers, qDbPds-F and qDbPds-R, qGapdh-F and qGapdh-R were designed. All were shown in Table 1.
3. Results and discussion 3.1. Isolation and sequence analysis of the DbPds The 3′-end genomic sequence of DbPds was obtained using Genomic walking kit. Firstly, three primers g1PdSP1, g1PdSP2, g1PdSP3 was design according to the 100 bp sequence before 3′UTR of DbPds. The amino acid sequences of Pds from green algae and higher plants were aligned by ClustalX2 to obtain the conserved sequence, then upstream primer nPd-F was designed. According to the sequence obtained by the first genomic walking, downstream primers nPd-R1 and nPd-R2 were designed. Semi-nested PCR was performed to obtain the middle sequence by using primers nPd-F, nPd-R1 and nPd-R2. Finally, second genomic walking primers g2PdSP1, g2PdSP2, g3PdSP3 were designed according to the middle sequence. After twice genomic walking and once semi-nested PCR we isolated the full-length genomic sequence of DbPds. The 5′-end of DbPds isolated in this experiment was different from the previous DbPds (GenBank: Y14807), so we used 5′-end rapid amplification of cDNA ends (5′-RACE) technology to determine the transcription start site ATG. The result showed that 288 bp sequence including initiation codon ATG in 5′-end coding region is consistent with the sequence isolated by genomic walking. The DbPds gene of 8113 bp contains 12 exons interrupted by 11 introns. The complete coding sequence (CDS) of DbPds was 1725 bp encoding a putative protein sequence of 574 amino acids. Theoretical
Fig. 5. Part of cis-acting elements in DbPds promoter. GT1CONSENSUS, ACGTATERD1, GATA box, and MYCCONSENSUSAT were at position −1300, −735, −320 and −94, correspondingly.
20
H.-H. Chen et al. / Algal Research 20 (2016) 16–21
Table 2 Potential regulation elements of DbPds promoter. Regulation elements
Funtions
Characteristic sequence
Referenced species
Reference
GATA box MYCCONSENSUSAT GT1CONSENSUS ACGTATERD1 ANAERO2CONSENSUS MNB1A OSE2ROOTNODULE SORLIP1AT WRKY71OS
GATA CANNTG GGAAAA ACGT AGCAGC AAAGH CTCTT GCCAC TGAC
Light regulation, tissue-specific expression Cold stress regulation Light regulation Drought-induced yellowing expression Anaerobic fermentation pathway Dof transcription factor recognition sequence Pathogen-induced Light regulation Transcriptional repressor factor
Arabidopsis thaliana Arabidopsis thaliana Arabidopsis thaliana, Oryza sativa Arabidopsis thaliana Arabidopsis thaliana Zea mays Glycine max, Vicia faba Arabidopsis thaliana Oryza sativa
[19] [20] [21] [22] [23] [24] [25] [26] [27]
molecular weight is about 62.1 kD. Nucleotide Blast result showed that there was a high homology between DbPds CDS and the Pds mRNA of D. bardawil (GenBank: Y14807), Chlamydomonas reinhardtii, and Haematococcus pluvialis, respectively for the identities of 1201/1359 (88%), 875/1151 (76%), and 286/366 (78%). However, despite the high similarities between these nucleotide sequences, DbPDS protein sequence was quite different from the corresponding protein sequences of the above species, with similarities of 172/370 (46%), 104/312 (33%) and 105/311 (34%), respectively. Using Conserved Domain Search (NCBI) to analyze conserved domains of proteins, we found that N terminal DbPDS did not contain any conserved domains. But C-terminal DbPDS was a typical conserved domain, associated with FAD-dependent dehydrogenase (domain HpnE) in carotenoid synthesis pathway, and is part of Pfam01593 superfamily (Fig. 2). 3.2. DbPDS subcellular localization analysis Membrane proteins have subcellular localization signal peptides which generally locate in the N-terminus. The online sever WoLF PSORT was used to analyze DbPDS and the previous DbPDS protein (GenBank: CAA75094.1). We found the possibility of DbPDS located in chloroplasts (chlo: 7.0, plas: 4.0, nucl: 1.0, ER: 1.0) higher than the previous DbPDS (chlo: 6.0, mito: 6.0, plas: 1.0). PDS subcellular localization has an important influence on the regulation of carotenoid synthesis. N terminus influence localization and dimerization of protein and it's also crucial to maintaining the stability and activity of the protein [16,17]. Further experiments are needed to clarify whether the gene expression of DbPds is relative to the subcellular location of carotenoid synthesis. 3.3. Cloning of the DbPds promoter and terminator According to the genomic sequence of DbPds, the promoter and terminator region were isolated by genomic walking. The primers were shown in Table 1. Sequence analysis by Blast showed that the third nested PCR products (3 kb in Fig. 3-A) possess identical region (80 bp
in length) as expected with the 5′-end DbPds. Likewise, a candidate terminator fragment shares 35 bp identical nucleotides with the 3′-end DbPds (1.6 kb in Fig. 3-B). 3.4. Activity verification of DbPds promoter and termiator In order to verify the expression activity of the DbPds promoter and terminator, the plasmids pETpds (negative control) and pPdsET were constructed and transformed to D. bardawil by electroporation, respectively. Under the blue excitation light, D. bardawil cell without EGFP perform red color. After the electroporation for 48 h, D. bardawil cells were observed under fluorescence microscope. The result was shown in Fig. 4. The negative control in blue excitation light did not perform green fluorescent. This proved that with no promoter expression plasmid failed to express EGFP. After 48 h, the D. bardawil cells transformed by pPdsET produced green fluorescence protein and can be excited. The highest activity was on the sixth day that it had a significant increase of green fluorescence D. bardawil cells. However, green fluorescent cells subsequently declined, which indicated that EGFP promoted by DbPds promoter was transient expression in D. bardawil. Consequently, we suspected that DbPds upsteam and downstream sequence were authentic DbPds promoter and terminator sequences, and they had a promoter and terminator basic activity. 3.5. DbPds promoter including potential cis-acting elements In order to analyze the potential cis-acting element in DbPds promoter, PlantPAN online server was utilized and six species (Arabidopsis, Zea mays, Oryza sativa, Glycine max, Solanum lycopersicum, Triticum aestivum) were chosen for the research. We found DbPds promoter sequence contained several regulatory elements (Fig. 5), including drought-induced plant yellow reaction element ACGTATERD1, cold stress element MYCCONSENSUSAT and light regulation element GATA box, etc. Herbicides inhibit the activity of PDS at the protein level through the competition with PDS coenzyme NAD (P) or plastoquinone
Fig. 6. Transcriptional analysis of DbPds under long-term salt stress. A: Relative transcriptional level of DbPds gene. Histogram represents mean of three repeats for each sample, the standard deviation (SD) is shown (t-test, p b 0.05). B: Melt curve of PCR amplification products of DbPds and DbGapdh gene.
H.-H. Chen et al. / Algal Research 20 (2016) 16–21
[18], but we did not find any potential herbicide binding site. Moreover, we have not found any element related to the salt regulation in DbPds promoters. Part of cis-acting elements of DbPds promoters are listed in Table 2. 3.6. Analysis of transcript levels Real-time quantitative PCR was performed using the PrimeScript RT Reagent Kit with gDNA Eraser and the SYBR Green PCR Kit (TaKaRa). The internal control is DbGapdh gene which can be relatively stable and efficient expression in cells. The relative expression of DbPds gene was detected in different salinity stress treatments (1.0, 1.5, 2.0, 2.5, 3.0, 3.5 and 4.5 M NaCl). The DbPds gene expression levels was set 1.0 under the 2.0 M NaCl. Quantitative results are shown in Fig. 6. The transcription quantitative PCR level of DbPds gene did not show a clear trend of gradually increasing or decreasing. With respecting to 2 M NaCl sample, 1.5 M, 3.5 M and 4.5 M NaCl DbPds sample transcription slightly increased. Specially, 4.5 M NaCl sample expresses the largest amount, and approximately 1.339 times higher than the 2 M NaCl sample. Other products relative to 2 M NaCl sample has declined. The largest decline was 2.5 M NaCl sample which was approximately 0.769 times loser than the 2 M NaCl sample. t-Test showed that the standard deviations of the test results were within a reasonable range. The results could reflect the salinity gradient expression level under the long-term culture in D. bardawil cell. In addition, the melting curve analysis of PCR products were all single peak, which confirm there was no non-specific amplification phenomenon (Fig. 6-A). There are evidences suggesting that Dunaliella PDS is not a carotenoid biosynthetic key enzyme under the salt stress condition. Under nutrient stress condition pds gene induced by salt stress in Dunaliella cells, however, when returned to normal nutrition, salt stress has been unable to induce transcription of pds [28]. This implies that pds gene is not sensitive to salt stress. 4. Conclusion Bioinformatics analysis showed that the DbPDS had a typical PDS conserved domain C-terminal region, located in the chloroplast, and had homology to other algae. Use the online analysis system, we found DbPds had a variety of potential regulatory elements which might be involved in the regulation of light, plants yellowing and cold stress, but not found any potential regulatory elements element related to salt regulation. This was consistent with the transcript level of DbPds under the salt gradient stress. We hypothesized that the pds gene isolated in this study was not likely induced under salt stress directly. Significantly, by constructing the DbPds promoter-EGFP-DbPds terminator exogenous gene expression cassette to drive EGFP expression in D. bardawil, we confirmed that DbPds upstream and downstream sequence isolated in this experiment were authentic active promoter and terminator. To investigate the molecular mechanism of carotenoids accumulation in D. bardawil, it provided an important theoretical support to further increase carotenoids production by genetic engineering. It is possible to use the stress-responsive genes from Dunaliella to enegineer higher plants and algae to product certain high value carotenoids by genetic engineering and biotechnology. Acknowledgement This project was supported by the National Natural Foundation of China (31171631 and 31571773), Guangdong Province Science and Technology plan project (2011B031200005), and Guangdong Provincial
21
Bureau of Ocean and Fishery Science and Technology to promote a special (A201301C04). References [1] G. Sandmann, G. Mitchell, In vitro inhibition studies of phytoene desaturase by bleaching ketomorpholine derivatives, 49 (2001) 138–141. [2] A.J. Simkin, et al., Comparison of carotenoid content, gene expression and enzyme levels in tomato (Lycopersicon esculentum) leaves, 58 (2003) 371–380. [3] V. Mann, I. Pecker, J. Hirschberg, Cloning and characterization of the gene for phytoene desaturase (Pds) from tomato (Lycopersicon esculentum), Plant Mol. Biol. 24 (1994) 429–434. [4] C. Zhu, et al., cDNA cloning and expression of carotenogenic genes during flower development in Gentiana lutea, Plant Mol. Biol. 48 (2002) 277–285. [5] Z. Sun, F.X. Cunningham, E. Gantt, Differential expression of two isopentenyl pyrophosphate isomerases and enhanced carotenoid accumulation in a unicellular chlorophyte, 95 (1998) 11482–11488. [6] M. Rodrigo, J.F. Marcos, L. Zacarías, Biochemical and molecular analysis of carotenoid biosynthesis in flavedo of orange (Citrus sinensis L.) during fruit development and maturation, 52 (2004) 6724–6731. [7] Y.H. Zhu, et al., Isolation and characterization of phytoene desaturase cDNA involved in the beta-carotene biosynthetic pathway in Dunaliella salina, J. Agric. Food Chem. 53 (2005) 5593–5597. [8] N. Nagatani, et al., Semi-real time imaging of the expression of a maize polyubiquitin promoter-GFP gene in transgenic rice, Plant Sci. 124 (1997) 49–56. [9] A.H.M. Van Der Geest, J.F. Petolino, Expression of a modified green fluorescent protein gene in transgenic maize plants and progeny, Plant Cell Rep. 17 (1998) 760–764. [10] A. Itaya, B. Ding, Developmental regulation of intercellular protein trafficking through plasmodesmata in tobacco leaf epidermis, Plant Physiol. 118 (1998) 373–385. [11] M.A. Borowitzka, C.J. Siva, The taxonomy of the genus Dunaliella (Chlorophyta, Dunaliellales) with emphasis on the marine and halophilic species, J. Appl. Phycol. 19 (2007) 567–590. [12] A. Ben-Amotz, M. Avron, The biotechnology of cultivating the halotolerant alga Dunaliella, Trends Biotechnol. 8 (1990) 121–126. [13] M.H. Liang, et al., Characterization and functional identification of a gene encoding geranylgeranyl diphosphate synthase from Dunaliella bardawil, J. Agric. Food Chem. 63 (2015) 737–741. [14] Y.M. Lao, et al., Hypoosmotic expression of Dunaliella bardawil ζ-carotene desaturase is attributed to a hypoosmolarity-responsive element different from other key carotenogenic genes, Plant Physiol. 165 (2014) 359–372. [15] M.H. Liang, et al., Inhibiting lycopene cyclases to accumulate lycopene in high β-carotene-accumulating Dunaliella bardawil, Food Bioprocess Technol. (2016) 1–8. [16] F.X. Cunningham, E. Gantt, Genes and enzymes of carotenoid biosynthesis in plants, Annu. Rev. Plant Physiol. Plant Mol. Biol. 49 (1998) 557–583. [17] Z. Sun, E. Gantt, F.X. Cunningham, Cloning and functional analysis of the β-carotene hydroxylase of Arabidopsis thaliana, J. Biol. Chem. 271 (1996) 24349–24352. [18] J. Breitenbach, A. Changfu Zhu, G. Sandmann, Bleaching herbicide norflurazon inhibits phytoene desaturase by competition with the cofactors, J. Agric. Food Chem. 49 (2001) 5270–5272. [19] E. Lam, N.H. Chua, ASF-2: a factor that binds to the cauliflower mosaic virus 35S promoter and a conserved GATA motif in cab promoters, Plant Cell 1 (1989) 1147–1156. [20] H. Abe, et al., Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling, Plant Cell 15 (2003) 63–78. [21] W.B. Terzaghi, A.R. Cashmore, Light-regulated transcription, Annu. Rev. Plant Biol. 46 (1995) 445–474. [22] T. Kuroi, K. Nakamoto, Two different novel cis-acting elements of erd1, a clpA homologous Arabidopsis gene function in induction by dehydration stress and darkinduced senescence, Plant Journal for Cell & Molecular Biology 33 (2003) 259–270. [23] B. Mohanty, et al., Detection and preliminary analysis of motifs in promoters of anaerobically induced genes of different plant species, Ann. Bot. 96 (2005) 669–681. [24] S. Yanagisawa, R.J. Schmidt, Diversity and similarity among recognition sequences of Dof transcription factors, Plant Journal for Cell & Molecular Biology 17 (1999) 209–214. [25] M.F. Vieweg, et al., The promoter of the Vicia faba L. leghemoglobin gene VfLb29 is specifically activated in the infected cells of root nodules and in the arbuscule-containing cells of mycorrhizal roots from different legume and nonlegume plants, Mol. Plant-Microbe Interact. 17 (2004) 62–69. [26] M.E. Hudson and P.H. Quail, Identification of Promoter Motifs Involved in the Network of Phytochrome A-Regulated Gene Expression by Combined Analysis of Genomic Sequence and Microarray Data, American Society for Plant Biologists. [27] Z.L. Zhang, et al., A rice WRKY gene encodes a transcriptional repressor of the gibberellin signaling pathway in aleurone cells, Plant Physiol. 134 (2004) 1500–1513. [28] S.N. Coesel, et al., Nutrient limitation is the main regulatory factor for carotenoid accumulation and for Psy and Pds steady state transcript levels in Dunaliella salina (Chlorophyta) exposed to high light and salt stress, Mar. Biotechnol. 10 (2008) 602–611.