- Email: [email protected]
Utility of Aspergillus niger citrate synthase promoter for heterologous expression
Journal of Biotechnology 155 (2011) 173–177
Contents lists available at ScienceDirect
Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec
Short communication
Utility of Aspergillus niger citrate synthase promoter for heterologous expression Kashyap Dave, Narayan S. Punekar ∗ Biotechnology Group, Department of Bioscience and Bioengineering, Indian Institute of Technology Bombay, Mumbai 400076, India
a r t i c l e
i n f o
Article history: Received 21 December 2010 Received in revised form 2 June 2011 Accepted 17 June 2011 Available online 23 June 2011 Keywords: Citrate synthase Fungal promoter Gene constructs Aspergillus niger Protein expression
a b s t r a c t Citrate synthase is a central player in the acidogenic metabolism of Aspergillus niger. The 5 upstream sequence (0.9 kb DNA) of citrate synthase gene (citA) from A. niger NCIM 565 was analyzed and its promoter function demonstrated through the heterologous expression of two proteins. The cloned citrate synthase promoter (PcitA) sequence was able to express bar coding sequence thereby conferring phosphinothricin resistance. This sequence was further analyzed by systematic deletions to define an effective but compact functional promoter. The PcitA driven egfp expression showed that PcitA was active in all differentiation cell-stages of A. niger. EGFP expression was highest on non-repressible carbon sources like acetate and glycerol. Mycelial EGFP levels increased during acidogenic growth suggesting that PcitA is functional throughout this cultivation. A. niger PcitA is the first Krebs cycle gene promoter used to express heterologous proteins in filamentous fungi. © 2011 Elsevier B.V. All rights reserved.
1. Introduction
2. Methods
Recent advances in genetic engineering tools (Meyer, 2008) have brought filamentous fungi in spotlight as protein production platforms. Endowed with high secretion capacity, good yields and favorable media requirements, Aspergilli are much sought after organisms for use (Lubertozzi and Keasling, 2009). Aspergillus niger is an industrially important citric acid producer (Papagianni, 2007). Well-tested fermentation processes and ‘generally regarded as safe’ status make it an attractive protein production host. Developing various components namely promoters, markers, reporters and a suitable host background (Fleissner and Dersch, 2010) therefore assume importance. Few strong filamentous fungal promoters like PglaA are available (Nagaraj et al., 2009; Fleissner and Dersch, 2010). Krebs cycle gene promoters are noticeable by their absence in expression strategies. In this context, we chose A. niger citrate synthase promoter (PcitA) and evaluated its potential for heterologous expression. A. niger PcitA was selected based on the following: (a) citrate synthase is a key enzyme for citrate formation, (b) its activity is found throughout the acidogenic growth of A. niger and hence PcitA is expected to display strong and constitutive expression, and (c) analysis of PcitA regulation is of broader interest in understanding fungal carbon metabolism. The promoter region of A. niger citA was cloned and characterized. Its function was evaluated by expressing a selection marker (bar) and a reporter (egfp).
2.1. Strains, media and culture conditions
∗ Corresponding author. Tel.: +91 022 2576 7775; fax: +91 022 2572 3480. E-mail address: [email protected] (N.S. Punekar). 0168-1656/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.jbiotec.2011.06.012
A. niger strain NCIM 565 (National Collection of Industrial Microorganisms, NCL-Pune, India) was used in this study. The bar maker from plasmid pCB1265 (Ahuja and Punekar, 2008) was employed to select A. niger transformants. The A. niger NCIM 565 strain was grown either on potato dextrose agar or on minimal medium (NM) agar (Ahuja and Punekar, 2008). Shake flask cultivation was carried out in citric acid producing medium (CPM) (Punekar et al., 1984). For selection of bar transformants, sterile yeast dextrose agar (YDA) medium was supplemented with 5 mM dl-phosphinothricin (PPT). 2.2. Construction of PcitA expression vectors The citA promoter region (867 bp sequence upstream to ATG) was PCR amplified using primers CitHF2 and CitPR1 (Table 1). This fragment was used to construct expression vectors pCBPFln (Fig. 1a) and pCBXCE (Fig. 1b). pCBXCE was designed for bar selection while PXcitA activity monitored through egfp expression. 2.3. Aspergillus niger transformation A. niger NCIM 565 mycelia grown in liquid NM (shake flasks for 16 h) were harvested on cheese cloth. Lysing enzyme (Sigma, L1412; at 10 mg ml−1 ) was used (at 37 ◦ C and up to 4 h) to release protoplasts from the mycelia. Transformation, selection of transformants and Southern analysis were performed as before (Ahuja and Punekar, 2008). Representative transformants were selected
174
K. Dave, N.S. Punekar / Journal of Biotechnology 155 (2011) 173–177
Table 1 List of primers used. Primers
Sequence
CitHF2 CitPR1 DHCitF1 DHCitF2 DHCitF3 BarXbR1 nspt3
gggaagcttgtgaccatgcaaatcagc ggtctgcagtctcaaggtggaagc cacaagctttacggatgagacggc ggcaagcttgagactagtgtgacc cataagcttggaacaccgtgcggc gctctagaaatctaaatctcggtgacgg aattaaccctcactaaaggg
for further analysis, based on their healthy growth and good conidiation. 3. Results and discussion Citrate synthase sequences from several fungi are known. Prior to the publication of its genome (Pel et al., 2007), citA gene from two different A. niger strains was studied (Kirimura et al., 1999; Ruijter et al., 2000). However their focus was on increasing citrate production and not the citA promoter. This is the first report demonstrating the promoter function of PcitA through the expression of two proteins namely, PPT-acetyltransferase and EGFP in A. niger. 3.1. PcitA is able to drive bar expression in A. niger The putative promoter region of citA gene from A. niger NCIM 565 (PcitA; 0.9 kb sequence upstream to ATG) was PCR amplified, cloned and sequenced on both strands. This sequence (GenBank Acc. No. HQ418220) was compared (ClustalW analysis) with relevant sequences available from four different A. niger strains – ATCC 9029 (Ruijter et al., 2000), WU-2223L (Kirimura et al., 1999), ATCC 1015 (chr 1 1:1569453-1571577, http://genome.jgipsf.org/Aspni5/Aspni5.home.html) and CBS 513.88 (GenBank Acc. No AM270988.1). While the sequence showed excellent identity with the three reported sequences, it differed maximally from the sequence of WU-2223L strain. Other putative citA-like sequences in the A. niger genome (Pel et al., 2007) with much lower identities may correspond to genes like methylcitrate synthase. The ability of 0.9 kb PcitA sequence to function as a promoter was evaluated through expression of bar CDS in A. niger NCIM 565. The PcitA-bar gene construct (linearized pCBFln) upon integration gave rise to PPT-resistant transformants (Fig. 2c). Resistant phenotype is indicative that PcitA sequence functions as a promoter. Also, the promoter activity of PcitA was directional with the
−−−→ construct PcitA-bar (forward orientation of PcitA sequence, pFCBP) alone being effective (Table S1). Efficient but compact promoters are desirable in the construction of expression cassettes. Four deletion constructs were designed (Fig. 2a) to further delimit the optimal promoter length of the PcitA sequence. All four bar expression cassettes were able to impart PPT-resistance to their respective transformants. They were characterized for corresponding PcitA-bar DNA integrations through diagnostic genomic PCR’s (Fig. 2b) and Southern analysis (not shown). Reporters like -glucuronidase (Hisada et al., 2006) and -galactosidase (Punt et al., 1990) are normally employed in promoter deletion analysis. The present work however made use of bar selection marker for this purpose. Although single copy integrants were available for all five PcitA cassettes, they are expected to be random integrations. Further promoter strength comparison is feasible only with single copy integrations at a predefined locus (Nayak et al., 2006). Ability of the short 121 bp A. niger PcitA fragment (PcitAF3) to express bar CDS was interesting (Fig. 2). The 5 upstream sequences of enoA (224 bp) (Toda et al., 2001), sodM (200 bp) (Hisada et al., 2006) and crp (188 bp) (Kwon et al., 2009) are some of the shortest DNA fragments with demonstrated promoter activity. PcitAF3 is thus the shortest DNA sequence with demonstrated fungal promoter activity to date; only two CT-rich nucleotide stretches (beginning at −84 and −37 positions) occur in this fragment. CTrich nucleotide stretches are an important feature of constitutive fungal promoters (Hamer and Timberlake, 1987; Punt et al., 1990; Chen and Roxby, 1997). A long CT box also occurs (at −105 to −43) in citA of Aspergillus nidulans (Min et al., 2010). Three short conserved stretches (ClustalW analysis; Fig. 3) were found by comparing PcitA sequences (1.0 kb upstream to ATG) from different Aspergilli (Jones, 2007). These conserved elements, located between −187 and −136 from ATG (A as +1) of A. niger citA gene, suggest a possible common cis regulatory feature of PcitA. 3.2. Evaluation of PXcitA function through EGFP expression PXcitA was chosen to express EGFP in A. niger since it was compact (with 0.5 kb of PcitA sequence) and provided best transformation efficiency (2.5 per g DNA; Table S1). The PXcitA-egfp expression cassette was used to transform A. niger and PPT resistant transformants were selected as before. Colony fluorescence (long UV, 365 nm) due to expressed EGFP served as a secondary screen. Out of 33 bar transformants 24 were fluorescent; both single and multi copy integrants were detected. A single copy integrant (C6JT2, confirmed by genomic PCR and Southern analysis) showed
Fig. 1. PcitA plasmid constructs to drive the expression of bar and egfp CDS. (a) The bar CDS was cloned in frame with PcitA in pBS KS (pCBPFln). (b) PXcitA and egfp cDNA along with Tgla (A. awamori glucoamylase terminator) (Vanden Wymelenberg et al., 1997), were cloned in frame in pCB1265 to obtain pCBXCE.
K. Dave, N.S. Punekar / Journal of Biotechnology 155 (2011) 173–177
175
Fig. 2. Characterization of various PcitA deletion transformants. (a) Schematic of PcitA-bar constructs showing various PcitA deletions. To constructs pDHCBPF1, pDHCBPF2 and pDHCBPF3 through PCR, the primer CitPR1 was paired respectively with DHCitF1, DHCitF2 and DHCitF3 (Table 1). In the fourth construct (pXCBP) XhoI fragment was deleted from pCBPFln. (b) Genomic PCR of different PcitA-bar transformants. Five forward primers (CitHF2, DHCitF1, nspt3, DHCitF2, DHCitF3) were used individually with BarXbR1 (reverse primer). PCR with pCBPFln DNA served as control (Lane 1). PCR products from genomic DNAs of A. niger NCIM 565 (Lane 2) and of transformants corresponding to gene constructs PcitAFln-bar (Lane 3), PcitAF1-bar (Lane 4), PXcitA-bar (Lane 5), PcitAF2-bar (Lane 6), PcitAF3-bar (Lane 7) are shown. Lane 8 contains 1 kb DNA ladder. (c) Transformants (after four passages on bar selection plates) resulting from gene constructs namely – PcitAFln-bar, PcitAF1-bar, PXcitA-bar, PcitAF2-bar, PcitAF3-bar – are shown. A. niger NCIM 565 (B) and a single copy bar transformant (A) characterized earlier were controls.
Fig. 3. Three conserved stretches found in the putative promoter regions of citA gene from seven Aspergilli.
bright EGFP fluorescence throughout its mycelia, conidiophores, primary and secondary sterigmata and conidia (Fig. 4). This generalized EGFP expression suggests that citA promoter is active in all differentiated cells and stages of A. niger life cycle. However, when gfp CDS was fused in-frame with citA mitochondrial targeting sig-
nal, the expressed protein was preferentially localized to A. nidulans mitochondria (Murray and Hynes, 2010; Min et al., 2010). The transformant C6JT2 was used to evaluate PXcitA function through EGFP expression. Growth of strain C6JT2 and the parent A. niger NCIM 565 was comparable on different carbon and nitro-
Fig. 4. Fluorescence and bright field images of A. niger (C6JT2 strain) mycelia. Mycelial EGFP fluorescence was captured with FITC filter (a) and the bright field image (b) on a fluorescence microscope (Nikon ECLIPSE TE2000-U) with 40× objective. Images (scale bar, 10 m) were captured using CoolSNAP-Pro camera (and ImageJ software).
176
K. Dave, N.S. Punekar / Journal of Biotechnology 155 (2011) 173–177
Table 2 EGFP expression in A. niger (C6JT2 strain) grown on various carbon sources. Carbon sourcea Glucose Starch + glucose Sucrose Molasses (cane) Acetate Glycerol
RFU mg−1 of proteinb 5000 3500 7000 1750 68,800 15,700
pH at the time of harvest 3.1 2.3 3.3 4.3 6.3 5.5
a All carbon sources in NM were used at 1% (w/v) except with starch + glucose (both at 1% each). The initial pH of the medium was adjusted to 5.5. Cells were harvested after 24 h of growth; but for acetate and glycerol this was after 48 h. b A. niger mycelia were extracted (Noor and Punekar, 2005) with EGFP extraction buffer (100 mM Tris–Cl pH 8.0, 50 mM MgCl2 , 25% glycerol, 1.0 mM 2mercaptoethanol). The buffer also included 1.0 mM PMSF (phenylmethylsulfonyl fluoride), TLCK (N␣-Tosyl-l-lysine choloromethyl ketone; 1.0 g ml−1 ) and TPCK (N-p-Tosyl-l-phenylalanine chloromethyl ketone; 0.5 g ml−1 ). EGFP fluorescence measurements (excitation at 488 nm and emission at 510 nm; Shimadzu, RF-530 PC series, with version 2.04 of fluorescence spectroscopy software) were made in 20 mM HEPES buffer at pH 8.0. EGFP concentrations were calculated in relative fluorescence intensity unit (RFU) per mg of total protein. Fluorescence data representative of three independent experiments and the variation between duplicates was less than 10%. No EGFP fluorescence was detected in parent, A. niger NCIM 565.
gen sources. Both grew very poorly on starch and grew slowly on glycerol and acetate. No growth was observed when ethanol or glutamate was the sole carbon source. In terms of mycelial EGFP levels, PXcitA was functional on all the carbon and nitrogen sources that supported growth of strain C6JT2. Specific EGFP expression was generally higher on non-repressing carbon sources like acetate or glycerol (Table 2). High EGFP levels on acetate (versus glucose) suggest that PcitA may be subject to glucose repression in A. niger. Starvation/stress induction of PXcitA could also possibly explain this effect with medium pH being another relevant parameter. These however need further study. Two very recent reports on citA transcription implicate a role for glucose repression in A. nidulans (Murray and Hynes, 2010; Min et al., 2010). Comparable EGFP expression (in the range of 4500–11,000 RFU mg−1 of protein) was observed when C6JT2 strain was grown on NM but containing different nitrogen sources (NH4 NO3 , arginine, glutamine, ornithine, proline and glutamate; all at equimolar N corresponding to 28 mM of NH4 NO3 ). The final pH of the medium with different N-sources ranged between 3.1 and 5.5. EGFP expression in C6JT2 strain provided a convenient handle to address PcitA function and regulation during acidogenic growth of A. niger. Growth of strain C6JT2 and A. niger NCIM 565 was com-
Fig. 5. EGFP expression and citrate formation in the A. niger strain C6JT2 grown on normal and citric acid production media. Fluorescence was measured in crude extracts of mycelia grown on NM (䊉) and CPM (). Specific RFUs shown are representative of three independent experiments. Citrate lyase was used to measure citrate (Petrarulo et al., 1995) in the spent medium after growth on NM () and CPM (); data is representative of triplicates from two independent experiments.
parable both on NM and on CPM. EGFP levels (in RFU mg−1 of protein) declined with time and this correlated well with the initiation of conidiation on NM. EGFP was found in C6JT2 mycelia when cultivated on CPM and its levels increased with time (Fig. 5). Continued presence of citrate synthase enzyme activity during acidogenic growth is already described (Kubicek and Rohr, 1980). Functioning of PXcitA throughout acidogenic growth is suggested by the levels of EGFP found in C6JT2 strain. Performance of PcitA during growth on CPM forms an additional yet valuable indicator. In summary, we have cloned and functionally characterized the promoter region of citrate synthase gene from A. niger NCIM 565. PcitA is thereby added to the repertoire of fungal promoters. This is the first report of a Krebs cycle gene promoter expressing heterologous proteins in filamentous fungi. In principle, it may be exploited both in normal and in acidogenic growth conditions. Acknowledgements Bayer Crop-Science is gratefully acknowledged for providing glufosinate ammonium (PPT). This research was funded by the New Millennium Indian Technology Leadership Initiative of Council of Scientific and Industrial Research (NMITLI-CSIR), India and forms a part of Indian Patent application (No. 2542/MUM/2009). Kashyap Dave was supported by a University Grants Commission (UGC) research fellowship. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.jbiotec.2011.06.012. References Ahuja, M., Punekar, N.S., 2008. Phosphinothricin resistance in Aspergillus niger and its utility as a selectable transformation marker. Fungal Genet. Biol. 45, 1103–1110. Chen, Y., Roxby, R., 1997. Identification of a functional CT-element in the Phytophthora infestans piypt1 gene promoter. Gene 198, 159–164. Fleissner, A., Dersch, P., 2010. Expression and export: recombinant protein production systems for Aspergillus. Appl. Microbiol. Biotechnol. 87, 1255–1270. Hamer, J.E., Timberlake, W.E., 1987. Functional organization of the Aspergillus nidulans trpC promoter. Mol. Cell. Biol. 7, 2352–2359. Hisada, H., Sano, M., Ishida, H., Hata, Y., Abe, Y., Machida, M., 2006. Deletion analysis of the superoxide dismutase (sodM) promoter from Aspergillus oryzae. Appl. Microbiol. Biotechnol. 72, 1048–1053. Jones, M.G., 2007. The first filamentous fungal genome sequences: Aspergillus leads the way for essential everyday resources or dusty museum specimens? Microbiology 153, 1–6. Kirimura, K., Yoda, M., Ko, I., Oshida, Y., Miyake, K., Usami, S., 1999. Cloning and sequencing of the chromosomal DNA and cDNA encoding the mitochondrial citrate synthase of Aspergillus niger WU-2223L. J. Biosci. Bioeng. 88, 237–243. Kubicek, C.P., Rohr, M., 1980. Regulation of citrate synthase from the citric acidaccumulating fungus, Aspergillus niger. Biochim. Biophys. Acta 615, 449–457. Kwon, B.R., Kim, M.J., Park, J.A., Chung, H.J., Kim, J.M., Park, S.M., Yun, S.H., Yang, M.S., Kim, D.H., 2009. Assessment of the core cryparin promoter from Cryphonectria parasitica for heterologous expression in filamentous fungi. Appl. Microbiol. Biotechnol. 83, 339–348. Lubertozzi, D., Keasling, J.D., 2009. Developing Aspergillus as a host for heterologous expression. Biotechnol. Adv. 27, 53–75. Meyer, V., 2008. Genetic engineering of filamentous fungi-progress, obstacles and future trends. Biotechnol. Adv. 26, 177–185. Min, I.S., Bang, J.Y., Seo, S.W., Lee, C.H., Maeng, P.J., 2010. Differential expression of citA gene encoding the mitochondrial citrate synthase of Aspergillus nidulans in response to developmental status and carbon sources. J. Microbiol. 48, 188–198. Murray, S.L., Hynes, M.J., 2010. Metabolic and developmental effects resulting from deletion of the citA gene encoding citrate synthase in Aspergillus nidulans. Eukaryot. Cell 9, 656–666. Nagaraj, G., Dave, K., Sastry, K.N., Punekar, N.S., 2009. Yeasts and filamentous fungi as hosts for recombinant protein production. In: Ravishankar, R.V., Bhat, R. (Eds.), Biotechnology: Concepts and Applications. Narosa Publishing House, New Delhi, pp. 183–221. Nayak, T., Szewczyk, E., Oakley, C.E., Osmani, A., Ukil, L., Murray, S.L., Hynes, M.J., Osmani, S.A., Oakley, B.R., 2006. A versatile and efficient gene-targeting system for Aspergillus nidulans. Genetics 172, 1557–1566. Noor, S., Punekar, N.S., 2005. Allosteric NADP-glutamate dehydrogenase from aspergilli: purification, characterization and implications for metabolic regulation at the carbon–nitrogen interface. Microbiology 151, 1409–1419.
K. Dave, N.S. Punekar / Journal of Biotechnology 155 (2011) 173–177 Papagianni, M., 2007. Advances in citric acid fermentation by Aspergillus niger: biochemical aspects, membrane transport and modeling. Biotechnol. Adv. 25, 244–263. Pel, H.J., et al., 2007. Genome sequencing and analysis of the versatile cell factory Aspergillus niger CBS 513.88. Nat. Biotechnol. 25, 221–231. Petrarulo, M., Facchini, P., Cerelli, E., Marangella, M., Linari, F., 1995. Citrate in urine determined with a new citrate lyase method. Clin. Chem. 41, 1518–1521. Punekar, N.S., Vaidyanathan, C.S., Appaji Rao, N., 1984. Mechanisms of citric acid fermentation by Aspergillus niger. J. Sci. Ind. Res. 43, 398–404. Punt, P.J., Dingemanse, M.A., Kuyvenhoven, A., Soede, R.D., Pouwels, P.H., van den Hondel, C.A., 1990. Functional elements in the promoter region of the
177
Aspergillus nidulans gpdA gene encoding glyceraldehyde-3-phosphate dehydrogenase. Gene 93, 101–109. Ruijter, G.J., Panneman, H., Xu, D., Visser, J., 2000. Properties of Aspergillus niger citrate synthase and effects of citA overexpression on citric acid production. FEMS Microbiol. Lett. 184, 35–40. Toda, T., Sano, M., Honda, M., Rimoldi, O.J., Yang, Y., Yamamoto, M., Takase, K., Hirozumi, K., Kitamoto, K., Minetoki, T., Gomi, K., Machida, M., 2001. Deletion analysis of the enolase gene (enoA) promoter from the filamentous fungus Aspegillus oryzae. Curr. Genet. 40, 260–267. Vanden Wymelenberg, A.J., Cullen, D., Spear, R.N., Schoenike, B., Andrews, J.H., 1997. Expression of green fluorescent protein in Aureobasidium pullulans and quantification of the fungus on leaf surfaces. Biotechniques 23, 686–690.
Contents lists available at ScienceDirect
Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec
Short communication
Utility of Aspergillus niger citrate synthase promoter for heterologous expression Kashyap Dave, Narayan S. Punekar ∗ Biotechnology Group, Department of Bioscience and Bioengineering, Indian Institute of Technology Bombay, Mumbai 400076, India
a r t i c l e
i n f o
Article history: Received 21 December 2010 Received in revised form 2 June 2011 Accepted 17 June 2011 Available online 23 June 2011 Keywords: Citrate synthase Fungal promoter Gene constructs Aspergillus niger Protein expression
a b s t r a c t Citrate synthase is a central player in the acidogenic metabolism of Aspergillus niger. The 5 upstream sequence (0.9 kb DNA) of citrate synthase gene (citA) from A. niger NCIM 565 was analyzed and its promoter function demonstrated through the heterologous expression of two proteins. The cloned citrate synthase promoter (PcitA) sequence was able to express bar coding sequence thereby conferring phosphinothricin resistance. This sequence was further analyzed by systematic deletions to define an effective but compact functional promoter. The PcitA driven egfp expression showed that PcitA was active in all differentiation cell-stages of A. niger. EGFP expression was highest on non-repressible carbon sources like acetate and glycerol. Mycelial EGFP levels increased during acidogenic growth suggesting that PcitA is functional throughout this cultivation. A. niger PcitA is the first Krebs cycle gene promoter used to express heterologous proteins in filamentous fungi. © 2011 Elsevier B.V. All rights reserved.
1. Introduction
2. Methods
Recent advances in genetic engineering tools (Meyer, 2008) have brought filamentous fungi in spotlight as protein production platforms. Endowed with high secretion capacity, good yields and favorable media requirements, Aspergilli are much sought after organisms for use (Lubertozzi and Keasling, 2009). Aspergillus niger is an industrially important citric acid producer (Papagianni, 2007). Well-tested fermentation processes and ‘generally regarded as safe’ status make it an attractive protein production host. Developing various components namely promoters, markers, reporters and a suitable host background (Fleissner and Dersch, 2010) therefore assume importance. Few strong filamentous fungal promoters like PglaA are available (Nagaraj et al., 2009; Fleissner and Dersch, 2010). Krebs cycle gene promoters are noticeable by their absence in expression strategies. In this context, we chose A. niger citrate synthase promoter (PcitA) and evaluated its potential for heterologous expression. A. niger PcitA was selected based on the following: (a) citrate synthase is a key enzyme for citrate formation, (b) its activity is found throughout the acidogenic growth of A. niger and hence PcitA is expected to display strong and constitutive expression, and (c) analysis of PcitA regulation is of broader interest in understanding fungal carbon metabolism. The promoter region of A. niger citA was cloned and characterized. Its function was evaluated by expressing a selection marker (bar) and a reporter (egfp).
2.1. Strains, media and culture conditions
∗ Corresponding author. Tel.: +91 022 2576 7775; fax: +91 022 2572 3480. E-mail address: [email protected] (N.S. Punekar). 0168-1656/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.jbiotec.2011.06.012
A. niger strain NCIM 565 (National Collection of Industrial Microorganisms, NCL-Pune, India) was used in this study. The bar maker from plasmid pCB1265 (Ahuja and Punekar, 2008) was employed to select A. niger transformants. The A. niger NCIM 565 strain was grown either on potato dextrose agar or on minimal medium (NM) agar (Ahuja and Punekar, 2008). Shake flask cultivation was carried out in citric acid producing medium (CPM) (Punekar et al., 1984). For selection of bar transformants, sterile yeast dextrose agar (YDA) medium was supplemented with 5 mM dl-phosphinothricin (PPT). 2.2. Construction of PcitA expression vectors The citA promoter region (867 bp sequence upstream to ATG) was PCR amplified using primers CitHF2 and CitPR1 (Table 1). This fragment was used to construct expression vectors pCBPFln (Fig. 1a) and pCBXCE (Fig. 1b). pCBXCE was designed for bar selection while PXcitA activity monitored through egfp expression. 2.3. Aspergillus niger transformation A. niger NCIM 565 mycelia grown in liquid NM (shake flasks for 16 h) were harvested on cheese cloth. Lysing enzyme (Sigma, L1412; at 10 mg ml−1 ) was used (at 37 ◦ C and up to 4 h) to release protoplasts from the mycelia. Transformation, selection of transformants and Southern analysis were performed as before (Ahuja and Punekar, 2008). Representative transformants were selected
174
K. Dave, N.S. Punekar / Journal of Biotechnology 155 (2011) 173–177
Table 1 List of primers used. Primers
Sequence
CitHF2 CitPR1 DHCitF1 DHCitF2 DHCitF3 BarXbR1 nspt3
gggaagcttgtgaccatgcaaatcagc ggtctgcagtctcaaggtggaagc cacaagctttacggatgagacggc ggcaagcttgagactagtgtgacc cataagcttggaacaccgtgcggc gctctagaaatctaaatctcggtgacgg aattaaccctcactaaaggg
for further analysis, based on their healthy growth and good conidiation. 3. Results and discussion Citrate synthase sequences from several fungi are known. Prior to the publication of its genome (Pel et al., 2007), citA gene from two different A. niger strains was studied (Kirimura et al., 1999; Ruijter et al., 2000). However their focus was on increasing citrate production and not the citA promoter. This is the first report demonstrating the promoter function of PcitA through the expression of two proteins namely, PPT-acetyltransferase and EGFP in A. niger. 3.1. PcitA is able to drive bar expression in A. niger The putative promoter region of citA gene from A. niger NCIM 565 (PcitA; 0.9 kb sequence upstream to ATG) was PCR amplified, cloned and sequenced on both strands. This sequence (GenBank Acc. No. HQ418220) was compared (ClustalW analysis) with relevant sequences available from four different A. niger strains – ATCC 9029 (Ruijter et al., 2000), WU-2223L (Kirimura et al., 1999), ATCC 1015 (chr 1 1:1569453-1571577, http://genome.jgipsf.org/Aspni5/Aspni5.home.html) and CBS 513.88 (GenBank Acc. No AM270988.1). While the sequence showed excellent identity with the three reported sequences, it differed maximally from the sequence of WU-2223L strain. Other putative citA-like sequences in the A. niger genome (Pel et al., 2007) with much lower identities may correspond to genes like methylcitrate synthase. The ability of 0.9 kb PcitA sequence to function as a promoter was evaluated through expression of bar CDS in A. niger NCIM 565. The PcitA-bar gene construct (linearized pCBFln) upon integration gave rise to PPT-resistant transformants (Fig. 2c). Resistant phenotype is indicative that PcitA sequence functions as a promoter. Also, the promoter activity of PcitA was directional with the
−−−→ construct PcitA-bar (forward orientation of PcitA sequence, pFCBP) alone being effective (Table S1). Efficient but compact promoters are desirable in the construction of expression cassettes. Four deletion constructs were designed (Fig. 2a) to further delimit the optimal promoter length of the PcitA sequence. All four bar expression cassettes were able to impart PPT-resistance to their respective transformants. They were characterized for corresponding PcitA-bar DNA integrations through diagnostic genomic PCR’s (Fig. 2b) and Southern analysis (not shown). Reporters like -glucuronidase (Hisada et al., 2006) and -galactosidase (Punt et al., 1990) are normally employed in promoter deletion analysis. The present work however made use of bar selection marker for this purpose. Although single copy integrants were available for all five PcitA cassettes, they are expected to be random integrations. Further promoter strength comparison is feasible only with single copy integrations at a predefined locus (Nayak et al., 2006). Ability of the short 121 bp A. niger PcitA fragment (PcitAF3) to express bar CDS was interesting (Fig. 2). The 5 upstream sequences of enoA (224 bp) (Toda et al., 2001), sodM (200 bp) (Hisada et al., 2006) and crp (188 bp) (Kwon et al., 2009) are some of the shortest DNA fragments with demonstrated promoter activity. PcitAF3 is thus the shortest DNA sequence with demonstrated fungal promoter activity to date; only two CT-rich nucleotide stretches (beginning at −84 and −37 positions) occur in this fragment. CTrich nucleotide stretches are an important feature of constitutive fungal promoters (Hamer and Timberlake, 1987; Punt et al., 1990; Chen and Roxby, 1997). A long CT box also occurs (at −105 to −43) in citA of Aspergillus nidulans (Min et al., 2010). Three short conserved stretches (ClustalW analysis; Fig. 3) were found by comparing PcitA sequences (1.0 kb upstream to ATG) from different Aspergilli (Jones, 2007). These conserved elements, located between −187 and −136 from ATG (A as +1) of A. niger citA gene, suggest a possible common cis regulatory feature of PcitA. 3.2. Evaluation of PXcitA function through EGFP expression PXcitA was chosen to express EGFP in A. niger since it was compact (with 0.5 kb of PcitA sequence) and provided best transformation efficiency (2.5 per g DNA; Table S1). The PXcitA-egfp expression cassette was used to transform A. niger and PPT resistant transformants were selected as before. Colony fluorescence (long UV, 365 nm) due to expressed EGFP served as a secondary screen. Out of 33 bar transformants 24 were fluorescent; both single and multi copy integrants were detected. A single copy integrant (C6JT2, confirmed by genomic PCR and Southern analysis) showed
Fig. 1. PcitA plasmid constructs to drive the expression of bar and egfp CDS. (a) The bar CDS was cloned in frame with PcitA in pBS KS (pCBPFln). (b) PXcitA and egfp cDNA along with Tgla (A. awamori glucoamylase terminator) (Vanden Wymelenberg et al., 1997), were cloned in frame in pCB1265 to obtain pCBXCE.
K. Dave, N.S. Punekar / Journal of Biotechnology 155 (2011) 173–177
175
Fig. 2. Characterization of various PcitA deletion transformants. (a) Schematic of PcitA-bar constructs showing various PcitA deletions. To constructs pDHCBPF1, pDHCBPF2 and pDHCBPF3 through PCR, the primer CitPR1 was paired respectively with DHCitF1, DHCitF2 and DHCitF3 (Table 1). In the fourth construct (pXCBP) XhoI fragment was deleted from pCBPFln. (b) Genomic PCR of different PcitA-bar transformants. Five forward primers (CitHF2, DHCitF1, nspt3, DHCitF2, DHCitF3) were used individually with BarXbR1 (reverse primer). PCR with pCBPFln DNA served as control (Lane 1). PCR products from genomic DNAs of A. niger NCIM 565 (Lane 2) and of transformants corresponding to gene constructs PcitAFln-bar (Lane 3), PcitAF1-bar (Lane 4), PXcitA-bar (Lane 5), PcitAF2-bar (Lane 6), PcitAF3-bar (Lane 7) are shown. Lane 8 contains 1 kb DNA ladder. (c) Transformants (after four passages on bar selection plates) resulting from gene constructs namely – PcitAFln-bar, PcitAF1-bar, PXcitA-bar, PcitAF2-bar, PcitAF3-bar – are shown. A. niger NCIM 565 (B) and a single copy bar transformant (A) characterized earlier were controls.
Fig. 3. Three conserved stretches found in the putative promoter regions of citA gene from seven Aspergilli.
bright EGFP fluorescence throughout its mycelia, conidiophores, primary and secondary sterigmata and conidia (Fig. 4). This generalized EGFP expression suggests that citA promoter is active in all differentiated cells and stages of A. niger life cycle. However, when gfp CDS was fused in-frame with citA mitochondrial targeting sig-
nal, the expressed protein was preferentially localized to A. nidulans mitochondria (Murray and Hynes, 2010; Min et al., 2010). The transformant C6JT2 was used to evaluate PXcitA function through EGFP expression. Growth of strain C6JT2 and the parent A. niger NCIM 565 was comparable on different carbon and nitro-
Fig. 4. Fluorescence and bright field images of A. niger (C6JT2 strain) mycelia. Mycelial EGFP fluorescence was captured with FITC filter (a) and the bright field image (b) on a fluorescence microscope (Nikon ECLIPSE TE2000-U) with 40× objective. Images (scale bar, 10 m) were captured using CoolSNAP-Pro camera (and ImageJ software).
176
K. Dave, N.S. Punekar / Journal of Biotechnology 155 (2011) 173–177
Table 2 EGFP expression in A. niger (C6JT2 strain) grown on various carbon sources. Carbon sourcea Glucose Starch + glucose Sucrose Molasses (cane) Acetate Glycerol
RFU mg−1 of proteinb 5000 3500 7000 1750 68,800 15,700
pH at the time of harvest 3.1 2.3 3.3 4.3 6.3 5.5
a All carbon sources in NM were used at 1% (w/v) except with starch + glucose (both at 1% each). The initial pH of the medium was adjusted to 5.5. Cells were harvested after 24 h of growth; but for acetate and glycerol this was after 48 h. b A. niger mycelia were extracted (Noor and Punekar, 2005) with EGFP extraction buffer (100 mM Tris–Cl pH 8.0, 50 mM MgCl2 , 25% glycerol, 1.0 mM 2mercaptoethanol). The buffer also included 1.0 mM PMSF (phenylmethylsulfonyl fluoride), TLCK (N␣-Tosyl-l-lysine choloromethyl ketone; 1.0 g ml−1 ) and TPCK (N-p-Tosyl-l-phenylalanine chloromethyl ketone; 0.5 g ml−1 ). EGFP fluorescence measurements (excitation at 488 nm and emission at 510 nm; Shimadzu, RF-530 PC series, with version 2.04 of fluorescence spectroscopy software) were made in 20 mM HEPES buffer at pH 8.0. EGFP concentrations were calculated in relative fluorescence intensity unit (RFU) per mg of total protein. Fluorescence data representative of three independent experiments and the variation between duplicates was less than 10%. No EGFP fluorescence was detected in parent, A. niger NCIM 565.
gen sources. Both grew very poorly on starch and grew slowly on glycerol and acetate. No growth was observed when ethanol or glutamate was the sole carbon source. In terms of mycelial EGFP levels, PXcitA was functional on all the carbon and nitrogen sources that supported growth of strain C6JT2. Specific EGFP expression was generally higher on non-repressing carbon sources like acetate or glycerol (Table 2). High EGFP levels on acetate (versus glucose) suggest that PcitA may be subject to glucose repression in A. niger. Starvation/stress induction of PXcitA could also possibly explain this effect with medium pH being another relevant parameter. These however need further study. Two very recent reports on citA transcription implicate a role for glucose repression in A. nidulans (Murray and Hynes, 2010; Min et al., 2010). Comparable EGFP expression (in the range of 4500–11,000 RFU mg−1 of protein) was observed when C6JT2 strain was grown on NM but containing different nitrogen sources (NH4 NO3 , arginine, glutamine, ornithine, proline and glutamate; all at equimolar N corresponding to 28 mM of NH4 NO3 ). The final pH of the medium with different N-sources ranged between 3.1 and 5.5. EGFP expression in C6JT2 strain provided a convenient handle to address PcitA function and regulation during acidogenic growth of A. niger. Growth of strain C6JT2 and A. niger NCIM 565 was com-
Fig. 5. EGFP expression and citrate formation in the A. niger strain C6JT2 grown on normal and citric acid production media. Fluorescence was measured in crude extracts of mycelia grown on NM (䊉) and CPM (). Specific RFUs shown are representative of three independent experiments. Citrate lyase was used to measure citrate (Petrarulo et al., 1995) in the spent medium after growth on NM () and CPM (); data is representative of triplicates from two independent experiments.
parable both on NM and on CPM. EGFP levels (in RFU mg−1 of protein) declined with time and this correlated well with the initiation of conidiation on NM. EGFP was found in C6JT2 mycelia when cultivated on CPM and its levels increased with time (Fig. 5). Continued presence of citrate synthase enzyme activity during acidogenic growth is already described (Kubicek and Rohr, 1980). Functioning of PXcitA throughout acidogenic growth is suggested by the levels of EGFP found in C6JT2 strain. Performance of PcitA during growth on CPM forms an additional yet valuable indicator. In summary, we have cloned and functionally characterized the promoter region of citrate synthase gene from A. niger NCIM 565. PcitA is thereby added to the repertoire of fungal promoters. This is the first report of a Krebs cycle gene promoter expressing heterologous proteins in filamentous fungi. In principle, it may be exploited both in normal and in acidogenic growth conditions. Acknowledgements Bayer Crop-Science is gratefully acknowledged for providing glufosinate ammonium (PPT). This research was funded by the New Millennium Indian Technology Leadership Initiative of Council of Scientific and Industrial Research (NMITLI-CSIR), India and forms a part of Indian Patent application (No. 2542/MUM/2009). Kashyap Dave was supported by a University Grants Commission (UGC) research fellowship. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.jbiotec.2011.06.012. References Ahuja, M., Punekar, N.S., 2008. Phosphinothricin resistance in Aspergillus niger and its utility as a selectable transformation marker. Fungal Genet. Biol. 45, 1103–1110. Chen, Y., Roxby, R., 1997. Identification of a functional CT-element in the Phytophthora infestans piypt1 gene promoter. Gene 198, 159–164. Fleissner, A., Dersch, P., 2010. Expression and export: recombinant protein production systems for Aspergillus. Appl. Microbiol. Biotechnol. 87, 1255–1270. Hamer, J.E., Timberlake, W.E., 1987. Functional organization of the Aspergillus nidulans trpC promoter. Mol. Cell. Biol. 7, 2352–2359. Hisada, H., Sano, M., Ishida, H., Hata, Y., Abe, Y., Machida, M., 2006. Deletion analysis of the superoxide dismutase (sodM) promoter from Aspergillus oryzae. Appl. Microbiol. Biotechnol. 72, 1048–1053. Jones, M.G., 2007. The first filamentous fungal genome sequences: Aspergillus leads the way for essential everyday resources or dusty museum specimens? Microbiology 153, 1–6. Kirimura, K., Yoda, M., Ko, I., Oshida, Y., Miyake, K., Usami, S., 1999. Cloning and sequencing of the chromosomal DNA and cDNA encoding the mitochondrial citrate synthase of Aspergillus niger WU-2223L. J. Biosci. Bioeng. 88, 237–243. Kubicek, C.P., Rohr, M., 1980. Regulation of citrate synthase from the citric acidaccumulating fungus, Aspergillus niger. Biochim. Biophys. Acta 615, 449–457. Kwon, B.R., Kim, M.J., Park, J.A., Chung, H.J., Kim, J.M., Park, S.M., Yun, S.H., Yang, M.S., Kim, D.H., 2009. Assessment of the core cryparin promoter from Cryphonectria parasitica for heterologous expression in filamentous fungi. Appl. Microbiol. Biotechnol. 83, 339–348. Lubertozzi, D., Keasling, J.D., 2009. Developing Aspergillus as a host for heterologous expression. Biotechnol. Adv. 27, 53–75. Meyer, V., 2008. Genetic engineering of filamentous fungi-progress, obstacles and future trends. Biotechnol. Adv. 26, 177–185. Min, I.S., Bang, J.Y., Seo, S.W., Lee, C.H., Maeng, P.J., 2010. Differential expression of citA gene encoding the mitochondrial citrate synthase of Aspergillus nidulans in response to developmental status and carbon sources. J. Microbiol. 48, 188–198. Murray, S.L., Hynes, M.J., 2010. Metabolic and developmental effects resulting from deletion of the citA gene encoding citrate synthase in Aspergillus nidulans. Eukaryot. Cell 9, 656–666. Nagaraj, G., Dave, K., Sastry, K.N., Punekar, N.S., 2009. Yeasts and filamentous fungi as hosts for recombinant protein production. In: Ravishankar, R.V., Bhat, R. (Eds.), Biotechnology: Concepts and Applications. Narosa Publishing House, New Delhi, pp. 183–221. Nayak, T., Szewczyk, E., Oakley, C.E., Osmani, A., Ukil, L., Murray, S.L., Hynes, M.J., Osmani, S.A., Oakley, B.R., 2006. A versatile and efficient gene-targeting system for Aspergillus nidulans. Genetics 172, 1557–1566. Noor, S., Punekar, N.S., 2005. Allosteric NADP-glutamate dehydrogenase from aspergilli: purification, characterization and implications for metabolic regulation at the carbon–nitrogen interface. Microbiology 151, 1409–1419.
K. Dave, N.S. Punekar / Journal of Biotechnology 155 (2011) 173–177 Papagianni, M., 2007. Advances in citric acid fermentation by Aspergillus niger: biochemical aspects, membrane transport and modeling. Biotechnol. Adv. 25, 244–263. Pel, H.J., et al., 2007. Genome sequencing and analysis of the versatile cell factory Aspergillus niger CBS 513.88. Nat. Biotechnol. 25, 221–231. Petrarulo, M., Facchini, P., Cerelli, E., Marangella, M., Linari, F., 1995. Citrate in urine determined with a new citrate lyase method. Clin. Chem. 41, 1518–1521. Punekar, N.S., Vaidyanathan, C.S., Appaji Rao, N., 1984. Mechanisms of citric acid fermentation by Aspergillus niger. J. Sci. Ind. Res. 43, 398–404. Punt, P.J., Dingemanse, M.A., Kuyvenhoven, A., Soede, R.D., Pouwels, P.H., van den Hondel, C.A., 1990. Functional elements in the promoter region of the
177
Aspergillus nidulans gpdA gene encoding glyceraldehyde-3-phosphate dehydrogenase. Gene 93, 101–109. Ruijter, G.J., Panneman, H., Xu, D., Visser, J., 2000. Properties of Aspergillus niger citrate synthase and effects of citA overexpression on citric acid production. FEMS Microbiol. Lett. 184, 35–40. Toda, T., Sano, M., Honda, M., Rimoldi, O.J., Yang, Y., Yamamoto, M., Takase, K., Hirozumi, K., Kitamoto, K., Minetoki, T., Gomi, K., Machida, M., 2001. Deletion analysis of the enolase gene (enoA) promoter from the filamentous fungus Aspegillus oryzae. Curr. Genet. 40, 260–267. Vanden Wymelenberg, A.J., Cullen, D., Spear, R.N., Schoenike, B., Andrews, J.H., 1997. Expression of green fluorescent protein in Aureobasidium pullulans and quantification of the fungus on leaf surfaces. Biotechniques 23, 686–690.