UV-responsive [email protected] nanoparticles potential for polymorphous light eruption protection and therapy

Journal Pre-proof UV-responsive AKBA@ZnO nanoparticles potential for polymorphous light eruption protection and therapy Xiao Huang, Muhammad Farrukh Nisar, Mei Wang, Wenhong Wang, Long Chen, Mao Lin, Wei Xu, Qingchun Diao, Julia Li Zhong PII:

S0928-4931(17)34089-4

DOI:

https://doi.org/10.1016/j.msec.2019.110254

Reference:

MSC 110254

To appear in:

Materials Science & Engineering C

Received Date: 12 October 2017 Revised Date:

5 August 2019

Accepted Date: 24 September 2019

Please cite this article as: X. Huang, M.F. Nisar, M. Wang, W. Wang, L. Chen, M. Lin, W. Xu, Q. Diao, J.L. Zhong, UV-responsive AKBA@ZnO nanoparticles potential for polymorphous light eruption protection and therapy, Materials Science & Engineering C (2019), doi: https://doi.org/10.1016/ j.msec.2019.110254. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier B.V.

UV-responsive AKBA@ZnO nanoparticles potential for polymorphous light eruption protection and therapy Xiao Huang1,2,3 #,*, Muhammad Farrukh Nisar1,#†, Mei Wang 1, Wenhong Wang 2,3,Long Chen 1, Mao Lin 4, Wei Xu 4, Qingchun Diao 4and Julia Li Zhong1,4,* 1

Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering college, Chongqing University, Chongqing 400044, China;

2

Institute of Nanomedicine and Biomaterials, School of Sports and Health Science, Tongren University, Tongren 554300, China;

3

Guizhou Provincical College-based Key Lab for Tumor Prevention and Treatment with Distinctive Medicines, Zunyi Medical University, Zunyi 563003, China;

4

Department of Dermatology, Chongqing First People's Hospital and Chongqing Traditional Chinese Medicine Hospital, Chongqing 400011, China

#

These two authors contribute equally to this work.

Current Address: Department of Physiology and Biochemistry, Cholistan University of Veterinary and Animal Sciences (CUVAS), Bahawalpur, 63100, Pakistan.

†

* Correspondence: Huang X.

[email protected]; Zhong J.L.

[email protected]

Abstract: Polymorphous light eruption (PLE) is one of the acquired idiopathic photodermatosis mainly induced by immoderate UV radiation. In order to realize UV protection and medicine administration simultaneously for polymorphous light eruption protection and therapy, Acetyl-11-keto-β-boswellic acid (AKBA) loaded Zinc Oxide (ZnO) nanoparticles of which drug release behavior is UV-controlled has been successfully synthesized. Such nanoparticles can not only reflect UV but also transfer the energy to release AKBA which presents an excellent antioxidant and anti-inflammatory effects. In addition, they are biocompatible to HaCaT cells. As a result, they have a great potential in combining UV protection and medicine administration simultaneously for PLE protection and therapy. Keywords: PLE; ZnO; AKBA; UV radiation; prevention and treatment integrated

1. Introduction Polymorphous light eruption (PLE) is one of the acquired idiopathic photodermatosis with sunlight exposure and affects 10~20% of southern Scandinavians and North Americans [1]. Although the etiology and pathogenesis of PLE are still unclear, it is reported to be related to the direct exposure of UV that resulting in accumulation of free oxygen radicals, delayed type hypersensitivity and so on [2]. Therefore, the effective way to protect against PLE is staying in dark or using sunscreen while in going outdoors. For the treatment of PLE, immunosuppressants (such as corticosteroids, Imuran) are being used to reduce the immune response. In addition, antioxidants (such as vitamin C, vitamin E) are used to prevent oxidative damage [3, 4]. It should be noted that therapeutic process should keep away from light in order to avoid UV radiation, which hinders the

treatment on PLE [5]. However, to our best knowledge, there is no efficient method of combining UV protection and medicine administration simultaneously for PLE protection and therapy so far. Zinc Oxide (ZnO) is a kind of low-cost and resourceful metal oxide, and routinely used in sunscreens for UV protection. Moreover, we have found that ZnO nanoparticles (ZnO NPs) could transform between the hydrophobic and hydrophilic state under the UV radiation and dark stay to release loaded drugs [6]. Acetyl-11-keto-β-boswellic acid (AKBA), a frankincense isolated from Boswellia serrata plant bears a long medicinal history in traditional medication systems (Chinese and Ayurvedic), modulating the expression of stress responsive proteins like HO-1 via Nrf2/Bach1 pathway has neuroprotective [7, 8] and dermatoprotective functions [9]. It protects skin keratinocytes from UV-induced damage by modulating inflammatory mediators and ROS production [9], which has great potential in PLE therapy. Similar to chitosan loaded AKBA nanoparticles for enhanced neuroprotection [7], herein it can be predicted that loading AKBA on the surface of ZnO NPs would protect skin from UV radiation by ZnO NPs and release AKBA controlled by UV radiation in order to realize bioavailability, PLE protection and therapy simultaneously. Herein, we synthesized and characterized ZnO NPs and used them for AKBA loading in order to realize UV protection and AKBA administration simultaneously (Scheme 1). The controlled release behavior of AKBA from ZnO NPs under the UV illumination as well as the anti-inflammatory and antioxidant effect of AKBA loaded ZnO NPs (AKBA@ZnO NPs) will be investigated. Moreover, the cytotoxicity of AKBA@ZnO NPs will also be evaluated.

2. Materials and Methods 2.1. Materials Zinc acetate dihydrate (Zn(Ac)2·2H2O) (Gracia, China), NaOH, acetone (Chuangdong Chemical Co., China) were of analytical reagent grade and used as received unless otherwise noted. AKBA, with the purity≥98%, was obtained from ENZO Life Sciences. 3-[4,5-dimethyl-2-yl]-2,5-diphenyl-2H-tetrazolium bromide (MTT) was bought from Sigma. Immortalized human skin keratinocytes (HaCaT) cells were the kind donation of Prof. Dr. Rex M. Tyrrell, University of Bath, UK. Fetal bovine serum (FBS, TBD21HY), RPMI 1640 cell culture medium (HyClone), penicillin and streptomycin were purchased from North China Pharmaceutical Co., Ltd. 2.2. Synthesis of ZnO NPs ZnO NPs were prepared through homogeneous precipitation method. In brief, 5 mL of 4 mol/L Zn(Ac)2 solution was dropped into 10 mL of 10 mol/L NaOH solution with supersonic treatment. After the addition, the mixture was kept sonication for another 0.5 h. The precipitate was washed 3 times using deionized water and dried under vacuum, followed by calcined in muffle furnace at 600 ℃ for 5 h. 2.3. AKBA loading 0.20 mg of AKBA was dissolved in 5 μL of acetone and mixed with various mass ratios of ZnO NPs (AKBA: ZnO=1:100, 1:50, 1:10, 1:1, 10:1, 50:1, 100:1). 1 mL of deionized water was added in under ultrasonic treatment for 1 h during which the acetone was evaporated. Centrifugation was used to remove deionized water at 12000 rpm for 10 min to obtain AKBA@ZnO NPs, which were dried with N2. 1 mL of acetone was added in to dissolve the loading AKBA and separated by centrifuge at 12000 rpm for 10 min. The concentration of AKBA in the acetone was tested by

ultraviolet spectrophotometry (Lambda 900, Perkin Elmer, USA), which was used to calculate the AR and LC of AKBA on ZnO NPs according to the standard curve of AKBA in acetone as follows: AR%=Win / Wraw × 100% LC%=Win/WZnO × 100% where Win was the weight of AKBA in acetone, Wraw was the raw weight of AKBA used for loading, WZnO was the raw weight of ZnO used for AKBA loading. All the tests were repeated thrice. 2.4. Characterization The morphology and size of ZnO particles were observed by scanning electron microscopy (SEM, SU-70 HITACHI, Japan). The size distribution was tested at room temperature by a dynamic light scattering instrument (DLS, Zetasizer Nano S90, Malvern, UK). The elements composition was tested by energy dispersive spectroscopy (EDS, X-MaxN, Oxford Instruments, UK). The Infrared Spectrum of ZnO particles and AKBA@ZnO particles was determined by Fourier transform infrared spectrometer (FTIR, Spectrum GX Perkin Elmer, USA). 2.5. AKBA release behavior AKBA@ZnO NPs with optimal AR were used for UV-controlled release studies. They were spread evenly on the glass slides and placed in a darkroom equipped with a UV light (365 nm, 12 Watt) at 37 ℃. 5 experimental groups with three samples in each group were prepared. AKBA@ZnO NPs were exposed to UV radiation. At the certain time points (1, 2, 4, 6, 8 h), one group of AKBA@ZnO NPs were taken out and washed with 1 mL of acetone. The concentration of AKBA in the acetone, which was the released AKBA from ZnO NPs was determined by the ultraviolet spectrophotometry and represented its release behavior. Meanwhile, AKBA@ZnO NPs without UV radiation were set as controls. 2.6. Anti-inflammation effect The anti-inflammatory effects of AKBA@ZnO NPs against UV damage in HaCaT cells were assessed by qRT-PCR. To quantify gene expression levels, real-time q-PCR experiments were carried out using the Promega GoTaq® q-PCR Master Mix (A6001) in a Light Cycler apparatus (C1000 Touch; Bio-Rad). Specific primers were designed as follows: COX-2(F, ATGCTGACTATGGCTACAAAAGC; R, TCGGGCAATCATCAGGCAC); NFκB(F, AACAGAGAGGATTTCGTTTCCG; R, TTTGACCTGAGGGTAAGACTTCT). HaCaT cells were co-cultured with 2.5 μM of AKBA according to the release curve, during which cells were exposed to UV with the doses of 160 kJ/m2. All samples were analyzed triplicates. 2.7. Measurement of ROS The experimental cells were incubated with 10 μM of dihydroethidium in PBS for 30 min at 37 ℃, followed by washing with PBS thrice. The intracellular ROS were visualized under fluorescence microscope at the excitation and emission wavelengths of 480 nm and 530 nm, respectively. The images were quantified by the relative fluorescence intensity. 2.8. Cytotoxicity of AKBA@ZnO HaCaT cells were planted at a density of 8×103, in 96-well plates. After the 24 h incubation, pretreatment of cells with various concentrations (3.75, 6.25, 12.5 μg/mL) of ZnO NPs, AKBA and AKBA@ZnO NPs for additional 8 h and 24 h respectively. The viability of HaCaT cells was determined by MTT assay. Cells without any treatment were used as positive control to set the cellular viability to 100%.

3. Results 3.1. Preparation and characterization of ZnO NPs and AKBA@ZnO NPs The elemental composition of synthesized ZnO NPs was 63.87% of zinc and 15.52% of oxygen in weight (Figure 1a), proving that our product was ZnO. A little of carbon element in the EDS spectrum was from the sample support. SEM found that ZnO NPs were of analogously round and monodisperse structure (Figure 1b). And their size distribution was around 180 nm (Figure 1c). ZnO NPs were applied topically as a transparent and effective broad spectrum ultraviolet filter [10-12] and ZnO NPs containing sunscreens could availably prevent sunburn and photo-allergy due to accelerated skin ageing, immunosuppression and an increased risk of developing skin cancer[13]. Therefore, ZnO NPs were a good choice for anti-UV. The FTIR of ZnO NPs and AKBA@ZnO NPs was shown in Figure 1d. Compared to the spectrum of ZnO NPs, the adsorption at 1680.16 cm-1、1401.50 cm-1 and 916.13 cm-1 showed the existence of -COOH. The FTIR of AKBA@ZnO NPs appeared several intense bands at around 2926.52 cm−1, resulted from the increment of -CH3. All the FTIR results indicated that AKBA had been successfully loaded on the surface of raw ZnO NPs.

3.2. Adsorption rate and loading capacity of AKBA on ZnO NPs The dependency of adsorption rate (AR) and loading capacity (LC) on the mass ratio of ZnO NPs to AKBA were shown in Figure 2a and b. Although the highest AR could run up to 99.23±0.71% when the mass ratio of AKBA:ZnO was 1:100, the LC was unsatisfactory. In overall consideration, the mass ratio of 10:1 (AKBA:ZnO) received an optimal AR of 91.55±0.57%, and LC of 28.43±1.57%. Due to their stability, good biocompatibility and low cost, ZnO NPs have shown promising potential in drug delivery[14, 15]. Several structures of ZnO were employed to load drug. By adsorption, doxorubicin was loaded into nanoscale assembly of mesoporous ZnO and was released under the control of pH and ultrasound [16]. Another drug delivery system was composed of MSNs containing doxorubicin inside the polymer pores and ZnO naolids covering the pores. When the ZnO nanolides were decomposed and the doxorubicin was released from MSNs to kill the Hela cell [17]. Folic acid conjugated ZnO quantum dots was used for cytoplasm delivery of doxorubicin via complexation of doxorubicin with Zn2+ using ZnO quantum dots as a Zn2+ source [18]. Among all the drug delivery structures, ZnO nanorod could get the highest encapsulation efficiency up to 75.28% and its corresponding drug loading capacity was 20.08% resulting from their tremendous superficial area [19]. It was delighted that our analogously round and monodisperse ZnO NPs could get an optimal AR of 91.55±0.57%, and LC of 28.43±1.57%. 3.3. UV-controlled release behavior Realizing UV-controlled drug release was the key to design our AKBA@ZnO NPs potential for PLE therapy under the sunlight. So, the UV-controlled AKBA release behavior was studied. Under the initial UV radiation for 1 h, 43.24±1.36% of AKBA was released from AKBA@ZnO NPs. After 8 h’s UV radiation, the cumulative release percent of AKBA was up to 92.12±1.97%. In comparison to the AKBA@ZnO NPs without UV radiation, only 7.96±0.81% of AKBA was released after 8 h in dark stay (Figure 3), proving the stimulation effect of UV radiation due to the UV created hydrophobic/hydrophilic transition of ZnO NPs. Previously we have reported [6, 20] the contact angle of ZnO could decrease after UV radiation resulting in ZnO changing to the hydrophilic state under UV radiation by replacement of the oxygen with a hydroxyl group. While, the AKBA release from UV-responsive ZnO NPs was accelerated by UV radiation exposure.

Photo-responsive drug delivery systems have excited many interests because they could be externally applied to switch drug release on at a specific site, offering a method for controlling the release that was otherwise difficult to achieve using other stimuli (such as pH, temperature, electricity)[21-23]. And the light could be restricted in 1 mm2 so as to reduce the effect of stimuli and triggered release drug on the adjacent tissues to a minimum [24]. Moreover, UV and blue light were the suitable initiator to trigger the drug delivery systems that were used for skin and mucosa diseases therapy [25]. In consideration of AKBA@ZnO NPs could be triggered resulting in AKBA release by UV in which sunlight contained, we could infer that AKBA@ZnO NPs would hold a great potential in PLE therapy. 3.4. Antioxidant and anti-inflammatory effect AKBA@ZnO NPs could reflect and adsorb UV by ZnO, and transfer the radiative energy to release AKBA from ZnO. UV posed its effects mainly by producing ROS, which interacted with endogenous photosensitizers, damaged DNA, proteins and membranes [26-28]. AKBA was a promising natural product derivative that provide cells from oxidative damage through the Nrf2-ARE-driven antioxidant pathway [29]. In this study, a significant increase in fluorescent dihydroethidium staining occurred (Figure 4a insert), indicating high intracellular ROS levels induced by UV radiation. While, when the HaCaT cells were co-cultured with AKBA, the relative intensity of ROS significantly decreased by 17% (Figure 4a). ROS accumulated in cells disturbed the cellular redox homeostasis generating a range of aldehydes and carbonyls, of which one such compound was malondialdehyde [30]. UV induced ROS and other free radicals are detoxified by the superoxide dismutase, which catalyzed the superoxides anion free radical into O2 and H2O2, resulting in the protection against oxidative damage [31]. AKBA boosted the induction of SOD expression to a high level leading the decrease of MDA and ROS to mediate cytoprotection of UV induced HaCaT cells against oxidative stress [9], which played an important role in pathogenesis of PLE [32]. Reducing the immune response was an effective method for PLE therapy, so we also studied the expression levels of inflammatory factors including COX-2 and NFκB in HaCaT cells through q-PCR. AKBA@ZnO NPs could significantly reduce the UV induced COX-2 level from 1.74-fold to 1.10-fold as well as NFκB from 1.18-fold to 0.73-fold (Figure 4b), indicating a good anti-inflammatory effect of AKBA@ZnO NPs. Activation of the Nrf2-ARE-driven gene regulatory pathway by a variety of natural compounds conferred chemoprevention against various diseases of oxidative stress origin [33]. This pathway was considered as a promising therapeutic target for natural phytochemicals derived from various natural products mainly by evoking Nrf2-directed antioxidant and anti-inflammatory responses [34]. AKBA, is one of the pharmacologically potent ingredient, reported as a natural inhibitor of NFκB and its downstream genes. Meanwhile, it mediated anti-inflammatory responses by suppressing lipoxygenases and COX-2 production [35]. 3.5. Biocompatibility Biocompatibility was the key concern of biomaterials and their applications in clinic [36-38]. The cytotoxicity assay here was used to evaluate the potential application of AKBA@ZnO NPs for skin. Even though previous studies insisted that particles with diameters lower than 5 nm could penetrate the epidermis and reach the dermis [39], we still tested the influences of AKBA@ZnO NPs on the growth of HaCaT cells. Our results (Figure 5) showed that the cellular viability in the highest concentration of AKBA@ZnO NPs (12.5 µg/mL) were 76.64±1.24% which was compatible to HaCaT cells, indicating their probability in using in PLE therapy. On the other hand, some other studies found that ZnO could be a source of Zn2+ that would enter the body via dermal penetration leading to biotoxicity [40-42]. Therefore, the detailed effects of our AKBA@ZnO NPs needed further investigation before being used in clinic.

4. Discussion Herein, AKBA@ZnO NPs were applied for the PLE protection and therapeutics for they can realize UV protection and cytoprotection simultaneously. The HaCaT cells play an important role in the disease, were used to test the therapeutic effects of AKBA@ZnO NPs. In another study, AKBA alone or by loading on chitosan nanoparticles showed a protective effects on neuron cells under ischemic injury via Nrf2/HO-1 signaling pathway [7, 8]. AKBA mainly help reduce the expression of the transcriptional repressor Bach1 (BTB and CNC Homology 1) protein, facilitating Nrf2 to attach its downstream genes to activate their expression and hence safeguard the cells under stress by down regulating inflammatory factors [9]. In a very mimicking study [43], the results reported that AKBA (2 μg/mL) is protective and optimal therapeutic concentration for the successful regeneration of injured sciatic nerves both in vivo and in vitro. Moreover, in renal interstitial fibrosis, AKBA proves itself as a potential drug that not only reduced this condition, but also showed reno-protective effects via Klotho/TGF-β/Smad signaling cascade [44]. Current study have attempted to investigate the biological effect of AKBA@ZnO NPs on human skin cells only to find AKBA potential for curing various skin conditions as described in various traditional Chinese medication systems mainly by Boswellia gum. AKBA is the drug having both cytotoxic and cytoprotective effects depending upon the concentration being applied i.e., low concentration of AKBA pose protective effects while higher concentration give cytotoxic effects. Regarding the anticancer properties, a study reported that AKBA inhibited the growth in different colon cancer cells at G1 phase of cell cycle via p21 [45]. Moreover, AKBA along with its sister compounds (Boswellic Acids), have strong anti-proliferative effects by inducing apoptosis in human HT-29 cells via activation of caspase-8 [46]. Many studies reported similar antitumor effects of AKBA in different cancer types, when used in higher concentrations [47-50]. ZnO and AKBA may hold a great potential in anti-cancer therapies, and would be our focus in near future. Many other drugs especially Brusatol is reported in a recent study that detailed its effects on the oxidative stress responsive protein Nrf2 mediated apoptotic pathways to kill the melanoma cells [51]. But AKBA is a potential inhibitor of Bach1 repressor protein, hence allowing the Nrf2 to activate its downstream cytoprotective pathways to protect the cells [9]. Comparing both these drugs (Brusatol and AKBA), it is a dire need to explore a cross talk, at which point AKBA switches on an apoptotic machinery of the cells. ZnO nanoparticles are superior drug delivery carriers in recent years. However, in current study, the UV reflection properties have been utilized to reduce radiation effects as ZnO itself can accommodate many of the energy rich photons and some of the photons help release AKBA molecules, hence additional protection to the cells in case of excessive UVA exposure releasing ROS efflux. In conclusion, AKBA loaded ZnO NPs have been successfully synthesized of which drug release behavior was UV-controlled. AKBA@ZnO NPs could not only reflect UV but also transfer the energy to release AKBA which owns an excellent antioxidant and anti-inflammatory effect. In view of their good biocompatibility, AKBA@ZnO NPs have a great potential in combining UV protection and medicine administration simultaneously for PLE protection and therapy.

Acknowledgments: This work is supported by the National Natural Science Foundation of China (No. 81271776, 81573073, 81860324), Science and Technology Cooperation Project of Guizhou Province

(LH20157237), Science and Technology fund of Guizhou Province (20161152), Key Grant of Guizhou Education Committee (KY2015399), Incubation Project of Tongren University Science Park (trxykjy2017005) and Key Grant of Chongqing Basic Science and Frontier Technology Research Project(cstc2017jcyjBX0044).

References

1. 2. 3.

4.

5.

6.

7.

8.

9.

10.

11.

Hawk, J., Abnormal responses to ultraviolet radiation: idiopathic. Dermatology in general medicine, 1993. Gruber-Wackernagel, A., Byrne, S.N. and Wolf, P. Polymorphous light eruption: clinic aspects and pathogenesis. Dermatologic clinics, 2014. 32(3): p. 315-334. Bakardzhiev, I., Chokoeva, A.A., Krasnaliev, I., Tana, C., Wollina, U., Lotti, T. and Tchernev, G. Unilateral unique Lupus tumidus: pathogenetic mystery and diagnostic problem. Wiener Medizinische Wochenschrift, 2016. 166(7-8): p. 250-253. Eberlein‐König, B., Fesq, H., Abeck, D., Przybilla, B., Placezke, M. and Ring, J. Systemic vitamin C and vitamin E do not prevent photoprovocation test reactions in polymorphous light eruption. Photodermatology, photoimmunology & photomedicine, 2000. 16(2): p. 50-52. Bissonnette, R., Nigen, S. and Bolduc, C. Influence of the quantity of sunscreen applied on the ability to protect against ultraviolet induced polymorphous light eruption. Photodermatology, photoimmunology & photomedicine, 2012. 28(5): p. 240-243. Huang, X., Wang, X., Wang, S., Yang, J., Zhong, L. and Pan, J. UV and dark-triggered repetitive release and encapsulation of benzophenone-3 from biocompatible ZnO nanoparticles potential for skin protection. Nanoscale, 2013. 5(12): p. 5596-5601. Ding, Y., Qiao, Y., Wang, M., Zhang, H., Li, L., Zhang, Y., Ge, J., Song, Y., Li, Y. and Wen, A. Enhanced neuroprotection of acetyl-11-keto-β-boswellic acid (AKBA)-loaded O-carboxymethyl chitosan nanoparticles through antioxidant and anti-inflammatory pathways. Molecular neurobiology, 2016. 53(6): p. 3842-3853. Ding, Y., Chen, M., Wang, M., Wang, M., Zhang, T., Park, J., Zhu, Y., Guo, C., Jia, Y., Li, Y. and Wen, A. Neuroprotection by acetyl-11-keto-β-boswellic acid, in ischemic brain injury involves the Nrf2/HO-1 defense pathway. Scientific reports, 2014. 4: p. 7002. Yang, S., Zhou, B., Xu, W., Xue, F., Nisar, M.F., Bian, C., Huang, X., Yang, L., Zhang, Y., Bartsch, J.W. and Zhong, J.L. Nrf2-and Bach1 May Play a Role in the Modulation of Ultraviolet A-Induced Oxidative Stress by Acetyl-11-Keto-β-Boswellic Acid in Skin Keratinocytes. Skin pharmacology and physiology, 2017. 30(1): p. 13-23. Lu, P., Cheng, W.L., Huang, S.C., Chen, Y.P., Chou, H.K. and Cheng, H.F. Characterizing titanium dioxide and zinc oxide nanoparticles in sunscreen spray. International journal of cosmetic science, 2015. 37(6): p. 620-626. McCormick, P.G. and Tsuzuki, T. In vitro testing of zinc oxide sunscreens. International journal of cosmetic science, 2012. 34(4): p. 291-297.

12.

13. 14. 15.

16. 17.

18.

19.

20.

21.

22.

23.

24.

25.

Beasley, D.G. and Meyer, T.A. Characterization of the UVA protection provided by avobenzone, zinc oxide, and titanium dioxide in broad-spectrum sunscreen products. American journal of clinical dermatology, 2010. 11(6): p. 413-421. Nohynek, G., E. Dufour, and Roberts, M. Nanotechnology, cosmetics and the skin: is there a health risk? Skin pharmacology and physiology, 2008. 21(3): p. 136-149. Xiong, H.M., ZnO nanoparticles applied to bioimaging and drug delivery. Advanced Materials, 2013. 25(37): p. 5329-5335. Huang, X., Zheng, X., Xu, Z. and Yi, C. ZnO-based nanocarriers for drug delivery application: From passive to smart strategies. International journal of pharmaceutics, 2017. 534(1-2): p. 190-194. Barick, K., S. Nigam, and Bahadur, D. Nanoscale assembly of mesoporous ZnO: A potential drug carrier. Journal of Materials Chemistry, 2010. 20(31): p. 6446-6452. Muhammad, F., et al., pH-triggered controlled drug release from mesoporous silica nanoparticles via intracelluar dissolution of ZnO nanolids. Journal of the American chemical society, 2011. 133(23): p. 8778-8781. Muhammad, F., Guo, M., Qi, W., Sun, F. Wang, A. Guo, Y. and Zhu, G. Acid degradable ZnO quantum dots as a platform for targeted delivery of an anticancer drug. Journal of materials chemistry, 2011. 21(35): p. 13406-13412. Zhang, H., Chen, B., Jiang, H., Wang, C., Wang, H. and Wang, X. A strategy for ZnO nanorod mediated multi-mode cancer treatment. Biomaterials, 2011. 32(7): p. 1906-1914. Huang, X., Lu, J., Yue, D., Fan, Y., Yi, C., Wang, X., Zhang, M. and Pan, J. Fe3O4@ZnO core-shell nanocomposites for efficient and repetitive removal of low density lipoprotein in plasma and on blood vessel. Nanotechnology, 2015. 26(12): p. 125101. Huang, X., Zheng, X., Yi, C. and Yin, S. P(BA-co-HBA) coated Fe3O4@ ZnO nanoparticles as photo-responsive multifunctional drug delivery systems for safer cancer therapy. Nano, 2016. 11(05): p. 1650057. Cardano, F., Frasconi, M. and Giordani, S. Photo-responsive graphene and carbon nanotubes to control and tackle biological systems. Frontiers in chemistry, 2018. 6: p. 102. Zhao, Y., Wei, C., Chen, X., Liu, J., Yu, Q., Liu, Y. and Liu, J. Drug delivery system based on near-infrared light-responsive molybdenum disulfide nanosheets controls the high-efficiency release of dexamethasone to inhibit inflammation and treat osteoarthritis. ACS applied materials & interfaces, 2019. 11(12): p. 11587-11601. Jiang, J., Tong, X., Morris D. and Zhao, Y. Toward photocontrolled release using light-dissociable block copolymer micelles. Macromolecules, 2006. 39(13): p. 4633-4640. Kong, F., Huang, X., Yue, D. and Pan, J. A biocompatible and magnetic nanocarrier with a safe UV-initiated docetaxel release and cancer secretion removal properties increases therapeutic potential for skin cancer. Materials Science and Engineering: C, 2017. 76: p. 579-585.

26.

27.

28.

29.

30.

31. 32.

33.

34.

35.

36.

37.

38.

Zhao, S., Liu, T., Wang, B. Fu, J., Liang, T., Zhong, Z., Zhan, J. and Liu, L. Accumulation, biodegradation and toxicological effects of N-ethyl perfluorooctane sulfonamidoethanol on the earthworms Eisenia fetida exposed to quartz sands. Ecotoxicology and environmental safety, 2019. 181: p. 138-145. Bhattacharyya, S. and Saha, J. Tumour, oxidative stress and host T cell response: cementing the dominance. Scandinavian journal of immunology, 2015. 82(6): p. 477-488. Wu, B., Li, Y., Su, K., Tan, L., Liu, X., Cui, Z., Yang, X., Liang, Y., Li, Z., Zhu, S., Yeung, K.W.K. and Wu, S. The enhanced photocatalytic properties of MnO2/g-C3N4 heterostructure for rapid sterilization under visible light. Journal of hazardous materials, 2019. 377: p. 227-236. Williamson, T.P., Johnson, D.A. and Johnson, J.A. Activation of the Nrf2-ARE pathway by siRNA knockdown of Keap1 reduces oxidative stress and provides partial protection from MPTP-mediated neurotoxicity. Neurotoxicology, 2012. 33(3): p. 272-279. Yan, S., Hong, X., Hu, Y., Liao, K. Tempol, one of nitroxides, is a novel ultraviolet-A1 radiation protector for human dermal fibroblasts. Journal of dermatological science, 2005. 37(3): p. 137-143. Ahmed, F. and Schenk, P.M. UV–C radiation increases sterol production in the microalga Pavlova lutheri. Phytochemistry, 2017. 139: p. 25-32. Hadshiew, I., Treder-Conrad, C., v Bülow, R., Klette, E., Mann, T., Stäb, F., Moll, I. and Rippke, F. Polymorphous light eruption (PLE) and a new potent antioxidant and UVA‐ protective formulation as prophylaxis. Photodermatology, photoimmunology & photomedicine, 2004. 20(4): p. 200-204. Chang, K.M., Liang, FP., Chen, I.L., Yang, S.C., Juang, S.H., Wang, T.C., Chen, Y.L. and Tzeng, C.C. Discovery of oxime-bearing naphthalene derivatives as a novel structural type of Nrf2 activators. Bioorganic & medicinal chemistry, 2015. 23(13): p. 3852-3859. Raval, C.M., Zhong, J.L., Mitchell, S.A. and Tyrrell, R.M. The role of Bach1 in ultraviolet A-mediated human heme oxygenase 1 regulation in human skin fibroblasts. Free Radical Biology and Medicine, 2012. 52(1): p. 227-236. Holmes, S., Singh, M., Su, C. and Cunningham, R.L. Effects of oxidative stress and testosterone on pro-inflammatory signaling in a female rat dopaminergic neuronal cell line. Endocrinology, 2016. 157(7): p. 2824-2835. Li, D., Hu, X. and Zhang, S. Biodegradation of graphene-based nanomaterials in blood plasma affects their biocompatibility, drug delivery, targeted organs and antitumor ability. Biomaterials, 2019. 202: p. 12-25. Li, Z., Zhang, Y. and Feng, N. Mesoporous silica nanoparticles: synthesis, classification, drug loading, pharmacokinetics, biocompatibility, and application in drug delivery. Expert opinion on drug delivery, 2019. 16(3): p. 219-237. Tsagogiorgas, C., Anger, F., Beck, G., Breedijk, A., Yard, B. and Hoeger, S. Impact of different emulsifiers on biocompatibility and inflammatory potential of

39. 40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

Perfluorohexyloctane (F6H8) emulsions for new intravenous drug delivery systems. Drug Design, Development and Therapy, 2019. 13: p. 2097-2110. Hackenberg, S. and Kleinsasser, N. Dermal toxicity of ZnO nanoparticles: a worrying feature of sunscreen? Nanomedicine, 2012. 7(4): p. 461-463. Osmond-McLeod, M.J., Oytam, Y., Kirby, J.K., Gomez-Fernandez, L., Baxter, B. and McCall, M.J. Dermal absorption and short-term biological impact in hairless mice from sunscreens containing zinc oxide nano-or larger particles. Nanotoxicology, 2014. 8(sup1): p. 72-84. Holmes, A.M., Song, Z., Moghimi, H.R. and Roberts, M.S. Relative penetration of zinc oxide and zinc ions into human skin after application of different zinc oxide formulations. ACS nano, 2016. 10(2): p. 1810-1819. Leite-Silva, V.R., Liu, D.C., Sanchez, W.Y., Studier, H., Mohammed, Y.H., Holmes, A., Becker, W., Grice, J.E., Benson, H.A. and Roberts, M.S. Effect of flexing and massage on in vivo human skin penetration and toxicity of zinc oxide nanoparticles. Nanomedicine, 2016. 11(10): p. 1193-1205. Jiang, X.W., Zhang, B.Q., Qiao, L., Liu, L., Wang, X.W. and Yu, W.H. Acetyl-11-keto-β-boswellic acid extracted from Boswellia serrata promotes Schwann cell proliferation and sciatic nerve function recovery. Neural regeneration research, 2018. 13(3): p. 484-491. Liu, M., Liu, T., Shang, P., Zhang, Y., Liu, L., Liu, T. and Sun, S. Acetyl 11 keto β boswellic acid ameliorates renal interstitial fibrosis via Klotho/TGF β/Smad signalling pathway. Journal of cellular and molecular medicine, 2018. 22(10): p. 4997-5007. Liu, J.J., Huang, B. and Hooi, S.C. Acetyl keto β boswellic acid inhibits cellular proliferation through a p21 dependent pathway in colon cancer cells. British journal of pharmacology, 2006. 148(8): p. 1099-1107. Liu, J.J., Nilsson, A., Oredsson, S., Badmaev, V., Zhao, W.Z. and Duan, R.D. Boswellic acids trigger apoptosis via a pathway dependent on caspase-8 activation but independent on Fas/Fas ligand interaction in colon cancer HT-29 cells. Carcinogenesis, 2002. 23(12): p. 2087-2093. Park, Y.S., Lee, J.H., Harwalkar, J.A., Bondar, J., Safayhi, H. and Golubic, M. Acetyl-11-keto-β-boswellic acid (AKBA) is cytotoxic for meningioma cells and inhibits phosphorylation of the extracellular-signal regulated kinase 1 and 2. Advances in Experimental Medicine and Biology, 2002. 507: p. 387-393. Liu, J.J., Nilsson, Ake., Oredsson, S., Badmaev, V. and Duan, R.D. Keto-and acetyl-keto-boswellic acids inhibit proliferation and induce apoptosis in Hep G2 cells via a caspase-8 dependent pathway. International journal of molecular medicine, 2002. 10(4): p. 501-505. Syrovets, T., Gschwend, J.E., Büchele, B., Laumonnier, Y., Zugmaier, W., Genze, F, and Simmet, T. Inhibition of IκB kinase activity by acetyl-boswellic acids promotes apoptosis in androgen-independent PC-3 prostate cancer cells in vitro and in vivo. Journal of Biological Chemistry, 2005. 280(7): p. 6170-6180.

50.

51.

Hoernlein, R., Orlikowshy, T., Zehrer, C., Niethammer, D., Sailer, E.R., Simmet, T. Dannecker, G.E. and Ammon, H.P. Acetyl-11-keto-β-boswellic acid induces apoptosis in HL-60 and CCRF-CEM cells and inhibits topoisomerase I. Journal of Pharmacology and Experimental Therapeutics, 1999. 288(2): p. 613-619. Wang, M., Shi, G., Bian, C., Nisar, M.F., Guo, Y., Wu, Y., Li, W., Huang, X., Jiang, X., Bartsch, J.W., Ji, P. and Zhong, J.L. UVA irradiation enhances Brusatol-mediated inhibition of melanoma growth by downregulation of the Nrf2-mediated antioxidant response. Oxidative medicine and cellular longevity, 2018. 2018:p.9742154.

Figure Captions Scheme 1 The illustration of UV protection and AKBA administration simultaneously using AKBA@ZnO NPs

Figure 1. Characterization of ZnO particles and AKBA@ZnO NPs. a, EDX of ZnO NPs; b, SEM image of ZnO NPs; c, The size of ZnO NPs; d, FTIR of ZnO NPs and AKBA@ZnO NPs.

Figure 2. The dependence of AR (a) and LC (b) of AKBA on ZnO NPs on the mass ratio of AKBA to ZnO.

Figure 3. The UV-controlled release behavior of AKBA.

Figure 4. AKBA@ZnO modulates UV induced oxidative stress (a) and inflammatory response (b) in HaCaT cells. (*, p<0.05)

Figure 5 The cytotoxicity of AKBA@ZnO NPs.

1. An intelligent drug delivery system applied for the PLE protection and therapeutics has been successfully synthesized.

2. This delivery system could not only reflect UV but also transfer the energy to release AKBA.

3. This drug delivery system owns satisfying antioxidant and anti-inflammatory effect.