Uteroplacental insufficiency lowers the threshold towards hypoxia-induced cerebral apoptosis in growth-retarded fetal rats

Brain Research 895 (2001) 186–193 www.elsevier.com / locate / bres

Research report

Uteroplacental insufficiency lowers the threshold towards hypoxia-induced cerebral apoptosis in growth-retarded fetal rats a, b b b Robert H. Lane *, Rolando J. Ramirez , Anna E. Tsirka , Jennifer L. Kloesz , b b a Margaret K. McLaughlin , Elisa M. Gruetzmacher , Sherin U. Devaskar a

Department of Pediatrics, UCLA School of Medicine, Mattel Children’ s Hospital @ UCLA, Mental Retardation Research Center, Division of Neonatology and Developmental Biology, 10833 Le Conte Ave B2 -375, Los Angeles, CA 90095 -1752, USA b Department of Pediatrics and Obstetrics and Gynecology, University of Pittsburgh School of Medicine, Magee-Womens Research Institute, Pittsburgh, PA 15213, USA Accepted 26 December 2000

Abstract Infants suffering uteroplacental insufficiency and hypoxic ischemic injury often demonstrate cerebral apoptosis. Our objective was to determine the global effects of uteroplacental insufficiency upon cerebral gene expression of the apoptosis related proteins Bcl-2 and Bax and their role in increasing vulnerability to hypoxia-induced cerebral apoptosis. We therefore caused uteroplacental insufficiency and growth retardation by performing bilateral uterine artery ligation upon pregnant rats 2 days prior to term delivery and elicited further perinatal fetal hypoxia by placing maternal rats in 14% FiO 2 3 h prior to delivery. We quantified cerebral levels of Bcl-2 and Bax mRNA, lipid peroxidation, caspase-3 activity, and cAMP in control and growth retarded term rat pups that experienced either normoxia or hypoxia. Uteroplacental insufficiency alone caused a significant decrease in cerebral Bcl-2 mRNA levels without altering cerebral Bax mRNA levels, malondialdehyde levels, or caspase-3 activity. In contrast, uteroplacental insufficiency and subsequent fetal hypoxia significantly increased cerebral Bax mRNA levels, lipid peroxidation and caspase-3 activity; Bcl-2 mRNA levels continued to be decreased. Hypoxia alone increased cerebral cAMP levels, whereas uteroplacental insufficiency and subsequent hypoxia decreased cerebral cAMP levels. We speculate that the decrease in Bcl-2 gene expression increases the vulnerability towards cerebral apoptosis in fetal rats exposed initially to uteroplacental insufficiency and subsequent hypoxic stress.  2001 Elsevier Science B.V. All rights reserved. Theme: Development and Regeneration Topic: Nutritional and prenatal factors Keywords: Intrauterine growth retardation; Bcl-2; Bax; Lipid peroxidation; Hypoxic ischemic encephalopathy; Apoptosis

1. Introduction Uteroplacental insufficiency is associated with hypoxic– ischemic cerebral damage [58,60]. Severe prenatal hypoxia–ischemia causes both cerebral necrosis and apoptosis and results in fetal demise or perinatal death [14,50]. Intrauterine growth retardation (IUGR) is an adaptation to less severe episodes of prenatal hypoxia–ischemia and is associated with long-term neurodevelopmental morbidity [33]. The relative contribution of cerebral apoptosis to the *Corresponding author. Tel.: 11-310-794-4891; fax: 11-310-2670154. E-mail address: [email protected] (R.H. Lane).

neurodevelopmental morbidity of these children is not known, though the concept of apoptosis contributing to the cerebral pathology of the IUGR infant is intriguing. Most IUGR infants who demonstrate abnormal neurodevelopmental outcomes do not display overt neurological symptomatology in the perinatal period [35]. This phenomenon is more consistent with apoptosis causing cerebral cell death than necrosis because the latter is more likely to cause an inflammatory response that results in immediate symptoms such as seizures [13]. Apoptosis contributes of the pathogenesis of cerebral ischemia in juvenile and adult animals, and the relative contribution of apoptosis towards cerebral cell death increases with the immaturity of the animals studied [10,44,52,59,63]. Furthermore, apoptosis is

0006-8993 / 01 / $ – see front matter  2001 Elsevier Science B.V. All rights reserved. PII: S0006-8993( 01 )02074-1

R.H. Lane et al. / Brain Research 895 (2001) 186 – 193

an important and active mechanism of normal human and rodent fetal brain development [5,39]. Apoptosis is characterized by chromatin condensation and DNA fragmentation, which requires caspase-3 (casp-3) activity [23,43]. The mitochondrial associated proteins Bax and Bcl-2 contribute to the signaling pathways that activate casp-3, and both are expressed in the fetal brain [23,32,43,51]. Bax is an important pro-apoptotic protein that triggers cellular events ascribed to apoptosis including the release of cytochrome C from the mitochondria; in contrast, Bcl-2 attenuates the effects of cytochrome C release and may counter the effects of Bax upon mitochondrial involvement with apoptosis [24,25,41]. Gene expression of Bcl-2 and Bax responds to components of the intracellular and extracellular environment such as acidosis, hypoxia, hypoglycemia, and changes in growth factor availability [22,25,31,36,54,65]: all of which characterize the intrauterine milieu associated with uteroplacental insufficiency and IUGR in humans [4,12,38]. These changes are also seen in a rat model of uteroplacental insufficiency that is initiated by bilateral uterine artery ligation of the pregnant rat 48 h prior to delivery [40,57]. Fetal and neonatal rats in this model are significantly lighter than controls that undergo identical anesthesia and sham surgery, and litter size does not differ between control and IUGR groups [26]. We therefore hypothesized that uteroplacental insufficiency would alter cerebral gene expression of Bcl-2 and Bax in the term fetal rat, and these alterations would make the IUGR fetal rat more vulnerable to an additional perinatal hypoxic insult. To test this hypothesis, we examined the global effects of uteroplacental insufficiency and sham surgery (controls) upon fetal cerebral Bcl-2 and Bax mRNA levels, lipid peroxidation (as a measure of oxidative stress), and casp-3 activity. We also measured cerebral cAMP levels because acute cerebral hypoxic stress increases neuronal cAMP levels [3,42,62]. Uteroplacental insufficiency decreased Bcl-2 mRNA levels, but had no effect upon cerebral lipid peroxidation, Bax mRNA levels, casp-3 activity, and cAMP levels. We then determined whether the decrease in Bcl-2 gene expression is associated with increased vulnerability towards apoptosis by causing fetal perinatal hypoxia in both IUGR and control fetuses. We found that fetal hypoxia alone causes a significant increase in cAMP levels. Moreover, we found that uteroplacental insufficiency and subsequent hypoxic stress caused significant increases in cerebral lipid peroxidation, Bax mRNA levels, and casp-3 activity versus either uteroplacental insufficiency or fetal hypoxia alone.

187

Animal Care and Use Committee of the Magee-Womens Research Institute, Pittsburgh, PA. Timed pregnant Sprague–Dawley rats (Taconic Farms, Germantown, NY) were housed in individual cages and were exposed to 12-h light–dark cycles. All animals were fed routine Purina rat chow ad libitum (St. Louis, MO). The animals were allowed at least 2 days of acclimatization before experimental handling. The rat model of uteroplacental insufficiency and IUGR used in this study was bilateral uterine artery ligation of the pregnant rat 48 h prior to term delivery that we have previously described [26–30,40]. On day 19 of gestation (term is 21.5 days), the maternal rats were anesthetized with intraperitoneal xylazine (8 mg / kg) and ketamine (40 mg / kg), and both inferior uterine arteries were ligated (IUGR) (n516 litters). Sham surgery was performed upon control animals who underwent identical anesthetic and surgical procedures except for the uterine artery ligation (Con) (n516 litters). Rats recovered within a few hours and had ad lib access to food and water. On day 21 of gestation randomly selected control and IUGR dams (n58, respectively) were exposed to 3 h of 14% FiO 2 by placement in a monitored sealed plastic chamber (Con-H and IUGR-H). Oxygen concentration and time of exposure were predetermined to be optimal for causing fetal hypoxia without a significant loss in fetal weight or litter size. The hypoxic environment was created and maintained by bleeding nitrogen into the chamber, and the percentage of oxygen in the chamber was continuously monitored and kept at 14%. Carbon dioxide levels were maintained at less than 0.1% by gas flow. The remaining animals were maintained in 21% FiO 2 (Con-N and IUGRN). Fetuses were delivered by caesarian section. Blood was obtained from axillary vessels within 10–15 s of severing the umbilical cord. Blood gas determinations and glucose levels were determined using the i-STATE analyzer (iSTAT corporation, East Windsor, NJ). Each pup was weighed, decapitated, and the brains were immediately harvested. Maternal rats were sacrificed by pentobarbital overdose (100 mg / kg). Two to three animals were pooled from each litter (for an n51) for RNA, malondialdehyde, caspase-3 activity, and cAMP levels, respectively.

2.2. RNA isolation Total RNA was extracted from brain by the method of Chomczynksi and Sacchi [8] and quantified in triplicate using UV absorbance at 260 nm. Gel electrophoresis confirmed the integrity of the samples. Bovine retinal RNA was prepared in a similar manner.

2. Methods

2.3. RT-PCR 2.1. Animals All procedures were approved by the Institutional

This methodology of RT-PCR has been previously reported [26,27,29]. cDNA was synthesized using random

R.H. Lane et al. / Brain Research 895 (2001) 186 – 193

188

hexamers and Superscript II RTE (Gibco-BRL Life Technologies, Gaithersburgh, MD) from 1.0 mg of rat brain RNA added to 0.01 mg of bovine retinal RNA. The resulting cDNA was re-suspended in 20 ml of water, diluted into 1:100 aliquots, and stored at 2208C until use. Amplification primers for Bcl-2, Bax, and rhodopsin are listed in Table 1. To determine reaction conditions when both amplicons were simultaneously produced exponentially, we reverse transcribed and amplified serial dilutions of rat RNA with standard amounts of retinal RNA under different conditions and cycle numbers. Once optimal conditions were determined, we ran a single standard serial dilution with each quantification to regularly verify parallel production of both rat and bovine PCR products. Reactions were replicated 3 times once optimal PCR conditions were determined, and the primer concentrations were identical across all ages and between study groups for each rat DNA target, respectively. The PCR products were separated on a non-denaturing 5% acrylamide gel, and the radioactivity incorporated into the amplified product was quantified using a phosphorimager and Molecular Analyst  software (Bio-Rad Laboratories, Hercules, CA). The abundance of Bcl-2 and Bax was quantified relative to that of a control rhodopsin band from the same reaction, which was assigned an arbitrary level of unity. To determine the specificity of the primers, the amplified products were sequenced.

2.4. Malondialdehyde levels Malondialdehyde levels are commonly used to measure lipid peroxidation and oxidative cellular stress [15]. Brains were weighed, minced, and homogenized with ground glass grinders in 0.8 ml ice-cold Tris(hydroxymethyl) aminomethane buffer, 50 mM at pH 7.4 (containing 200 mM solution of butylated hydroxytoluene to prevent further formation of thiobarbituric acid reactive substances). After centrifugation (10003g for 20 min), the supernatant was removed and 0.6 ml of 20% trichloroacetic acid in 0.6 N HCl was added to precipitate protein. After further centrifugation (10 0003g for 15 min), 0.2 ml thiobarbituric acid reagent was added to 1 ml of sample, and the samples were heated, spun, and cooled to room temperature. Absorbencies were read at 532 nm. A standard curve was generated from increasing concentrations of 1,1,3,3-tetrahexopropane. Negative controls were run

without protein and without thiobarbituric acid reagent, respectively.

2.5. Caspase-3 activity Casp-3 activity is a specific molecular event that identifies apoptosis [6,18,48,49,55,64]. Our protocol used the ApoalertE CPP32 / Caspase-3 Assay (Clontech, Palo Alto, CA). The Apoalert Caspase-3 Colorimetric Assay KitE measures the proteolytic cleavage of the chromophore p-nitroanilide (pNA) from a DEVD tetrapeptide sequence. Brains were homogenized in chilled lysis buffer and subsequently centrifuged (12 000 rpm33 min at 48C) to precipitate cellular debris. The supernatant was then transferred to a new microcentrifuge tube. Fifty ml of reaction buffer containing DTT were added to each reaction, and then 1 mM of conjugated substrate was added to each tube. The reaction was incubated at 378C for 1 h. Absorbencies were read at 405 nm, and a standard curve was generated using a positive control of CPP32 chromogenic substrate. Negative controls were generated by running a reaction without conjugated substrate and with the Casp-3 inhibitor DEVD-fmk, respectively.

2.6. cAMP levels A commercially available kit was used (R&D Systems, Minneapolis, MN). This kit is a competitive immunoassay in which cAMP present in the sample competes for a fixed amount of alkaline phosphatase-labeled cAMP for sites on a polyclonal antibody. A zero standard and a dilution series were used to develop a cAMP standard curve. All unknowns were assayed in triplicate.

2.7. Statistics All data presented are expressed as mean6S.E.M. For animal weights, blood gases, malondialdehyde levels, caspase activity, and cAMP levels, statistical analyses were performed using ANOVA (Fisher’s protected least significance difference) and Student’s unpaired t-test. For RTPCR, statistical analyses were performed using the nonparametric Wilcoxon matched pair test.

Table 1 Sequences of PCR primers a Gene

Sense primer (59–39)

Antisense primer (59–39)

Size of PCR product (bp)

Genbank accession no.

rBax rBcl-2 Rhodopsin

TTTCATCCAGGATCGAGCAG AGCCTGAGAGCAACCGAACG TATTCTTCTGCTACGGGCAG

TGGTCTTGGATCCAGACAGG CATCCCTGAAGAGTTCCTCC ATGGGTGAAGATGTAGAACG

377 257 180

U449729 L14680 M21606

a

Sequences of each primer pair and their location in sequences cited in GenBankE as noted.

R.H. Lane et al. / Brain Research 895 (2001) 186 – 193 Table 2 Day 21 pup weights a Group

Weight (g)

Con-N IUGR-N Con-H IUGR-H

3.6960.09 2.8160.08* 3.6260.09 2.7310.07*

a

n58 litters for each study group. *P,0.05, IUGR versus control.

3. Results

3.1. Animals Though bilateral uterine artery ligation significantly reduced pup weight (Table 2), control and IUGR pups from dams inspiring 14% FiO 2 were not significantly lighter than their normoxic counterparts (Table 2). Mater-

189

nal inspiration of 14% FiO 2 did significantly decrease fetal pO 2 and pH in both sham-control and IUGR groups (P,0.05) (Table 3), though no significant difference was noted in fetal pCO 2 or glucose.

3.2. Bcl-2 and Bax mRNA levels Bcl-2 mRNA levels were significantly decreased to 29603 and 37606% of control values, respectively, for IUGR-N and IUGR-H pups (P,0.05); perinatal hypoxia alone (Con-H) did not result in a change in Bcl-2 mRNA (95605% of control) (Fig. 1). In contrast, Bax mRNA levels were unchanged in the IUGR-N and Con-H groups (110620 and 98613% of control, respectively). When both uteroplacental insufficiency and hypoxia were present, however, Bax mRNA levels significantly increased to 168611% of control values (P,0.05) (Fig. 1).

Table 3 Arteriovenous pH, blood gas tensions, and glucose in day 21 fetal pups a

Perinatal normoxia, control and IUGR Perinatal hypoxia, control and IUGR

pH

pCO 2 (mm Hg)

pO 2 (mm Hg)

Glucose (mmol / l)

7.2560.04

52.865.4

23.761.3

6.760.4

7.1460.03*

44.467.7

11.263.4*

7.560.7

a

n54 litters each study group. *P,0.05, hypoxia versus normoxia.

Fig. 1. Quantification and representative phosphorimages of Cerebral Bcl-2 and Bax RT-PCR products in control-normoxia (Con-N), IUGR-normoxia (IUGR-N), control-hypoxia (Con-H), and IUGR-hypoxia (IUGR-H) term fetal pups (n58 litters each group). Rat targets (Bcl-2, Bax) are the top band, and bovine internal controls (rhodopsin) are the bottom band of the phosphorimages. RT-PCR products were quantified by phosphorimage analysis (Molecular AnalystE Software, BioRad). Results are expressed as percent of the control-normoxia groups (which was arbitrarily defined as 100%)6S.E.M. (*P,0.05 versus Con-N).

190

R.H. Lane et al. / Brain Research 895 (2001) 186 – 193

3.3. Cerebral malondialdehyde levels There was no significant difference between Con-N and IUGR-N cerebral malondialdehyde levels (38.365.4 versus 49.7768.6 nmol / mg protein). Hypoxia (Con-H) alone resulted in a significant increase of malondialdehyde levels to 133634 nmol / mg protein (P,0.05 versus Con-N), and uteroplacental insufficiency and hypoxia together (IUGRH) caused a significant increase of malondialdehyde levels to 306669 nmol / mg protein (Fig. 2) (P,0.05 versus Con-H; P,0.01 versus Con-N).

3.4. Cerebral caspase-3 activity Cerebral caspase-3 activity did not significantly increase in either the IUGR-N or the Con-H groups (Con-N5 15.562.1 u / mg protein; IUGR-N5N-14.161.8 u / mg protein; Con-H518.462.6 u / mg protein). Casp-3 activity was significantly increased in those pups that experienced both uteroplacental insufficiency and perinatal hypoxia (39.066.2 u / mg protein*) (*P,0.05 versus Con-N, ConH, and IUGR-N) (Fig. 3).

3.5. Cerebral cAMP levels cAMP levels were did not significantly increase in the IUGR-N group. As expected, cAMP levels significantly increased in the Sham-H versus either the Sham-N group or IUGR-N group (Sham-N575.465.3 pm / mg; IUGR-N5 73.7 466.6 pm / mg; Sham-H595.4 468.0* pm / mg) (*P, 0.05 versus Sham-N and IUGR-N). Interestingly, cerebral cAMP levels were significantly decreased in the IUGR-H

Fig. 2. Quantification of cerebral malondialdehyde levels in controlnormoxia (Con-N), IUGR-normoxia (IUGR-N), control-hypoxia (ConH), and IUGR-hypoxia (IUGR-H) term fetal pups (n58 litters each group). Results are expressed as mean mmol / mg protein6S.E.M. (*P, 0.05 versus Con-N; **P,0.01 versus Con-N).

Fig. 3. Quantification of cerebral caspase-3 activity in control-normoxia (Con-N), IUGR-normoxia (IUGR-N), control-hypoxia (Con-H), and IUGR-hypoxia (IUGR-H) term fetal pups (n58 litters each group). Results are expressed as percent of the control-normoxia groups (which was arbitrarily defined as 100%)6S.E.M. (*P,0.05 versus Con-N).

pups (IUGR-H558.5 465.9* pm / mg) (*P,0.05 versus Sham-N and IUGR-N) (Fig. 3).

4. Discussion This study demonstrates that uteroplacental insufficiency in the rat lowers the cerebral threshold towards perinatal hypoxic stress-induced apoptosis. Casp-3 is the central effector enzyme of the apoptotic cascade and a mediator of cell death in the developing nervous system [23,55]. Neither uteroplacental insufficiency nor fetal hypoxia alone caused a significant increase in casp-3 activity; in contrast, the combination of uteroplacental insufficiency and subsequent hypoxic stress significantly increased casp-3 activity. The increase in casp-3 activity in this study was preceded by a decrease in cerebral Bcl-2 mRNA levels secondary to uteroplacental insufficiency. Fetal hypoxic stress, though it significantly increased cerebral lipid peroxidation, had no effect upon casp-3 activity. The decrease in cerebral Bcl-2 mRNA found in IUGR-N pups is important because it provides a molecular mechanism that links uteroplacental insufficiency and vulnerability to increased pathological cerebral apoptosis in the developing nervous system in response to subsequent fetal hypoxia; a situation which may be analogous to a human IUGR infant experiencing hypoxia during a labor and delivery. Apoptosis occurs throughout gestation in the developing rodent and human central nervous systems, and Bcl-2 gene expression inversely correlates with developmental apoptosis in the visual, sensory, and motor cortices [5,39].

R.H. Lane et al. / Brain Research 895 (2001) 186 – 193

Bcl-2 functions in antioxidant pathways to prevent apoptosis, and inhibits apoptotic death of central neural cells due to hypoglycemia and growth factor withdrawal [20,31,32]. A mechanism through which Bcl-2 forestalls apoptosis is by blocking mitochondrial cytochrome C release [47,61]. In contrast, Bax is an important proapoptotic protein that triggers cellular events ascribed to apoptosis including the release of cytochrome C from the mitochondria [24]. A molecular ratio of Bax / Bcl-2 may act as a cellular ‘rheostat’ determining cellular flux towards or away from apoptosis [17,25,41]. Consistent with this concept is the observation that cerebral ischemia in adult rats decreases Bcl-2 expression and increases Bax expression, and these changes in expression localize to focal areas of apoptosis [16,21]. Pathological apoptosis also occurs in immature stressed rat pups. Brains from 7-day-old rat pups exhibit more apoptosis than brains from 14- and 28-day-old animals when cerebral hypoxia–ischemia is induced by carotid artery ligation and subsequent hypoxia [44,52]. Cerebral apoptosis is also found in rat pups up to 8 days after inducing hypoxia–ischemia by placing the uterine horn to which they belong in a water bath [10]. Neither of these studies quantified changes in Bcl-2 or Bax gene expression, caspase activity, or lipid peroxidation, and these models do not mimic the intrauterine physiology and milieu associated with uteroplacental insufficiency and IUGR. Gestation is a unique period of time in the development of the CNS because of the immaturity of the fetus and the interactive physiology and biochemistry of mother, placenta, and fetus. The intrauterine milieu caused by uteroplacental insufficiency is characterized not only by fetal hypoxia, acidosis, and hypoglycemia, but also by alterations in serum growth factor biochemistry. Insulin growth factors (IGF) and their binding proteins are the best studied. IGF-I levels decrease and IGF binding protein 1 (IGFBP1) increase in IUGR human neonates [1,7]. Similarly, bilateral uterine artery ligation of the pregnant rat causes a decrease in fetal IGF-I and a concurrent increase in fetal IGFBP1 levels in the IUGR rat [57]. This component of the IUGR intrauterine milieu may be important because increased IGF-1 bioavailability prevents cerebral apoptosis in adult rats and alters cerebral gene expression and function of Bcl-2 as well as casp-3 activation [2,19,53,56]. Similarly, cAMP inhibits induction of caspase-3 expression and caspase-3 activity; furthermore, an increase in CSF cAMP plays a role in autoregulatory cerebral vasodilatation during periods of hypoxia and ischemia [9,11,37,62]. Our findings of increased cerebral cAMP in the Con-N pups is consistent with previous published reports of the effect of hypoxia and hypoxia–ischemia upon neuronal and CSF cAMP levels [3,42,62]. Our findings of decreased cAMP in the IUGR-H group are

191

novel, though consistent with the attenuation of cAMP CSF levels seen by Ben-Haim and Armstead during the more prolonged periods of hypoxia in the newborn pig [3]. We speculate that the dramatic difference in cerebral cAMP levels between Con-H and IUGR-H pups may play a role in the significant rise in cerebral lipid peroxidation and casp-3 activity in IUGR-H pups, despite being both groups being characterized by similar degrees of systemic acidosis and hypoxia. The decreased IUGR-H cerebral cAMP levels are particularly intriguing in light of the findings of Pourcyrous et al., who demonstrated that decreased CSF cAMP levels were associated with a poor neurological outcome in asphyxiated infants [45]. Caution is necessary of course when attempting to apply data from a rat model to human pathophysiology. The fetal and juvenile rat is physiologically immature relative to the human, and the insult imposed on the fetal rat in this model of uteroplacental insufficiency is severe and specific. In contrast, the timing and impact of uteroplacental insufficiency experienced by humans range across a continuum. This study is also limited in that we measured only two members of the Bcl-2 family, and our results can not exclude contributions from other apoptosis related proteins such as Bcl-x. A question not answered by this study is whether the predisposition towards apoptosis caused by uteroplacental insufficiency is beneficial or harmful to the fetus in terms of immediate survival. The answer to this question may center upon the mitochondria. IUGR fetal rats express increased of mitochondrial adenine nucleotide translocase mRNA (ANT) [30]. ANT cooperates with Bax as a component of the permeability transition pore complex, which increases mitochondrial membrane permeability and triggers mitochondrial and apoptotic cell death [34]. Selective death of mitochondrial rich cells in the CNS is protective because mitochondria are a significant source of free radical production [46]. We speculate that the CNS lowers the apoptotic threshold to ensure the immediate survival of the IUGR newborn in response to the initial insult of uteroplacental insufficiency. While this increases the risk of apoptosis if a second insult occurs (such as hypoxia), it minimizes the risk of a global necrotic insult. The price to this mechanism is increased loss of the susceptible CNS cells rich in mitochondria. The loss of these cells may play a role in neurodevelopmental problems often associated with IUGR children. In summary, we caused uteroplacental insufficiency and intrauterine growth retardation by performing bilateral uterine artery ligation upon pregnant rats 2 days prior to term delivery and elicited subsequent perinatal fetal hypoxia by placing maternal rats in 14% FiO 2 3 h prior to delivery. We found that a decrease in cerebral fetal Bcl-2 mRNA levels preceded significant increases in Bax mRNA, cerebral lipid peroxidation, and caspase-3 activity in response to a hypoxic insult. We speculate the immature

192

R.H. Lane et al. / Brain Research 895 (2001) 186 – 193

CNS lowers Bcl-2 gene expression in response to uteroplacental insufficiency and subsequently lowers the cerebral threshold towards apoptosis; this may be a protective mechanism to minimize the occurrence of necrosis in the event of a second stressful event such as hypoxia.

[14]

[15]

[16]

Acknowledgements This research was supported by NICHD Grant P30HD28836-05 (RHL), 1KO8BD01225-01 (RHL) and P30HD04612 (RHL) as well as the very generous support of the Magee Womens Hospital ‘25’ Club and Mental Retardation Research Center at UCLA. Sherin Devaskar is supported by NIH grants HD-33997 and HD-25024.

References [1] M. Arosio, D. Cortelazzi, L. Persanni, E. Palmeiri, G. Casati, A.M. Baggiani, G. Gambino, P. Beck-Peccoz, Circulating levels of growth hormone, insulin-like growth factor-1 and prolactin in normal, growth retarded, and anencephalic human fetuses, J. Endocrinol. Invest. 18 (1995) 346–353. [2] N.L. Baker, C. Russo, O. Bernard, A.J. D’Ercole, G.A. Werther, Interactions between bcl-2 and the IGF system control apoptosis in the developing mouse brain, Brain Res. Dev. Brain Res. 118 (1999) 109–118. [3] G. Ben-Haim, W.M. Armstead, Stimulus duration-dependent contribution of k(ca) channel activation and cAMP to hypoxic cerebrovasodilitation, Brain Res. 853 (2000) 330–337. [4] L. Bocconi, F. Mauro, S.E. Maddelena, C. De Iulio, A.S. Tirelli, E. Pace, U. Nicolini, Insulin-like growth factor I in controls and growth retarded fetuses, Fetal Diagn. Ther. 13 (1998) 192–196. [5] W.Y. Chan, D.T. Yew, Apoptosis and Bcl-2 oncoprotein expression in the human fetal central nervous system, Anat. Rec. 252 (1998) 165–175. [6] C. Carriaut-Marlangue, Y. Ben-Ari, A cautionary note on the use of the TUNEL stain to determine apoptosis, Neuroreport 7 (1995) 61–64. [7] S. Cianfarani, D. Germani, L. Rossi, G. Argiro, S. Boemi, M. Lemon, J.M. Holly, F. Branca, IGF-I and IGF-binding protein-1 are related to cortisol in human cord blood, Eur. J. Endocrinol. 138 (1998) 524–529. [8] P. Chomczynski, N. Sacchi, Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal. Biochem. 162 (1987) 156–159. [9] G. Dawson, Mechanisms of apoptosis in embryonic cortical neurons (E6 and E7) in culture involve lipid signaling, protein phosphorylation, and caspase activation, Int. J. Dev. Neurosci. 18 (2000) 247–257. [10] E. Dell’Anna, Y. Chen, E. Engidawork, K. Andersson, G. Lubec, J. Luthman, M. Herrera-Marshirtz, Delayed neuronal death following perinatal asphyxia in rat, Exp. Brain Res. 115 (1997) 105–115. [11] S.R. D’Mello, C. Galli, T. Ciotti, P. Calissano, Induction of apoptosis in cerebellar granule neurons by low potassium: inhibition of death by insulin growth factor I and cAMP, Proc. Natl. Acad. Sci. USA 90 (1993) 10989–10993. [12] D.L. Economides, K.H. Nicolaides, S. Campbell, Metabolic and endocrine findings in appropriate and small for gestation age fetuses, J. Perinat. Med. 19 (1991) 97–105. [13] A.D. Edwards, H. Mehmet, Apoptosis in perinatal hypoxic-is-

[17]

[18]

[19]

[20]

[21]

[22] [23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

chaemic cerebral damage, Neuropathol. Appl. Neurobiol. 22 (1996) 494–498. A.D. Edwards, X. Yue, P.L. Hope, D.V. Assopardi, M.V. Squier, H. Mehmet, Apoptosis in the brains of infants suffering intrauterine cerebral injury, Pediatr. Res. 42 (1997) 684–689. H. Esterbauer, K.H. Cheeseman, Determination of aldehydic lipid peroxidation products: malonaldehyde and 4-hydxoynonenal, Methods Enzymol. 186 (1990) 407–421. F. Gillardon, C. Lenz, K.F. Waschke, S. Krajewski, J.C. Reed, M. Zimmerman, W. Kuschinsky, Altered expression of Bcl-2, Bcl-X, Bax, and c-Fos colocalizes with DNA fragmentation and ischemic cell damage following middle cerebral artery occlusion in rats, Brain Res. Mol. Brain Res. 40 (1996) 254–260. F. Gillardon, H. Wickert, M. Zimmerman, Up-regulation of Bax and down regulation of Bcl-2 is associated with kainate-induced apoptosis in mouse brain, Neurosci. Lett. 192 (1995) 85–88. B. Grasl-Kraupp, B. Ruttkay-Nedecky, H. Koudelka, K. Bukowska, W. Bursch, R. Schulte-Hermann, In situ detection of fragmented DNA (TUNEL assay) fails to discriminate among apoptosis, necrosis, and autolytic cell death: a cautionary note, Hepatology 21 (1995) 1465–1468. J. Guan, C.E. Williams, S.J.M. Skinner, E.C. Mallard, P.D. Gluckman, The effects of insulin-like growth factor (IGF)-1, IGF-2, and des-IGF-1 on neuronal loss after hypoxic–ischemic brain injury in adult rats: evidence for a role for IGF binding proteins, Endocrinology 137 (1996) 893–898. D.M. Hockenbery, Z.N. Oltavi, X.M. Yin, C.L. Milliman, S.J. Korsmeyer, Bcl-2 function in an antioxidant pathway to prevent apoptosis, Cell 75 (1993) 241–251. S. Isenmann, G. Stoll, M. Schroeter, S. Krajewski, J.C. Reed, M. Bahr, Differential regulation of Bax, Bcl-2, and Bcl-X in focal cortical ischemia in the rat, Brain Pathol. 8 (1998) 49–63. M.D. Jacobson, M.C. Raff, Programmed cell death and Bcl-2 protection in very low oxygen, Nature 374 (1995) 814–816. R.U. Janicke, M.I. Sprengart, M.R. Wati, A.G. Porter, Caspase-3 is required for DNA fragmentation and morphological changes associated with apoptosis, J. Biol. Chem. 273 (1998) 9357–9360. J.M. Jurgensmeier, Z. Xie, Q. Devaraux, L. Ellerby, D. Bredesen, J.C. Reed, Bax directly induces release of cytochrome c from isolated mitochondria, Proc. Natl. Acad. Sci. USA 95 (1998) 4997– 5002. J.S. Korsmery, J.R. Shutter, D.J. Veis, D.E. Merry, Z.N. Oltavi, Bcl-2 / Bax: a rheostat that regulates an antioxidant pathway and cell death, Cancer Biol. 4 (1993) 327–332. R.H. Lane, A.K. Chandorkar, A.S. Flozak, R.A. Simmons, Intrauterine growth retardation alters mitochondrial gene expression and function in fetal and juvenile rat skeletal muscle, Pediatr. Res. 43 (1998) 563–570. R.H. Lane, S.E. Crawford, A.S. Flozak, R.A. Simmons, Localization and quantification of glucose transporters in liver of growth retarded fetal and neonatal rats, Am. J. Physiol. 276 (1999) E135–E142. R.H. Lane, A.S. Flozak, E.S. Ogata, G.I. Bell, R.A. Simmons, Altered hepatic gene expression of enzymes involved in energy metabolism in growth-retarded fetal rat, Pediatr. Res. 39 (1996) 390–394. R.H. Lane, A.S. Flozak, R.A. Simmons, Measurement of GLUT mRNA in liver of fetal and neonatal rats using a novel method of quantitative polymerase chain reaction, Biochem. Mol. Med. 59 (1996) 192–199. R.H. Lane, A.E. Tsirka, E.M. Gruetzmacher, Placental insufficiency alters cerebral mitochondrial gene expression and DNA in fetal and juvenile rats, Pediatr. Res. 47 (2000) 792–797. W. Li, X. Liu, Z. He, M. Yanoff, B. Jian, X. Ye, Expression of apoptosis regulatory genes by retinal pericytes after rapid glucose reduction, Invest. Opthalmol. Vis. Sci. 9 (1998) 1535–1543. X. Liu, X.Z. Zhu, Roles of p53, c-Myc, Bcl-2, Bax, and caspases in serum deprivation-induced neuronal apoptosis: a possible neuro-

R.H. Lane et al. / Brain Research 895 (2001) 186 – 193

[33]

[34]

[35]

[36]

[37]

[38]

[39] [40]

[41]

[42] [43] [44]

[45]

[46]

[47]

[48]

[49]

protective mechanism of basic fibroblast growth factor, Neuroreport 10 (1999) 3087–3091. J.A. Low, M.H. Handley-Derry, S.O. Burke, R.D. Peters, E.A. Pater, H.L. Killen, B.A. Derrick, Association of intrauterine fetal growth retardation and learning deficits at age 9 to 11 years, Am. J. Obstet. Gynecol. 167 (1992) 1499–1505. I. Marzo, C. Brenner, N. Zamzami, J.M. Jurgensmeier, S.A. Susin, H.L.A. Vieira, M.C. Prevost, Z. Xie, S. Matsuyama, J.C. Reed, G. Kroemer, Bax and adenine nucleotide translocator cooperate in the mitochondrial control of apoptosis, Science 281 (1998) 2027–2031. R. Matilainen, K. Heinonen, H. Siren-Tiusanen, V. Jokela, K. Launiala, Neurodevelopmental screening of in utero growth-retarded prematurely born children before school age, Eur. J. Pediatr. 146 (1987) 453–457. C. Minshall, S. Arkins, J. Straza, J. Conner, R. Dantzer, G.G. Fruend, K.W. Kelly, Il-4 and insulin like growth factor-I inhibit the decline of Bcl-2 and promote survival of Il-3 deprived myeloid progenitors, J. Immunol. 159 (1997) 1225–1232. J. Moran, T. Itoh, U.R. Reddy, M. Chen, E.S. Almenri, D. Pleasure, Caspase-3 expression by cerebellar granule neurons is regulated by calcium and cyclic AMP, J. Neurochem. 73 (1999) 568–577. K.H. Nicolaides, D.L. Economides, P.W. Soothill, Blood gases, pH, and lactate in appropriate and small for gestation age fetuses, Am. J. Obstet. Gynecol. 161 (1989) 996–1001. D.V. Novack, S.J. Korsmeyer, Bcl-2 protein expression during murine development, Am. J. Pathol. 145 (1994) 61–73. E.S. Ogata, M.E. Bussey, S. Finley, Altered gas exchange, limited glucose and branched chain amino acids and hypoinsulinism retard fetal growth in the rat, Metabolism 35 (1985) 970–977. Z.N. Oltvai, C.L. Milliman, S.J. Korsmeyer, Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death, Cell 74 (1993) 609–619. G.C. Palmer, Cyclic nucleotides in stroke and related cerebrovascular disorders, Life Sci. 36 (1985) 1995–2006. A.G. Porter, R.U. Janick, Emerging role of caspase-3 in apoptosis, Cell Death Differ. 6 (1999) 99–104. M.R. Pulera, L.M. Adams, H. Liu, D.G. Santos, R.N. Nishimura, F. Yang, G.M. Cole, C.G. Wasterlain, Apoptosis in a neonatal rat model of cerebral hypoxia–ischemia, Stroke 29 (1998) 2622–2630. M. Pourcyrous, H.S. Bada, W. Yang, H. Parfenova, S.P. Wong, S. Korones, C.W. Leffler, Prognostic significance of cerebrospinal fluid adenosine monophosphate in neonatal asphyxia, J. Pediatr. 134 (1999) 90–96. C. Richter, V. Gogvadze, R. Laffranchi, R. Schlapbach, M. Schweizer, M. Suter, P. Water, M. Yafee, Oxidants in mitochondria: from physiology to diseases, Biochim. Biophys. Acta 1271 (1995) 67–74. T. Rosse, R. Olivier, L. Monney, M. Rager, S. Conus, I. Fellay, B. Janesen, C. Borner, Bcl-2 prolongs cell survival after Bax-induced release of cytochrome C, Nature 391 (1998) 496–499. K.A. Roth, C.Y. Kuan, T.F. Haydar, C. D’Sa-Eipper, K.S. Shindler, T.S. Zheng, K. Kuida, R.A. Flavell, P. Rakic, Epistatic and independent functions of Caspase-3 and Bcl-X L in developmental programmed cell death, Proc. Natl. Acad. Sci. USA 97 (2000) 466–471. A. Saraste, Morphologic criteria and detection of apoptosis, Herz 24 (1999) 189–195.

193

[50] R.J. Scott, L. Hegyi, Cell death in perinatal hypoxic–ischemic brain injury, Neuropathol. Appl. Neurobiol. 23 (1997) 307–314. [51] S. Shinohamma, S. Fujimoto, Y. Sumida, H. Tanino, Differential expression of rat brain bcl-2 family proteins in developmental and aging, Biochem. Biophys. Res. Commun. 252 (1998) 92–96. [52] R.S. Sidhu, U.I. Tuor, M.R. Del Bigio, Nuclear condensation and fragmentation following cerebral hypoxia–ischemia occurs more frequently in immature than older rats, Neurosci. Lett. 223 (1997) 129–132. [53] M. Tagmi, K. Yamagata, Y. Nara, H. Jufino, A. Kubota, F. Numano, Y. Yamori, Insulin-like growth factors prevent apoptosis in cortical neurons isolated from stroke prone spontaneously hypertensive rats, Lab. Invest. 76 (1997) 603–612. [54] M. Tamataini, S. Ogawa, G. Nunez, M. Tohyamma, Growth factors prevent changes in Bcl-2 and Bax expression and neuronal apoptosis induced by nitric oxide, Cell Death Differ. 10 (1998) 911–919. [55] N.A. Thornberry, Y. Lazebnik, Caspases: enemies within, Science 281 (1998) 1312–1316. [56] S.A. Toms, A. Herchbergs, J. Liu, S. Kondo, T. Haqqi, G. Casey, K. Iwasai, G.H. Barnett, B.P. Barna, Antagonist effect of insulin-like growth factor I on protein kinase inhibitor-mediated apoptosis in human glioblastoma cells in association with bcl-2 and bcl-xL, J. Neurosurg. 88 (1998) 884–889. [57] T.G. Unterman, R.A. Simmons, R.P. Glick, E.S. Ogata, Circulating levels of insulin, insulin-like growth factor-I (IGF-I), IGF-II, and IGF-binding proteins in the small for gestational age fetal rat, Endocrinology 132 (1993) 327–336. [58] A. Valcamonico, L. Danti, T. Frusca, M. Soregaroli, S. Zucca, F. Abrami, A. Tiberti, Absent end-diastolic velocity in umbilical artery: risk of neonatal morbidity and brain damage, Am. J. Obstet. Gynecol. 170 (1994) 796–801. [59] Z.S. Vexler, T.P.L. Roberts, A.W. Bollen, N. Derugin, A.I. Arieff, Transient cerebral ischemia: association of apoptosis induction with hypoperfusion, J. Clin. Invest. 99 (1997) 1453–1459. [60] J. Villar, M. de Onis, E. Kestler, F. Bolanos, R. Cerezo, H. Bernedes, The differential neonatal morbidity of the intrauterine growth retardation syndrome, Am. J.Obstet. Gynecol. 163 (1990) 151–157. [61] J. Yank, X. Liu, K. Halla, C.N. Kim, A.M. Ibrado, J. Cai, T.I. Peng, D.P. Jones, X. Wang, Prevention of apoptosis by Bcl-2: release of cytochrome c from mitochondria blockade, Nature 275 (1997) 1129–1136. [62] M.J. Wilderman, W.M. Armstead, Role of PACAP in the relationship between cAMP and opioids in hypoxia-hypoxia induced pial artery vasodilatation, Am. J. Physiol. 272 (1997) H1350–1358. [63] X. Yue, H. Mahmet, J. Penrice, C. Cooper, E. Cady, J.S. Wyatt, E.O.R. Reynolds, A.D. Edwards, M.V. Squier, Apoptosis and necrosis in the newborn piglet brain following transient cerebral hypoxia–ischemia, Neuropathol. Appl. Neurobiol. 23 (1997) 16–25. [64] X. Zhao, B.R. Pike, J.K. Newcomb, K.K. Wang, R.M. Posmantur, R.L. Hayes, Maitotoxin induces calpain but not caspase-3 activation and necrotic cell death in primary septo-hippocampal cultures, Neurochem. Res. 24 (1999) 371–382. [65] L. Zhong, T. Sarafian, D.J. Kane, A.C. Charles, S.P. Mah, R.H. Edwards, D.E. Bredesen, Bcl-2 inhibits death of central neural cells induced by multiple agents, Proc. Natl. Acad. Sci. USA 90 (1993) 4533–4537.