Utilization of a real-time PCR assay for diagnosis of Babesia microti infection in clinical practice

Ticks and Tick-borne Diseases 6 (2015) 376–382

Contents lists available at ScienceDirect

Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis

Original article

Utilization of a real-time PCR assay for diagnosis of Babesia microti infection in clinical practice Guiqing Wang a,c,∗ , Gary P. Wormser b , Jian Zhuge c , Patrick Villafuerte b , Dawn Ip c , Christine Zeren c , John T. Fallon a,b,c a

Department of Pathology, New York Medical College, Valhalla, NY, United States Department of Medicine, New York Medical College, Valhalla, NY, United States c Department of Pathology and Clinical Laboratories, Westchester Medical Center, Valhalla, NY, United States b

a r t i c l e

i n f o

Article history: Received 14 September 2014 Received in revised form 3 March 2015 Accepted 3 March 2015 Available online 24 March 2015 Keywords: Babesia microti Babesiosis Real-time PCR Giemsa stain Microscopic examination

a b s t r a c t Babesiosis is an emerging tick-borne disease mainly caused Babesia microti, a protozoan that infects erythrocytes. Microscopic examination of blood smears is the current gold standard for detection of Babesia infection, but this diagnostic test has several limitations. We developed and assessed the clinical utilization of a multiplex real-time PCR assay targeting the 18S rRNA gene of B. microti and the human gapdh gene. The limit of detection of this PCR assay was approximately 1–3 parasites/␮l of blood. The assay showed a diagnostic sensitivity and probable specificity of 100% based on testing 145 retrospective and 185 prospective blood specimens from controls and patients with confirmed babesiosis. Notably, the PCR assay was more sensitive than blood smear examination in patients during and following antibabesia drug therapy. Our study suggests that PCR testing is as good or better than a blood smear for detection of B. microti in routine clinical practice. PCR testing may confirm the presence of babesiosis in patients whose level of infection is too low for reliable microscopic detection. © 2015 Elsevier GmbH. All rights reserved.

Introduction Babesiosis is an emerging tick-borne disease caused by protozoan parasites of the genus Babesia that infect red blood cells (Homer et al., 2000; Vannier and Krause, 2012). Babesia infection can range from asymptomatic in healthy, immunocompetent persons to severe and potentially life threatening in the elderly and in those who are immuncompromised (Krause et al., 1998; Wormser et al., 2006). Babesia parasites in nature are usually transmitted to humans and animals by ticks including Ixodes scapularis, which also transmits Borrelia burgdorferi and Anaplasma phagocytophilum, the etiologic agents of Lyme disease and human granulocytic anaplasmosis, respectively. Babesia parasites are also transmissible via blood transfusion or congenitally (Feder et al., 2003; Gubernot et al., 2009; Joseph et al., 2012; Leiby, 2011). In recent years, reports of tick-borne and transfusion-associated babesiosis cases have increased in number and geographic distribution in the United States. Because babesiosis may be asymptomatic, blood donors

∗ Corresponding author at: Department of Pathology and Clinical Laboratories, Westchester Medical Center, Room 1J-04, Valhalla, NY 10595, United States. Tel.: +1 914 493 8914; fax: +1 914 493 5742. E-mail address: guiqing [email protected] (G. Wang). http://dx.doi.org/10.1016/j.ttbdis.2015.03.001 1877-959X/© 2015 Elsevier GmbH. All rights reserved.

may not realize that they are infected, which poses a risk to the blood supply. Between 1979 and 2009 over 159 transfusion-related babesiosis cases, including nine deaths, were documented in the U.S. (Gubernot et al., 2009; Herwaldt et al., 2011; Leiby, 2011). In response to the increasing public health threat, the Centers for Disease Control and Prevention (CDC) made babesiosis a nationally notifiable disease as of January 2011; 1,124 cases were reported from 15 of the 18 states in which babesiosis was a reportable disease in 2011 (CDC, 2012). Of these, all 429 babesiosis cases reported to the CDC with species-level information were caused by infection with B. microti, which occurs mainly in the Northeast and upper Midwest regions of the U.S. (CDC, 2012). Microscopic examination of blood smears has been the most commonly used assay for confirmation of active Babesia infection. However, performance of this assay requires specially trained personnel. The expected sensitivity for examination of thick blood films is 10–50 parasites/␮l of blood, or a red blood cell (RBC) infection rate of 0.0002–0.001% (assuming a total RBC count of 5 × 106 /␮l of blood), by an experienced technologist (Garcia, 2007; Guerin et al., 2002; Kamau et al., 2011; Moody, 2002). Most diagnostic laboratories generally achieve a lower sensitivity of detection (100–500 parasites/␮l, or 0.002–0.01% infected RBCs) (World Health Organization, 1988; Milne et al., 1994), which limits the use of microscopy in patients with low levels of parasitemia.

G. Wang et al. / Ticks and Tick-borne Diseases 6 (2015) 376–382

Also, Babesia parasites can be difficult to distinguish from the early trophozoite stage (ring form) of Plasmodium parasites, particularly P. falciparum, in which ring forms are often the only stage that is observed on peripheral blood smears of patients. Furthermore, the infecting Babesia species can only be identified to the genus level based on morphological criteria. Recently, the use of real-time PCR has been described for detection of B. microti in ticks or clinical specimens from patients suspected of having babesiosis (Bloch et al., 2013; Chan et al., 2013; Hojgaard et al., 2014; Rollend et al., 2013; Teal et al., 2012). In these reports, the analytical sensitivity of real-time PCR assays was most often assessed by spiking plasmid DNA to negative blood samples, which may result in inaccurate results due to the potential for preferred amplification by PCR of small plasmid DNA fragments, compared with the same target sequence contained within the complete genome of a microorganism (Lin et al., 2011; Yun et al., 2006). Moreover, there are only very limited data available on the performance of real-time PCR for diagnosis and monitoring of treatment in patients with babesiosis in routine clinical practice. In this study, we developed a multiplex real-time PCR assay for detection of B. microti DNA in blood samples. The diagnostic value of this assay was validated in patients from the Lower Hudson Valley region of New York State where I. scapularis transmitted diseases are highly endemic (Aliota et al., 2014; Hersh et al., 2014; Joseph et al., 2011; Kogut et al., 2005). It is estimated that 3–7% of I. scapularis ticks in this area are infected with B. microti (Aliota et al., 2014; Hersh et al., 2014; Kogut et al., 2005), while the highest incidence of human babesiosis has been reported in residents of three counties in the Lower Hudson Valley east of the Hudson River (6.6–25.1 cases per 100,000 population in 2013) (NYSDOH, 2014).

Materials and methods PCR primers and probe for detection of B. microti The DNA target for the assay was a variable region of the 18S rRNA gene (GenBank accession number AB190459) that contains a sequence believed to be species-specific for B. microti based on multiple sequence alignment of the 18S rDNA from B. microti and from closely related microorganisms (see below). The PCR primers and the probe were designed using the Primer Express (Applied Biosystems, Foster City, CA). To ascertain whether the PCR primer/probe combination was specific for B. microti, the DNA target sequence on the 18S rDNA was compared with orthologous sequences from other Babesia species known to infect humans and animals using ClustalW and MEGA program (Tamura et al., 2007). These species included B. divergens (U16370), B. duncani WA1 (AY027815), B. bovis (L19077), B. equi (Z15105), B. gibsoni (AF175300), B. bigemina (X59604), B. odocoilei (U16369) and Babesia sp. MO1 (AY048113). The aligned sequences

Babesia sp. MO1 (AY048113) Babesia sp. EU1 (GU647159) B. divergens (U16370) B. odocoilei (U16369) B. gibsoni (AF175300) B. canis (L19079) B. caballi (Z15104) B. bigemina (X59604) B. bovis (L19077) B. equi (Z15105) B. microti (M93660) B. microti (AB190459) B. microti (AY693840) B. microti (EF413181) Babesia sp. (AB197940) Babesia sp. WA1 (AY027815)

of various Babesia and related protozoan species and the sequences of the B. microti-specific primers and probe used in this study are shown in Fig. 1. The PCR primer set is predicted to amplify a portion of the 18S rDNA of B. microti strains with an amplicon size of 79-bp. Clinical samples and DNA extraction Aliquots of all of the EDTA-whole blood specimens submitted to the Westchester Medical Center clinical laboratories for blood parasite examination from January 2009 through October 2013 were utilized in this study. Blood samples were evaluated by Wright or Giemsa-stained thick and thin blood smears, as well as by nucleic acid amplification. At least 300 oil-immersion fields were examined on a thin blood smear before reporting a negative test result. DNA was extracted from 200 ␮l of EDTA-whole blood using a blood and body fluids protocol with the QIAamp DNA Blood Mini kit (Qiagen, Germantown, MD), according to the manufacturer’s instructions. DNA was eluted in 50 ␮l of elution buffer. For each PCR run, DNA was also extracted from a negative control and two positive controls consisting of different levels of B. microti infected RBCs. Both the negative and positive controls were prepared from patients without and with babesiosis, respectively, as confirmed by microscopic examination and by a separate PCR assay that targeted the 18S rDNA of B. microti as described by Persing et al. (1992). B. microti real-time PCR assay A multiplex real-time PCR assay targeting simultaneously B. microti 18S rDNA and a human housekeeping gene (gapdh) was performed on the 7500 Fast Dx Real-Time PCR instrument (Applied Biosystems, Foster City CA). In this multiplex PCR assay, the gapdh was included to serve as an internal quality control of DNA extraction, PCR amplification and to monitor the adequacy of the input specimen and the presence of PCR inhibitors. The primer and probe concentrations for gapdh were optimized not to interfere with amplification of B. microti-specific target in an initial experiment. The final PCR reaction consisted of 1× TaqMan® Fast Universal PCR Master Mix (no AmpErase, Applied Biosystems, Foster City, CA), 0.9 ␮M forward and reverse primers and a 0.5 ␮M probe that are specific for B. microti, and 0.025 ␮M forward and reverse primers and 0.02 ␮M of probe that are specific for the human gapdh gene (Table 1). Five microliters of extracted DNA template was added to each reaction in a total volume of 20 ␮l. Cycling conditions were as follows: 95 ◦ C for 20 s, followed by 40 cycles of denaturation at 95 ◦ C for 3 s, and annealing at 60 ◦ C for 30 s. A PCR run was considered valid only if all three quality control samples yielded expected results. A sample was reported as positive in a valid run if B. microti 18S rDNA target was detected by PCR (Ct ≤ 38.0), regardless of whether the internal control (gapdh) was amplified; a sample

165----------------------185 189-----------------------------214 GGCCT----TTT------GGCGGCGTTTATTAGTTCTA-AAACCATCCCTTTT-----GGTT--TTCGGTGATTCATAATAAACT GGCCT----TTT------GGCGGCGTTTATTAGTTCTA-TAACCACCC-TTTT-----GGTT--TTCGGTGATTCATAATAAACT GGCCT----TTT------GGCGGCGTTTATTAGTTCTA-AAACCATCCCTTTT-----GGTT--TTCGGTGATTCATAATAAACT GGCCT----TTTT-----GGCGGCGTTTATTAGTTCTA--AACCATCCGTTTT-----GGTT--TTCGGTGATTCATAATAAACT GGCCT----TTTT-----GGCGGCGTTTATTAGTTCTA--AACCTCCC---TT-----GGTT--TTCGGTGATTCATAATAAACT GGCCT----TTT------GGCCGCGTTTATTAGTTGTA--AACCTCCG--CTT-----GGTT--TTCGGTGATTCATAATAAACT TGCCT----TTT------GGCGGCGTTTATTAGTTTTT--AACC-------CT-----TATT--TTCGGTGATTCATAATAAACT GGCCT----TTT------GGCGGCGTTTATTAGTTCGT-TAACCAC-----TT-------TT--TCTGGTGATTCATAATAAACT GGGTT----TTC--------CCGCGTTTACTGGTCTT-------------------------------GTGATTTACAGTAA-CC GCTGT----TTAC-----AGTTGCGTTTATTAGACCTA-AAACCTCCCCGCTTCTGCGGTGT--TTCGGTGATTCATAATAAATT GGCGCGT-TTTC-----GCGTGGCGTTTATTAGACTT--TAACCAACCC--TTC---GGGT--AATCGGTGATTCATAATAAATT GGCGCGT-TTTC-----GCGTGGCGTTTATTAGACTT--TAACCAACCC--TTC---GGGT--AATCGGTGATTCATAATAAATT GGCGCGT-TTTC-----GCGTGGCGTTTATTAGACTT--TAACCAACCC--TTC---GGGT--AATCGGTGATTCATAATAAATT GGCGCGT-TTTC-----GCGTGGCGTTTATTAGACTT--TAACCAACCC--TTC---GGGT--AATCGGTGATTCATAATAAATT GGCATATACTTCTGTATATGTGGCGTTTATTAGACTTCTTAACCAACCCCTTTT---GGGTTTACTCGGTGATTCATAATAAATT GGCCTTGGCTTCTGTCTTGGCTGCGTTTATTAGACTCG-AAACCTTCCCGCTTG---CGGT--ACTCGGTGATTCATAATAAATT

Forward primer

Probe

377

226---------------243 TGCGAATCGCAATTTTTT-GC----GATGG CGCGAATCGCAATTTATT-GC----GATGG TGCGAATCGCAATTTTTT-GC----GATGG CGCGAATCGCAATTTATT-GC----GATGG CGCGAATCGC---TTTTA-GC----GATGG TGCGAATCGC---TTTTA-GC----GATGG TGCGAATCGC--TTTTGA-GC----GATGG TGCGAATCGC----TTTT-GC----GATGT TGCGACTCGC---TTTTT-GC----GATAT AGCGAATCGCATGGCTTT-GCCGGCGATGT AGCGAATCGCATGGCTTT-GCCGGCGATGT AGCGAATCGCATGGCTTT-GCCGGCGATGT AGCGAATCGCATGGCTTT-GCCGGCGATGT AGCGAATCGCATGGCTTT-GCCGGCGATGT AGCGAATCGCATGGTYCT-ACCGGCGATAT TGCGAATCGCATGGCTTTTGCCGGCGATGG

Reverse primer

Fig. 1. DNA sequence alignment of the 18S rRNA genes of representative Babesia spp. and closely related microorganisms. The GenBank accession numbers for Babesia sp. and related microorganisms are given in parenthesis. The nucleotide positions on top of the sequences are defined per DNA sequence of the 18S rRNA gene from B. microti ATCC strain 30222 (GenBank accession number AB190459). The PCR primer and probe sequences used in this study are bolded and underlined.

378

G. Wang et al. / Ticks and Tick-borne Diseases 6 (2015) 376–382

Table 1 PCR primers and probes used in this study. Target

Primer/probe

Sequence (5 –3 )

B. microti Forward primer CGCGTGGCGTTTATTAGACTT 18S rDNA Reverse primer CAAAGCCATGCGATTCGC FAM-CCAACCCTTCGGGTAATCGGTGATTC-TAMRA Probe Human gapdh

Forward primer CCTGCCAAATATGATGACATCAAG Reverse primer Probe

GTGGTCGTTGAGGGCAATG VIC-CTCCTCTGACTTCAACAGCGACACCCA-TAMRA

of interfering substances (AcroMetrixTM inhibition panel, Life Technology). The final concentration of B. microti in these spiked samples was equivalent to a level of parasitemia of 0.33% infected RBCs. The measured B. microti DNA in each spiked specimen was compared with that recovered from the EDTA-blood control without interfering substances. PCR inhibition was considered to be significant if there was >2.0 increase in the Ct value of the specimen in which an interfering substance was present, compared with that of the EDTA-blood control. Diagnostic sensitivity and specificity of the B. microti PCR assay

was defined as negative if B. microti 18S rDNA was not detected by PCR, but the human gapdh was amplified with a Ct ≤ 40. Analytical sensitivity of B. microti PCR assay The analytical sensitivity of the PCR assay was assessed by two different approaches. First, we prepared a series of seven 10-fold dilutions by directly spiking a positive patient blood sample with 5% B. microti parasitemia, determined by microscopic examination of a blood smear, into pooled-negative patient blood specimens. Second, we constructed a B. microti – positive control by cloning the 79-bp PCR amplicon into a pGEM® -T plasmid vector (Promega, Madison, WI) and prepared a series of eight 2–10-fold dilutions by spiking known amounts of this plasmid DNA into negative human blood resulting in 5, 50, 250, 500, 2500, 5000, 50,000 or 500,000 copies/ml. For both dilution series, DNA was extracted from spiked blood samples and analyzed in duplicate or triplicate on three different days. The Probit analysis was employed to determine the limit of detection of the B. microti DNA PCR assay by using the SPSS software (IBM, ver. 22, Chicago, IL). Additionally, nine dilutions containing 10–109 copies/ml of B. microti plasmid DNA in human blood were also prepared and analyzed in triplicate to determine the linearity and efficiency of amplification of the PCR assay. Analytical specificity of B. microti PCR assay The analytical specificity of the B. microti DNA PCR assay was evaluated by testing a collection of 61 specimens known to be positive for various microorganisms (Table 2). These included parasites from closely related Babesia species, two other tick-borne pathogens, other blood-borne parasites, and a variety of viruses that may be detected in blood samples of patients. A total of ten bacterial or fungal organisms were also examined for cross-reactivity by the B. microti DNA PCR assay. In addition, interference testing was performed by spiking B. microti-infected blood into blood specimens with various levels Table 2 Microorganism examined for the analytical specificity of the B. microti PCR assay. Group

Microorganisms

Babesia spp.

B. divergens, B. bovis, B. cabalii, B. gibsoni, B. odocoilei, and Theileria (Babesia) equi Plasmodium falciparum, P. vixax, P. ovale, P. malariae, Leishmania sp., Trypanosoma brucei Borrelia burgdorferi, Anaplasma phagocytophilum Herpes simplex virus-1 and 2, Cytomegalovirus, Epstein–Barr virus, Enterovirus, Human immunodeficiency virus-1, Hepatitis C virus, Hepatitis B virus Bartonella henselae, Staphylococcus aureus, S. epidermidis, S. lugdunensis, Enterococcus sp., Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae, Candida albicans, Cryptococcus neoformans, Aspergillus sp.

Other parasites Tick-borne pathogens Viruses

Bacteria and fungi

To assess further the diagnostic value of this multiplex real-time PCR assay, Wright or Giemsa-stained thick and thin blood smear results and clinical data from patients were reviewed. The clinical sensitivity of the B. microti DNA PCR assay was assessed by comparing the PCR results with the results of microscopic examination of a blood smear. The individuals who performed each of the assays were unaware of the results of the other testing method. Patient specimens showing a discrepancy between the results of PCR and blood smear were analyzed by the Wadsworth Center Parasitology Laboratory (Albany, New York), using a real-time PCR assay that utilized a different set of primers and probe targeting the 18S rRNA gene of B. microti (Teal et al., 2012). Also, for patient specimens with discrepant results between microscopic examination and PCR, clinical and other laboratory data, including medical history, clinical diagnosis, and B. microti-specific antibody results if available, were reviewed and used to determine if the patient had infection with B. microti. Data analysis Statistical analysis was performed using the Mann–Whitney test, column statistics and linear regression programs of the Prism 5 software (GraphPad Software, La Jolla, CA). This study was part of the clinical laboratories quality improvement program. Review of patient medical records was approved by the New York Medical College Office of Research Administration. Results Limit of detection (LOD) of B. microti PCR assay The analytical sensitivity of the B. microti PCR assay was evaluated in two different experiments using spiked blood specimens containing either intact parasites with a known level of parasitemia or plasmid DNA with known target concentrations. In the first experiment, parasitemia levels of 5.0 × 10−3 to 5.0 × 10−9 % infected RBCs were prepared by spiking a fresh patient blood sample with 5% B. microti parasitemia, in which the total RBC count was 4.14 × 106 RBC/␮l, into a B. microti-negative human blood specimen. The limit of detection of B. microti DNA by the PCR was determined by the PROBIT analysis to be 0.000065% (6.5 × 10−5 %) parasite infected RBCs, with a positive rate greater than 95% (Table 3). This corresponded to 2.7 parasites/␮l of blood, or 54 parasites per PCR reaction, using the assumption of one parasite per infected RBC. In the second experiment, eight dilutions of blood samples were prepared from uninfected human blood spiked with known target concentrations of plasmid DNA. The limit of detection of the B. microti DNA PCR was determined by the PROBIT analysis as 715 copies of B. microti DNA per ml of blood for a positive rate greater than 95%, corresponding to 0.36 parasites/␮l of blood, or 7.2 parasites per PCR reaction, assuming that there are two copies of rDNA units per parasite cell (Cornillot et al., 2012).

G. Wang et al. / Ticks and Tick-borne Diseases 6 (2015) 376–382

379

Table 3 Limit of detection (LOD) of B. microti DNA PCR assay determined using blood specimens spiked with a positive patient blood sample with a known level of parasitemia. Dilution

Parasitemia (%)

No. of infected RBC/␮la

No. of samples tested

No. of samples positive

Positivity (%)

Probabilityb

D E F G H I J

5.00E−03 5.00E−04 5.00E−05 5.00E−06 5.00E−07 5.00E−08 5.00E−09

210 21.0 2.1 0.21 0.021 0.0021 0.00021

9 13 13 13 13 13 13

9 13 13 8 0 0 0

100.0 100.0 100.0 61.5 0.0 0.0 0.0

1.000 1.000 0.848 0.216 0.166 0.162 0.162

a

Estimation based on the total RBC count of patient blood used for spiking (4.14 × 106 RBC/␮l). Probit 95% hit rate: 6.50E−5 (%) parasitemia, or 2.7 parasites/␮l of blood sample.

Mesarured B. microi DNA (Log10 copies/mL)

b

10

y = 1.039x - 0.2367 R² = 0.9902

9 8 7 6 5 4 3 2 1 0 0

2

4

6

8

10

Estimated B. microti DNA (Log10 copies/mL) Fig. 2. Linearity of the B. microti DNA PCR assay determined using blood specimens spiked with different levels of plasmid DNA containing B. microti-specific 18S rDNA target.

The linearity of the assay was determined by plotting the cycle of threshold (Ct) versus copy number for the dilution series of the control plasmid used in the previous experiment (Fig. 2). The PCR assay was capable of detecting B. microti DNA at different levels that ranged over 8 logs in number. The slope was found to be −3.50, with an R2 of 0.990, which is very close to the theoretical optimum of 1.0. The calculated PCR efficiency was 95.0%. Therefore, this assay might be expanded to serve as a quantitative assay to estimate gene copy number and percent parasitemia in clinical samples. Analytical specificity No cross-reactivity was observed with the B. microti DNA PCR assay for the control organisms tested. Elevated levels of hemoglobin (0.5, 1.0 and 2.0 g/dl), triglycerides (0.75 g/dl) or bilirubin (16 mg/dl) in blood samples with low parasitemia (0.33%) did not interfere with detection of B. microti DNA by the B. microti PCR assay. However, heparin slightly reduced PCR amplification resulting in an average Ct of 27.8, compared with the EDTA-blood control that had an average Ct of 26.9. To confirm further the specificity of the B. microti PCR assay, amplicons obtained from blood specimens of 5 patients with B. microti infection based on microscopic examination and clinical features were sequenced using the Big Dye Terminator v1.1 kit on the ABI 3500xL Genetic Analyzer. Sequence analysis of the PCR products confirmed that all 5 amplicons contained the expected B. microti-specific sequence. Reproducibility The intra-assay reproducibility of the B. microti DNA PCR was evaluated by running three blood specimens spiked with a positive

patient sample in one day. The parasitemia in these spiked samples varied from 5.0 × 10−5 % infected RBCs, near the limit of detection of the assay, to 5.0 × 10−3 % infected RBCs. For each spiked sample 9 replicates were obtained for the intra-assay reproducibility study. High intra-assay reproducibility was demonstrated with a standard derivation (SD) on the Ct value of less than 0.56 and a coefficient of variance (CV%) of 0.4–1.6%. The inter-assay reproducibility of the B. microti DNA PCR was demonstrated by testing three human blood specimens spiked with positive patient blood samples at different levels of parasitemia on three different days. Duplicate samples underwent DNA extraction and PCR analysis on each day. A total of 6 replicates were performed for the inter-assay reproducibility testing for each spiked sample. The inter-assay CV% of the B. microti DNA PCR varied from 0.8% to 2.3%. Diagnostic sensitivity and specificity of the B. microti PCR assay Diagnostic sensitivity and specificity of the B. microti PCR assay were assessed in a retrospective study using blood samples from patients previously tested for Babesia sp. infection by microscopic examination of blood smears. A total of 145 blood specimens from 15 patients with a positive blood smear (15 blood samples) and 120 patients with a negative blood smear (130 blood samples) were analyzed by PCR (Table 4). The diagnostic sensitivity and specificity of the B. microti DNA PCR was 100% (15/15) and 97.7% (127/130), respectively. Of the three patient specimens that were negative by microscopic examination but were positive by PCR, two were also positive for B. microti DNA by a different PCR assay performed at the New York State Wadsworth Center Clinical Parasitology Laboratory. The third specimen yielded a low positive (Ct = 37.2) by PCR in our testing but was negative at the Wadsworth Laboratory. Review of the medical records of the 3 patients, as well as other laboratory data, confirmed that all three patients were recently diagnosed with babesiosis and were receiving or had completed anti-parasitic treatment for babesiosis prior to the collection of the particular blood samples used in this analysis, resulting in a probable specificity of 100% for the B. microti PCR assay. The gapdh target Table 4 Accuracy of the B. microti DNA real-time PCR for patient specimens compared to results of microscopic examination of blood smears (n = 145). Microscopic examination

Total

Positive

Negative

B. microti DNA PCR Positive Negative

15 0

3a 127

18 127

Total

15

130

145

a

Diagnosis of babesiosis was confirmed for all three patients based on medical history, detection of B. microti DNA at the New York Wadsworth Center Clinical Parasitology Laboratory using a different PCR assay (Teal et al., 2012) and/or B. microti-specific IgG and IgM antibodies. See text for more details.

380

G. Wang et al. / Ticks and Tick-borne Diseases 6 (2015) 376–382

in the multiplex PCR was detected in all 127 B. microti DNA-negative patient blood samples with an average Ct of 30.4 (range: 19.0–38.8). Performance of the B. microti DNA PCR assay in routine practice To validate the diagnostic value in routine clinical practice, a prospective study was performed with our B. microti DNA PCR assay in comparison with microscopic examination on an additional 185 consecutive blood samples from 152 patients that were submitted to the clinical laboratory for detection or confirmation of B. microti infection (Table 5). Twenty-one blood samples from 16 patients were positive by microscopic examination of blood smears. The level of parasitemia among the smear-positive patients varied from <0.01% to 15%. No smear positive blood sample was PCR negative, resulting in a diagnostic sensitivity of 100% by the PCR assay. Of the 164 smear-negative blood samples, 21 samples were positive by the PCR assay. These included 17 follow-up specimens from 8 previously smear-positive patients observed in this study and 4 specimens from 3 other smear-negative patients. For these three patients whose blood specimens were negative by microscopic examination but were positive by PCR, two patients had been smear positive on an earlier blood sample. A diagnosis of babesiosis was suggested for the third patient who recently developed a febrile illness with abnormal liver function tests and evidence of hemolysis along with seropositivity for B. microti-IgG and IgM specific antibodies; therefore, the probable diagnostic specificity was 100%. The mean Ct value for smear-positive samples (n = 21) was 22.8 (range: 17.1–37.5; 95% confidence interval [C.I.]: 20.1–25.6), which was significantly lower than that of smear-negative specimens (n = 21; mean: 31.8; range: 23.2–37.0; 95% C.I.: 29.3–33.7) (p < 0.001) (Fig. 3). The estimated average number of parasites for smearpositive and smear-negative blood specimens was approximately

Table 5 Summary of the performance of B. microti DNA PCR in comparison with microscopy for 185 blood samples from 152 patients as routine testing in a prospective study. Smear/PCR result

No. of samples

No. of patients

Smear positive Smear positive/PCR positive Smear positive/PCR negative Smear negative Smear negative/PCR positive Smear negative/PCR negative

21a 0

16 0

21b 143

3c 133

Total

185

152

a

Included 5 follow-up blood samples from smear-positive patients. b Included 17 follow-up blood samples from 8 previously smear-positive patients and 4 blood samples from 3 smear-negative patients. c Clinical diagnosis of babesiosis was confirmed for all three smear-negative patients based on previous positive-smear (n = 2) or detection of B. microti-specificIgG and IgM antibodies (n = 1).

Cycle of threshold (Ct)

40 30 20 10 0 Blood smear (+)

Blood smear (-)

Fig. 3. Distribution of the B. microti DNA PCR cycle of threshold (Ct) in blood smear-positive (n = 21) and smear-negative (n = 21) patient blood samples. See supplemental material for estimated average number of parasites/␮l of smear-positive and smear-negative blood specimens.

2500 parasites/␮l and 5 parasites/␮l, respectively (see supplemental material). It is noteworthy that 17 follow-up blood specimens from 8 previously smear-positive patients were negative by microscopic examination of blood smears but were positive by PCR, suggesting that the PCR assay was able to improve parasite detection in patients during or following antibiotic treatment for babesiosis.

Discussion We have developed a highly sensitive and specific multiplex real-time PCR assay that can accurately detect B. microti in human blood samples. Of note, our study is the first to assess and validate the utility of a B. microti-specific real-time PCR assay in routine clinical practice based on analysis of a large number of prospectively collected, consecutive blood specimens from patients with suspected babesiosis. Our findings have important implications for the diagnosis and management of symptomatic patients with babesiosis and augments the knowledge base on the use of PCR for detection of B. microti in clinical practice. In view of the increasing incidence of human babesiosis cases due to tick bite or blood transfusion in the US, highly sensitive and specific diagnostic tests for this infection are needed. The PCR assay described in this study can be evaluated for blood donor screening and also evaluated to determine whether it may prove useful for conducting prevalence surveys of B. microti infection in ticks and animal reservoirs. Thus, the development of accurate PCR tests to detect B. microti may have broader implications for public health, although a comprehensive evaluation of our PCR in these contexts is beyond the scope of this study. We established the analytical sensitivities (LOD) of the B. microti DNA PCR assay using blood samples spiked with B. microti (containing B. microti genomic DNA of approximately 6.5 Mb) (Cornillot et al., 2012) in infected RBCs or spiked with cloned plasmid DNA (3079 bp). The analytical sensitivity determined using samples containing plasmid DNA was 0.36 parasites/␮l of blood. By contrast, the analytical sensitivity using samples with intact B. microti parasites in infected RBCs was 2.7 parasites/␮l, which was ∼7-fold less sensitive than that established using samples spiked with plasmid DNA. Both reductions in DNA extraction efficiency and reduced PCR amplification have been well documented using intact organisms containing large genomic DNAs versus extracellular, small plasmid DNA fragments (Lin et al., 2011; Yun et al., 2006). Imprecision in the measurement of parasitemia in a patient sample and in the estimation of the plasmid copy numbers in DNA used for the spiking may also contribute to the observed difference (College of American Pathologist, 2013; Applied Biosystems, 2003). Since the blood specimens spiked with the patient sample with a known level of parasitemia and a known quantity of RBCs is more closely simulated to patient specimens used for routine testing, we believe the LOD established using spiked intact microorganisms is more likely to represent the true analytical sensitivity of a B. microti DNA PCR assay in clinical laboratories. Since the average detection limit by microscopy is about 100 parasites/␮l, our B. microti DNA PCR is about 30–100× more sensitive than microscopic examination of blood smears. It, therefore, provides a more sensitive testing method for detection of B. microti infection. The analytical sensitivity of PCR reported in this study is in general comparable to (Rollend et al., 2013; Chan et al., 2013) or slightly better (Teal et al., 2012) than that described by other investigators, which varied from 1 to 10 parasites/␮l of blood. Bloch et al. (2013) reported a SYBR-based PCR with greater sensitivity (LOD of 12.9 parasistes/2 ml), although the PCR assay described by these investigators requires additional steps of sample processing such as repeat freeze–thaw and centrifugation. In future studies it would

G. Wang et al. / Ticks and Tick-borne Diseases 6 (2015) 376–382

be desirable to directly compare the sensitivity and specificity of these other PCR tests with ours for detection of B. microti. We have employed a multiplex PCR approach, in which a human housekeeping gene (gapdh) was selected and co-analyzed for each sample with a negative PCR result for B. microti DNA. Thus, it eliminates the need to spike external control materials into patient samples to be analyzed. A high specificity of this PCR assay was demonstrated by an in silico comparison of aligned sequences of the target 18S rDNA and from experimental data obtained from an analytical specificity study. In addition, the performance of the B. microti PCR assay was validated using 145 retrospective blood specimens from controls and patients with confirmed babesiosis. Furthermore, its utility for diagnosis and potential utility for monitoring of treatment was demonstrated by analyzing 185 consecutive blood specimens from patients with suspected babesiosis. The PCR amplification and detection takes only ∼40 min with the use of the TaqMan® Fast Universal Master Mix reagents, providing more timely results to clinicians and potentially to blood centers for donor screening. Based on our experience, parasitemia levels decrease shortly after initiation of anti-parasitic treatment for the majority of patients with acute babesiosis. Therefore, we observed in this study that 17 follow-up blood specimens from 8 patients with babesiosis were positive by PCR but were negative by microscopic examination, suggesting that PCR analysis can be a preferred test for establishing the diagnosis and monitoring low level of parasitemia after beginning treatment in such cases. In addition, our B. microti PCR assay has an excellent linearity of response over 8 orders of magnitude. With the inclusion of a set of external standards to generate a calibration curve, this assay can be converted to a quantitative test that will permit calculation of the level of parasitemia. More data are needed to determine if the residual PCR positivity during and following anti-babesia drug therapy is a consequence of detection of non-viable versus viable parasites. A limitation of this study is that we were unable to evaluate the specificity of the PCR assay by directly testing some Babesia species or variants due to difficulty in obtaining DNA samples. On the basis of sequence alignment, however, it is unlikely that this PCR assay will amplify DNA from other Babesia species that infect humans in geographic regions beyond the Northeast and northern Midwest of the U.S., including B. duncani, B. divergens-like MO-1, and Babesia sp. CA-1 (Herwaldt et al., 2004; Leiby, 2011). Although such a high specificity for this PCR assay may limit its clinical utilization in areas in which patients may be infected with non-B. microti species or variants, the majority of human cases of babesiosis in the U.S. are caused by B. microti, and neither B. duncani nor B. divergens has caused human babesiosis in babesiosis-endemic areas of the Northeast or northern Midwest where B. microti is prevalent (CDC, 2012; Leiby, 2011). Three clades of B. microti isolates have been described (Goethert and Telford, 2003). Comparison of the 18S rDNA sequences shows 100%, 96.2% and 97.9% identity in nucleic acids between the B. microti isolate used to develop the PCR in this study (Fig. 1, isolate ATCC 30222, accession no. AB190459) and that of clade 1 (AY144696), clade 2 (AY144701) and clade 3 (AY144690) isolates respectively (data not shown), suggesting that our PCR will detect clade 1 B. microti isolates, which are believed to cause the vast majority of human B. microti infections in the U.S (Rollend et al., 2013). We cannot determine if our PCR would detect B. microti clades 2 and 3 due to insufficient data for these two clades on the DNA sequences for the specific region targeted for amplification by our PCR. Also, this validation was limited to patients from a limited geographic area (Lower Hudson Valley, NY) compared to the full geographic distribution of B. microti infection in the US, and this could result in a limited representation of the genetic variability of the B. microti examined.

381

Other limitations of this study are the lack of data on the efficiency of RBC lysis used in the DNA extraction procedure for this study and lack of information on whether the smear negative and PCR negative patients may have had serologic evidence of a recent B. microti infection. In summary, we have developed a highly sensitive and specific real-time multiplex PCR assay that is superior to microscopic examination of blood smears for detection of B. microti in blood samples of patients with babesiosis.

Acknowledgments We thank Patricia J Holman, Susan Madison-Antenucci, Syed Abid, Yi-Wei Tang for providing DNA samples of Babesia sp. and other microorganisms for analysis of the assay specificity. We also thank the New York Wadsworth Center Clinical Parasitology Laboratory for analysis of blood specimens by Giemsa smear and PCR. The PCR primers, probes and assay described in this paper are protected under U.S. provisional patent application no. 61935386. Disclosures: Dr. Wormser reports receiving research grants from Immunetics, Inc., Rarecyte, Inc., and bioMérieux SA. He owns equity in Abbott; has been an expert witness in malpractice cases involving Lyme disease and babesiosis; is an unpaid board member of the American Lyme Disease Foundation; and was a consultant to Baxter for Lyme disease vaccine development. Dr. Wang and Dr. Fallon are co-owners of the patent for the babesia PCR test. Other authors: None.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ttbdis.2015.03.001.

References Aliota, M.T., Dupuis 2nd, A.P., Wilczek, M.P., Peters, R.J., Ostfeld, R.S., Kramer, L.D., 2014. The prevalence of zoonotic tick-borne pathogens in Ixodes scapularis collected in the Hudson Valley, New York State. Vector Borne Zoonotic Dis. 14, 245–250. Applied Biosystems, 2003. Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR. Technical Note. 1–9. Bloch, E.M., Lee, T.H., Krause, P.J., Telford 3rd, S.R., Montalvo, L., Chafets, D., Usmani-Brown, S., Lepore, T.J., Busch, M.P., 2013. Development of a real-time polymerase chain reaction assay for sensitive detection and quantitation of Babesia microti infection. Transfusion 53, 2299–2306. Centersfor Disease Control and Prevention, 2012. Babesiosis surveillance – 18 States, 2011. MMWR. Morb. Mortal. Wkly. Rep. 61, 505–509. Chan, K., Marras, S.A., Parveen, N., 2013. Sensitive multiplex PCR assay to differentiate Lyme spirochetes and emerging pathogens Anaplasma phagocytophilum and Babesia microti. BMC Microbiol. 13, 295. College of American Pathologist, 2013. BP-C blood parasites participant summary/final critique. CAP Proficiency Testing Participant Summary, Vol. BP-C., pp. 1–12, Chicago. Cornillot, E., Hadj-Kaddour, K., Dassouli, A., Noel, B., Ranwez, V., Vacherie, B., Augagneur, Y., Bres, V., Duclos, A., Randazzo, S., Carcy, B., DebierreGrockiego, F., Delbecq, S., Moubri-Menage, K., Shams-Eldin, H., Usmani-Brown, S., Bringaud, F., Wincker, P., Vivares, C.P., Schwarz, R.T., Schetters, T.P., Krause, P.J., Gorenflot, A., Berry, V., Barbe, V., Ben Mamoun, C., 2012. Sequencing of the smallest Apicomplexan genome from the human pathogen Babesia microti. Nucleic Acids Res. 40, 9102–9114. Feder Jr., H.M., Lawlor, M., Krause, P.J., 2003. Babesiosis in pregnancy. N. Engl. J. Med. 349, 195–196. Garcia, L.S., 2007. Malaria and babesiosis. In: Garcia, L.S. (Ed.), Diagnostic Medical Parasitology. , 5th ed. ASM Press, Washington, DC, pp. 142–189. Goethert, H.K., Telford III, S.R., 2003. What is Babesia microti? Parasitology 127, 301–309. Gubernot, D.M., Nakhasi, H.L., Mied, P.A., Asher, D.M., Epstein, J.S., Kumar, S., 2009. Transfusion-transmitted babesiosis in the United States: summary of a workshop. Transfusion 49, 2759–2771. Guerin, P.J., Olliaro, P., Nosten, F., Druilhe, P., Laxminarayan, R., Binka, F., Kilama, W.L., Ford, N., White, N.J., 2002. Malaria: current status of control, diagnosis, treatment, and a proposed agenda for research and development. Lancet Infect. Dis. 2, 564–573.

382

G. Wang et al. / Ticks and Tick-borne Diseases 6 (2015) 376–382

Hersh, M.H., Ostfeld, R.S., McHenry, D.J., Tibbetts, M., Brunner, J.L., Killilea, M.E., LoGiudice, K., Schmidt, K.A., Keesing, F., 2014. Co-infection of blacklegged ticks with Babesia microti and Borrelia burgdorferi is higher than expected and acquired from small mammal hosts. PLOS ONE 9, e99348. Herwaldt, B.L., de Bruyn, G., Pieniazek, N.J., Homer, M., Lofy, K.H., Slemenda, S.B., Fritsche, T.R., Persing, D.H., Limaye, A.P., 2004. Babesia divergens-like infection, Washington State. Emerg. Infect. Dis. 10, 622–629. Herwaldt, B.L., Linden, J.V., Bosserman, E., Young, C., Olkowska, D., Wilson, M., 2011. Transfusion-associated babesiosis in the United States: a description of cases. Ann. Intern. Med. 155, 509–519. Hojgaard, A., Lukacik, G., Piesman, J., 2014. Detection of Borrelia burgdorferi, Anaplasma phagocytophilum and Babesia microti, with two different multiplex PCR assays. Ticks Tick Borne Dis. 5, 349–351. Homer, M.J., Aguilar-Delfin, I., Telford 3rd, S.R., Krause, P.J., Persing, D.H., 2000. Babesiosis. Clin. Microbiol. Rev. 13, 451–469. Joseph, J.T., Purtill, K., Wong, S.J., Munoz, J., Teal, A., Madison-Antenucci, S., Horowitz, H.W., Aguero-Rosenfeld, M.E., Moore, J.M., Abramowsky, C., Wormser, G.P., 2012. Vertical transmission of Babesia microti, United States. Emerg. Infect. Dis. 18, 1318–1321. Joseph, J.T., Roy, S.S., Shams, N., Visintainer, P., Nadelman, R.B., Hosur, S., Nelson, J., Wormser, G.P., 2011. Babesiosis in Lower Hudson Valley, New York, USA. Emerg. Infect. Dis. 17, 843–847. Kamau, E., Tolbert, L.S., Kortepeter, L., Pratt, M., Nyakoe, N., Muringo, L., Ogutu, B., Waitumbi, J.N., Ockenhouse, C.F., 2011. Development of a highly sensitive genusspecific quantitative reverse transcriptase real-time PCR assay for detection and quantitation of Plasmodium by amplifying RNA and DNA of the 18S rRNA genes. J. Clin. Microbiol. 49, 2946–2953. Kogut, S.J., Thill, C.D., Prusinski, M.A., Lee, J.H., Backerson, P.B., Coleman, J.L., Anand, M., White, D.J., 2005. Babesia microti, upstate New York. Emerg. Infect. Dis. 11, 476–478. Krause, P.J., Spielman, A., Telford 3rd, S.R., Sikand, V.K., McKay, K., Christianson, D., Pollack, R.J., Brassard, P., Magera, J., Ryan, R., Persing, D.H., 1998. Persistent parasitemia after acute babesiosis. N. Engl. J. Med. 339, 160–165. Leiby, D.A., 2011. Transfusion-transmitted Babesia spp.: bull’s-eye on Babesia microti. Clin. Microbiol. Rev. 24, 14–28.

Lin, C.H., Chen, Y.C., Pan, T.M., 2011. Quantification bias caused by plasmid DNA conformation in quantitative real-time PCR assay. PLoS ONE 6, e29101. Milne, L.M., Kyi, M.S., Chiodini, P.L., Warhurst, D.C., 1994. Accuracy of routine laboratory diagnosis of malaria in the United Kingdom. J. Clin. Pathol. 47, 740–742. Moody, A., 2002. Rapid diagnostic tests for malaria parasites. Clin. Microbiol. Rev. 15, 66–78. New York State Department of Health (NYSDOH), 2014. Statistics and Data. http://www.health.ny.gov/statistics/diseases/communicable/ (cited 28.02.15). Persing, D.H., Mathiesen, D., Marshall, W.F., Telford, S.R., Spielman, A., Thomford, J.W., Conrad, P.A., 1992. Detection of Babesia microti by polymerase chain reaction. J. Clin. Microbiol. 30, 2097–2103. Rollend, L., Bent, S.J., Krause, P.J., Usmani-Brown, S., Steeves, T.K., States, S.L., Lepore, T., Ryan, R., Dias, F., Ben Mamoun, C., Fish, D., Diuk-Wasser, M.A., 2013. Quantitative PCR for detection of Babesia microti in Ixodes scapularis ticks and in human blood. Vector Borne Zoonotic Dis. 13, 784–790. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Teal, A.E., Habura, A., Ennis, J., Keithly, J.S., Madison-Antenucci, S., 2012. A new realtime PCR assay for improved detection of the parasite Babesia microti. J. Clin. Microbiol. 50, 903–908. Vannier, E., Krause, P.J., 2012. Human babesiosis. N. Engl. J. Med. 366, 2397–2407. World Health Organization, 1988. Development of recommendations for the protection of short-stay travellers to malaria endemic areas: Memorandum from two WHO Meetings. Bull. World Health Organ. 66, 177–196. Wormser, G.P., Dattwyler, R.J., Shapiro, E.D., Halperin, J.J., Steere, A.C., Klempner, M.S., Krause, P.J., Bakken, J.S., Strle, F., Stanek, G., Bockenstedt, L., Fish, D., Dumler, J.S., Nadelman, R.B., 2006. The clinical assessment, treatment, and prevention of Lyme disease, human granulocytic anaplasmosis, and babesiosis: clinical practice guidelines by the Infectious Diseases Society of America. Clin. Infect. Dis. 43, 1089–1134. Yun, J.J., Heisler, L.E., Hwang, I.I., Wilkins, O., Lau, S.K., Hyrcza, M., Jayabalasingham, B., Jin, J., McLaurin, J., Tsao, M.S., Der, S.D., 2006. Genomic DNA functions as a universal external standard in quantitative real-time PCR. Nucleic Acids Res. 34, e85.