- Email: [email protected]
UVA-induced melanogenesis and modulation of glutathione redox system in different melanoma cell lines: The protective effect of gallic acid
Journal of Photochemistry and Photobiology B: Biology 108 (2012) 16–22
Contents lists available at SciVerse ScienceDirect
Journal of Photochemistry and Photobiology B: Biology journal homepage: www.elsevier.com/locate/jphotobiol
UVA-induced melanogenesis and modulation of glutathione redox system in different melanoma cell lines: The protective effect of gallic acid Uraiwan Panich a,⇑, Tasanee Onkoksoong a, Saowalak Limsaengurai a, Pravit Akarasereenont a,b, Adisak Wongkajornsilp a a b
Department of Pharmacology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand Center of Applied Thai Traditional Medicine, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand
a r t i c l e
i n f o
Article history: Received 30 September 2011 Received in revised form 8 November 2011 Accepted 6 December 2011 Available online 28 December 2011 Keywords: Ultraviolet A Melanogenesis Glutathione Redox Gallic acid
a b s t r a c t Oxidative stress has been suggested to play a role in ultraviolet A (UVA)-mediated melanogenesis. Glutathione (GSH) and GSH-related enzymes including c-glutamate cysteine ligase (c-GCL) and glutathione S-transferase (GST) are important antioxidant defenses responsible for maintaining cellular redox balance. Hence, improving GSH redox system to cope with oxidative insults may be essential for attenuation of abnormal melanin production. Gallic acid (GA), a dietary phenolic, has been shown to provide beneficial effects against hyperpigmentation possibly through its antioxidant properties. This study thus aimed to assess the antimelanogenic action of GA with regard to modulation of GSH–GCL system and GST in two melanoma cell lines, lightly pigmented G361 human melanoma and more pigmented B16F10 mouse melanoma cells, irradiated with UVA. G361 cells were shown to have lower basal GSH content and GST activity than B16F10 cells. Moreover, GA provided antimelanogenic effects in correlation with promotion of GSH levels, GST activity as well as c-GCL and GST mRNA in both G361 and B16F10 cells at 2-h post-irradiation. In summary, GA exhibits protective effects on UVA-mediated melanogenesis possibly through improvement of GSH-related antioxidant defenses. Furthermore, different redox state in G361 and B16F10 cells may affect the responses of melanoma cells to GA. Ó 2011 Elsevier B.V. All rights reserved.
1. Introduction Ultraviolet (UV) radiation has been recognized as a primary environmental factor implicated in alteration of melanin synthesis, mainly regulated by tyrosinase in melanocytes and/or melanoma cells [1]. Damaging effects on the skin due to overproduction of melanin has been extensively studied because melanin can possess either photoprotective or phototoxic properties and its excess could therefore be biologically toxic and mutagenic that probably increases malignant melanoma risk, especially in light-skinned individuals [2]. UVA (400–315 nm) has been demonstrated to trigger melanogenesis in association with increased oxidative stress caused by excessive production of oxidants and/or deterioration of antioxidant defense network in melanocytes and/or melanoma cells [3,4]. Glutathione (GSH) and its related enzymes including c-glutamate cysteine ligase (c-GCL) consisting of a catalytic subunit (c-GCLC) and modifier subunit (c-GCLM), the rate-limiting enzyme for GSH synthesis, and glutathione S-transferase (GST), are
⇑ Corresponding author. Tel.: +66 (0)2 419 7569; fax: +66 (0)2 411 5026. E-mail address: [email protected] (U. Panich). 1011-1344/$ - see front matter Ó 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.jphotobiol.2011.12.004
important endogenous antioxidants in various tissues including the skin. GSH redox system is essential for protecting the skin against photooxidative stress through maintaining intracellular redox balance and detoxifying xenobiotics and oxidants [5,6]. Since there is a correlation between melanogenesis and intracellular redox state primarily maintained by thiol-based antioxidants, in particular GSH, GSH–GCL system and GST probably thus play a crucial role either in regulation of pigmentation or in adaptation to melanogenesis-mediated oxidative stress. Therefore, potentiating the capacity of GSH redox system to maintain redox balance might be useful for control of melanogenesis. Gallic acid (GA) is an antioxidant phenolic distributed in medicinal and dietary plants widely developed as potential antimelanogenic agents [7], although the mechanisms by which cellular redox state influences melanogenesis are complex and therefore antimelanogenic action of GA involving GSH-related antioxidants needs elucidation. It has been suggested that differences in melanin content in darkly and lightly pigmented melanocytes contributed to various responses of the cells that include DNA damage and cell death induced by UVB irradiation implicated in photocarcinogenesis, particularly in fair/light skin [8,9]. Low levels of antioxidant content and/or activity in lightly pigmented cells could make them
U. Panich et al. / Journal of Photochemistry and Photobiology B: Biology 108 (2012) 16–22
continuously exposed to an oxidative environment and predisposed to oxidative damage and loss of cell homeostasis. In addition, different redox status represented in various pigment cell types could also in turn affect melanogenesis in response to UV irradiation [10]. Our study was therefore performed using two melanoma cell lines, lightly pigmented G361 human melanoma cell line and more pigmented B16F10 mouse melanoma cell line. Lightly pigmented cells generally have increased susceptibility to oxidative damage induced by UVR [8]. B16F10 cells are more pigmented and have commonly been used as models for the study of antimelanogenic effects and mechanisms of putative depigmenting compounds [11]. Our study thus evaluated the effects of UVA radiation on melanogenic and GSH-related antioxidant responses in both cell lines and explored the underlying mechanisms of GA in inhibiting UVA-induced melanogenesis involving modulation of GSH redox system including c-GCL and GST at the cellular and molecular level.
2. Materials and methods
17
2.4. Cell viability assay Metabolically viable cells were evaluated by reduction of 3-(4,5-dimethylthiazol-2-yl) 2,2 diphenyltetrazolium bromide (MTT) to the purple formazan. Absorbance of the formazan was measured at 595 nm by a spectrophotometer (SpectraMax M2 of Molecular Device, CA, USA). Cell viability is expressed as a percentage of the control (100%, non-irradiated and untreated cells). 2.5. Melanin content assay An evaluation of melanin production was performed as described previously [12]. Cells were collected at 1 h after UV radiation and the cell pellets were solubilized in 1 N NaOH for 1 h to dissolve melanin. The melanin content was then determined spectrophotometrically at 475 nm and calculated by comparison to a standard curve derived using synthetic melanin. The results are expressed as a percentage of the melanin content (lg/mg protein) of non-irradiated and untreated control cells (100%).
2.1. Materials
2.6. Tyrosinase activity assay
G361 and B16F10 cell lines from American Type Culture Collection (ATCC, Rockville, MD, USA) was a gift from Assoc. Prof. Tengamnuay, Faculty of Pharmaceutical Sciences, Chulalongkorn University and Assoc. Prof. Wajjwalku, Faculty of Veterinary Medicine, Kasetsart University, respectively. Dulbecco’s modified Eagle medium (DMEM) and all cell culture reagents were purchased from Invitrogen (NY, USA). Chemicals and reagents of the highest quality available were used and purchased from Sigma–Aldrich (MO, USA or Germany).
The rate of L-DOPA oxidation was measured to assess cellular tyrosinase activity in G361 and B16F10 cells exposed to a UVA dose of 8 J/cm2. The assay was performed as previously described [12]. Briefly, 20 mM L-DOPA used as the substrates was added to each lysate in a 96-well plate and absorbance of dopachrome formation was measured spectrophotometrically at 475 nm every 10 min for 1 h at 37 °C by a spectrophotometer. The tyrosinase activity was calculated by comparison to a standard curve using tyrosinase (2034 U/mg) and was expressed as unit/mg protein. The data are expressed as a percentage of the tyrosinase activity (unit/mg protein) of non-irradiated and untreated control cells (100%).
2.2. Cell cultures G361 and B16F10 cells were grown in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% penicillin (100 units/ ml)/streptomycin (100 lg/ml) and maintained at 37 °C in a humidified air of 5% CO2 (PCO2 = 40 Torr) (a Forma Scientific CO2 Water Jacketed Incubator).
2.3. Treatment of cells with UVA irradiation and gallic acid Cells were treated with GA dissolved in water (7.5, 15, 30, 60 lM) for up to 30 min prior to UVA irradiation for all assays and for 24 h to examine the cytotoxicity. DMEM was replaced with phosphate buffered saline (PBS) to avoid generation of medium-derived toxic photoproducts prior to UVA (320–400 nm) irradiation. Dose-dependent effects of UVA irradiation on melanin production in both cell lines were investigated using the UVA doses of 4, 8 and 16 J/cm2. The UVA doses selected in our study were non-cytotoxic to both G361 [12] and B16F10 cells (data not shown) and were physiologically relevant. Cells were collected at various times after UVA irradiation and assayed for GSH content, GST activity and mRNA expression. The UVA source was a xenon arc lamp (Dermalight ultrA1; Hoenle, Martinsried, Germany). For preparation of cell lysate, the harvested cells were pelleted by centrifugation and lysed in lysis buffer containing 50 mM Tris– HCl, 10 mM ethylene diaminetetraacetic acid (EDTA), 1% (v/v) Triton X-100, phenylmethylsulfonyl fluoride (PMSF) (100 mg/ml) and pepstatin A (1 mg/ml) in DMSO and leupeptin (1 mg/ml) in H2O, pH 6.8. The cells were centrifuged at 10,000 rpm for 10 min and the total cell lysate was collected and stored at 80 °C.
2.7. Measurement of intracellular glutathione content Determination of intracellular GSH content was based on the reaction of GSH with the fluorescent probe o-phthalaldehyde (OPA) at pH 8 as previously described [13]. Briefly, cells were lysed with ice-cold 6.5% (w/v) trichloroacetic acid (TCA). TCA extract was added to 96-well fluorescence plates followed by the addition of buffer (100 mM KH2PO4, 10 mM EDTA and 1 mM NaOH) and OPA (1 mg/ml in methanol). The fluorescence of the GSH-OPA adduct was measured with excitation and emission wavelengths of 350 and 420 nm, respectively. The GSH content was calculated by comparing the valued obtained with a standard curve of GSH. The results are expressed as a percentage of the GSH content (nmol/mg protein) of the non-irradiated and untreated control cells (100%). 2.8. Measurement of glutathione-S-transferase activity GST activity was assessed following the kit protocol from Cayman chemical (Ann Arbor, MI). GST catalyzed the conjugation of GSH with 1-chloro-2,4-dinitrobenzene (CDNB) to form the GSDNB conjugate which was then determined spectrophotometrically at 340 nm immediately and every 30 s for 10 min. 10 ll of 100 mM CDNB was added to start the reaction of 20 ll of sample or positive control GST with 20 ll of 200 mM GSH in 150 ll of assay buffer (100 mM potassium phosphate, pH 6.5, containing 0.1% Triton X-100). One unit of GST activity is defined as the amount of enzyme generating 1 lmol of GS-DNB conjugate/min. The data are expressed as a percentage of the GST activity (lmol/min/mg protein) of the non-irradiated and untreated control cells (100%).
18
U. Panich et al. / Journal of Photochemistry and Photobiology B: Biology 108 (2012) 16–22
2.9. Determination of protein content
3. Results
Protein concentration was measured using the Bio-Rad Protein Assay Kit (Bio-Rad, Germany) and bovine serum albumin (BSA) was used as protein standard.
3.1. GA at non-cytotoxic concentrations inhibited melanin content and tyrosinase activity in G361 and B16F10 cells
2.10. Determination of intracellular oxidant formation The assay is based on oxidation of non-fluorescent dichlorofluorescein (DCFH) by intracellular ROS (e.g., H2O2) to fluorescent 2, 7-DCF which could reflect oxidant formation mediated by UVA irradiation. After UVA irradiation, GA-treated cells and untreated cells were incubated in DMEM without phenol red and preloaded with 5 lM DCFHDA for 1 h at 37 °C. DCF fluorescence intensity for ROS formation was evaluated for 30 min at excitation/emission wavelengths of 485/530 nm using a spectrofluorometer. The data are expressed as a percentage of intracellular oxidant formation (relative fluorescence units, RFUs) of the non-irradiated and untreated control cells (100%). 2.11. Quantitative real-time reverse transcriptase–polymerase chain reaction: measurement of tyrosinase, c-GCLC, c-GCLM and GST mRNA expression For the time-course study, mRNA expression in G361 and B16F10 cells was determined at 2, 4, 8 and 16 h after UVA irradiation. In addition, modulation of mRNA expression by GA (7.5–30 lM) in UV-irradiated cells was assessed at 2 h after UVA irradiation (8 J/cm2). Total RNA was isolated using the illustra RNAspin Mini RNA Isolation Kit (GE Healthcare, UK). Reverse transcription was carried out with 1 lg of total RNA using the Improm-II reverse transcriptase (Promega, Medison, USA) under the conditions described in the kit manual. Reactions were performed in triplicate for each sample in the ABI Prism 7500 Real Time PCR System (Applied Biosystems, USA) under the following amplification conditions: 95 °C for 10 min, 40 cycles of 95 °C for 15 s, 60 °C for 40 s, and 72 °C for 40 s. Real-time RTPCR was performed in a total volume of 25 ll of reaction mixtures containing 5 ll cDNA template with FastStart universal SYBR Green Master (ROX) and 10 lM concentrations of primers. Primers for PCR were designed using the Primer Express software version 3.0 (Applied Biosystems, USA). Sequences of PCR primer sets of c-GCL-C, c-GCL-M, GST and GAPDH (in 5-3 direction) were as follows: c-GCLC sense (product sizes = 160 bp), GCTGTCTTGCAGGGAATGTT, and antisense, ACACACCTTCCTTCCCATTG; c-GCLM sense (product sizes = 200 bp), TTGGAGTTGCACAGCTGGATTC, and antisense, TGGTTTTACCTGTGCCCACTG; GST sense (product sizes = 72 bp), CCTGTACCAGTCCAATACCATCCT, and antisense, TCCTGCTGGTCCTTCCCATA; GAPDH sense (product size = 124 bp), GAAATCCCATCACCATCTTCC, and antisense, AAATGAGCCCCAGCCTTCTC. The mRNA level was normalized with reference to the amount of housekeeping gene transcripts (GAPDH mRNA). The mean Ct from mRNA expression in cDNA from each sample was compared with the mean Ct from GAPDH determinations from the same cDNA samples. 2.12. Statistical analysis Data are expressed as means ± standard error of the mean (SEM) of separate experiments (n P 3) performed on different days using freshly prepared reagents. The significance of non-irradiated controls or individual treatment groups in comparison to the UVAirradiated groups was evaluated by independent t-test (Student’s; 2 populations) or one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test, where appropriate, using Prism (GraphPad Software Inc., San Diego, CA).
Cytotoxicity of GA on both cell lines was first assessed in order to confirm that the protective effects of GA against UVA-induced melanin synthesis were not due to decreased cell number. The addition of GA up to 60 lM to the cells did not cause a remarkable reduction of cell viability as evaluated by MTT assay (Fig. 1A). To determine the antimelanogenic effects of GA, we first investigated the dose-dependent effect of UVA irradiation (4, 8 and 16 J/ cm2) on melanin content in G361 cells or B16F10 cells. Non-UVAirradiated control G361 and B16F10 cells showed melanin levels of 6.7 ± 0.2 and 7.4 ± 0.3 lg/mg protein, respectively, indicating that B16F10 cells had higher basal melanin content (P < 0.05) than G361 cells. A substantial increase in melanin production of 29.09 ± 3.50% (P < 0.01) was observed in G361 cells irradiated with a UVA dose of 16 J/cm2 and 29.64 ± 4.6% (P < 0.001) in B16F10 cells irradiated with a UVA dose of 8 J/cm2 (Fig. 1B). Whereas a UVA dose of 16 J/cm2 also significantly promoted melanin content in B16F10 cells, such UV dose was observed to cause cytotoxicity (data not shown). Hence, a UVA dose of 16 J/cm2 for G361 cells and 8 J/cm2 for B16F10 cells was then chosen for the study of inhibitory effects of GA on UVA-induced melanin production. The presence of GA prior to UV irradiation resulted in a suppression of melanin formation in both G361 and B16F10 cells with significant and a concentration-dependent reduction observed with 30–60 lM and 15–60 lM GA, respectively (Fig. 1C). We further investigated whether the antimelanogenic effects of GA were attributed to its inhibitory effects on tyrosinase, a rate-limiting step enzyme for melanin synthesis. G361 cells were observed to have lower tyrosinase activity (P < 0.01) than B16F10 cells as the tyrosinase activity of 1.5 ± 0.1 and 2.8 ± 0.3 U/mg protein were observed in non-UVA-irradiated control G361 and B16F10 cells, respectively. UVA irradiation (8 J/cm2) was demonstrated to cause 45.37 ± 5.4% (P < 0.001) increase in tyrosinase activity in G361 cells and 54.03 ± 7.56% (P < 0.001) in B16F10 cells. Nevertheless, the addition of GA at concentrations of 30–60 lM and 15–60 lM led to a concentration-dependent protection against UVA-mediated tyrosinase activation in G361 cells and B16F10 cells, respectively (Fig. 1D).
3.2. UVA mediated time-dependent changes in GSH content and GST activity: the inhibition by GA against GSH depletion and GST inactivation To examine whether redox mechanisms associated with antimelanogenic effects of GA, we determined GSH-related antioxidant parameters including cellular GSH content and GST activity. In non-irradiated G361 cells, the GSH content observed was 2.9 ± 0.1 nmol/mg protein and GST activity was 16.83 ± 2.7 lmol/ min/mg protein. Additionally, the GSH content of 12.54 ± 0.3 nmol/mg protein and GST activity of 35.52 ± 1.9 lmol/min/mg protein were observed in non-irradiated B16F10 cells, indicating that B16F10 cells had greater basal GSH content (P < 0.001; Student’s t-test) and GST activity (P < 0.001; Student’s t-test) than G361 cells. To determine time-course changes of antioxidant parameters studied, a substantial loss of GSH content by 47.51 ± 3.5% and decrease in GST activity by 41.5 ± 2.8% was observed in irradiated G361 cells compared to non-irradiated cells at 1 h after UVA (8 J/ cm2) exposure, although a significant restoration in GSH content (Fig. 2A) and GST activity (Fig. 2B) was detected by 24 h and 16 h, respectively. A similar pattern of changes in GSH content and GST activity mediated by UVA irradiation was also observed
U. Panich et al. / Journal of Photochemistry and Photobiology B: Biology 108 (2012) 16–22
19
Fig. 1. The effects of GA at non-cytotoxic concentrations on UVA-induced melanin content and tyrosinase activity in G361 and B16F10 cells. (A) The cytotoxic effects of GA were evaluated after treatment of the cells with GA (7.5–60 lM) for up to 24 h without UVA irradiation. Cell viability determined by MTT reduction was expressed as a percentage of control (100%, non-UVA-irradiated and untreated cells). (B) Dose-dependent effect of UVA (4, 8 and 16 J/cm2) on melanin content in G361 cells or B16F10 cells collected at 1 h after UVA irradiation. (C) Antimelanogenic effects of GA (15–60 lM) on G361 cells or B16F10 cells exposed to a UVA dose of 16 or 8 J/cm2, respectively. (D) Antityrosinase effects of GA on G361 cells or B16F10 cells exposed to 8 J/cm2 UVA. The tyrosinase activity and melanin production related to the protein concentration were expressed as a percentage of control (100%, non-UVA-irradiated and untreated cells). Data was expressed as mean ± SEM. The statistical significance of differences between the control and UVA-irradiated cells was evaluated by Student’s t test and between UVA-irradiated and GA-treated cells by one-way ANOVA followed by Tukey’s post hoc test. ### P < 0.001 compared with UVA-irradiated cells. ⁄P < 0.05; ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001 compared with untreated cells exposed to UVA.
in B16F10 cells. UVA irradiation caused a rapid depletion of GSH by 28.8 ± 1.8% and reduction in GST activity by 33.16 ± 2.2% by 1 h after irradiation as compared to non-irradiated cells. In contrast, a significant restoration of GSH content (Fig. 2A) and GST activity (Fig. 2B) was detected and the levels elevated to basal levels by 16 h for GSH content and by 8 h for GST activity after UV exposure. We further evaluated protective effects of GA against UVA-mediated GSH depletion and GST inactivation. At 1 h after UVA irradiation, the presence of GA prior to UVA irradiation resulted in a dose-dependent rise in cellular GSH content (Fig. 3C) and GST activity (Fig. 2D) as compared to UV-irradiated G361 cells or B16F10 cells without GA treatment. Moreover, a lower GA dose (30 lM) was required to prevent GSH depletion in irradiated B16F10 cells. 3.3. UVA mediated time-dependent changes in mRNA expression of c-GCLC, c-GCLM and GST: the inhibition by GA against mRNA downregulation The time-course changes in mRNA expression mediated by UVA were first examined in G361 cells or B16F10 cells harvested at 2, 4, 8 and 16 h after UVA (8 J/cm2) exposure. UVA irradiation caused a time-dependent change of c-GCLC and c-GCLM (Fig. 3A) as well as GST (Fig. 3B) mRNA expression in both cell lines. A significant decline in c-GCLC, c-GCLM and GST mRNA expressions was observed after 2-h post-irradiation but the mRNA recovery was partially achieved by 4 h and the mRNA levels were markedly restored and increased to a level greater than basal levels of mRNA expression by 8 h. In our study, GST mRNA expression was most prominently affected in both G361 and B16F10 cells at 2-h postirradiation. We further examined protective effects of GA (7.5–30 lM) against mRNA downregulation mediated by UVA at
2-h post-irradiation. Fig. 3C and 3D shows that the addition of GA to G361 cells or B16F10 cells led to a concentration-dependent inhibition on UVA-mediated a significant decrease in c-GCLC, cGCLM and GST mRNA levels. 3.4. GA inhibited UVA irradiation-induced intracellular oxidant formation in G361 and B16F10 cells G361 cells were observed to have higher basal ROS levels (P < 0.05) than B16F10 cells, as determined by the levels of DCFDA-detectable ROS of 6.6 ± 1 and 3.5 ± 0.2 RFU observed in non-UVA-irradiated G361 and B16F10 cells, respectively. Within 2 h after irradiation, a UVA dose of 8 J/cm2 produced a significant rise in intracellular ROS by 137.27 ± 14.66% (P < 0.001) in G361 cells and by 71.76 ± 6% (P < 0.01) in B16F10 cells compared to non-irradiated cells (Fig. 4). By contrast, both cell lines pretreated with GA showed a dose-dependent decrease of ROS formation as compared to irradiated cells without GA. We also examined the effect of GA alone on ROS formation in non-irradiated G361 or B16F10 cells to rule out whether the upregulation of c-GCL and GST mRNA expressions in UVA-irradiated cells was mediated by the electrophilic property of GA capable of activating antioxidant enzyme genes associated with ROS generation. The addition of GA (7.5–30 lM) to G361 cells or B16F10 cells did not result in a significant change in intracellular ROS levels by 2 h after UV exposure compared to untreated cells (data not shown). 4. Discussion GA is a powerful antioxidant ubiquitously present in plants and fruits and shown to exhibit beneficial effect against hyperpigmentation.
20
U. Panich et al. / Journal of Photochemistry and Photobiology B: Biology 108 (2012) 16–22
Fig. 2. The inhibitory effects of GA on UVA-induced GSH depletion and GST inactivation. Time-course changes of GSH content (A) and GST activity (B) in G361 cells or B16F10 cells collected at 1, 4, 8, 16 and 24 h after UVA irradiation (8 J/cm2). The GSH content and GST activity related to the protein concentrations were expressed as a percentage of control (100%, non-UVA-irradiated and untreated cells). ⁄P < 0.05; ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001 compared with non-UVA-irradiated cells. Inhibition by GA (15–60 lM) against UVA-mediated GSH depletion (C) and GST inactivation (D) was examined in G361 cells or B16F10 cells at 1 h after irradiation. Determination of intracellular GSH content and GST activity was performed as described in Section 2. Data was expressed as mean ± SEM. The statistical significance of differences between the control and UVA-irradiated cells was evaluated by Student’s t test and between UVA-irradiated and GA-treated cells by one-way ANOVA followed by Tukey’s post hoc test. ###P < 0.001 compared with UVA-irradiated cells. ⁄P < 0.05; ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001 compared with untreated cells exposed to UVA.
We investigated the antimelanogenic effects of GA in association with modulation of GSH redox system in different melanoma cell lines, G361 and B16F10 cells irradiated with UVA. We observed a lower basal melanin level in G361 cells than that in B16F10 cells and a higher UVA dose (16 J/cm2) required to substantially induce melanin production in G361 cells than that (8 J/cm2) in B16F10 cells, indicating that G361 cells were less melanogenic than B16F10 cells. In addition, treatment of G361 cells or B16F10 cells with GA at non-cytotoxic concentrations was able to reduce UVA-induced melanin synthesis and tyrosinase activity. We previously demonstrated that ROS production mediated by UVR has been shown to be in direct proportion with enhanced melanin levels and tyrosinase upregulation in human melanoma cells [3], although a link between melanogenesis and cellular redox state is complicated and needs clarification. In this study, we showed that G361 and B16F10 cells had different redox states of the GSH–GCL system and GST as G361 cells had higher basal ROS levels but lower GSH content and GST activity than B16F10 cells. Furthermore, we observed that UV-irradiated B16F10 cells appeared to be more responsive to antimelanogenic effect of GA than G361 cells as lower concentrations of GA were required to suppress UVA-induced melanin production in B16F10 cells. Different degrees of oxidative insult in various pigment cell types may contribute to different responses of the cells to antimelanogenic effect of an antioxidant. GSH, a thiol antioxidant, involved in melanin synthesis is capable of protecting pigment cells against detrimental effects of photooxidative stress by neutralization of ROS and is also responsible for the conjugation reaction catalyzed by GST to convert a xenobiotic to a non-toxic metabolite [14–18]. Previous studies have
shown an inverse relationship between melanogenesis and GSH in melanoma cells [3,4,19]. We observed that a single dose of UVA radiation resulted in time-dependent changes in GSH level, GST activity as well as mRNA expression of c-GCLC, c-GCLM and GST in both cell lines. UVA exposure led to GSH loss and GST inactivation as early as 1 h after irradiation as well as downregulation of c-GCLC, c-GCLM and GST mRNA at 2 h following irradiation. Additionally, UVA irradiation induced a GSH depletion and ROS formation to the greater extent in G361 cells than in B16F10 cells. Our study has suggested that lightly pigmented melanoma cells were more susceptible to UV-induced cellular redox imbalance than more pigmented B16F10 cells. Lightly pigmented melanocytes were previously also shown to display lower levels of catalase activity [10]. Acute GSH depletion and GST inactivation in G361 cells and B16F10 cells exposed to UVA radiation could occur as a result of increased antioxidant consumption to eliminate excessive ROS and/ or direct inactivation of the enzymes by UVA or by ROS produced in response to UV irradiation [20]. UVA irradiation was observed to reduce activities of antioxidant enzymes including catalase in skin fibroblast through altering the protein structures [21]. However, the cellular and molecular mechanisms by which UVA affects GSH-related enzymes including c-GCL and GST in the pigmentproducing skin cells remain unclear and need further investigation in order to understand how cellular redox state regulates melanogenesis and antioxidant mechanisms underlying the antimelanogenic effects of phenolic antioxidants. UVA irradiation exhibited a time-dependent effect on cellular and molecular changes in GSH redox system in both G361 and B16F10 cells. While UVA radiation could mediate downregulation
U. Panich et al. / Journal of Photochemistry and Photobiology B: Biology 108 (2012) 16–22
21
Fig. 3. The inhibitory effects of GA on UVA-mediated downregulation of c-GCLC, c-GCLM and GST mRNA. Gene expression was quantitatively analyzed by real-time PCR with the 2 DDCt method. Time-course changes of c-GCLC and c-GCLM (A) as well as GST (B) in G361 cells or B16F10 cells harvested at 2, 4, 8 and 16 h after UVA irradiation (8 J/ cm2). ⁄P < 0.05; ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001 compared with non-UVA-irradiated cells. Protection by GA (7.5–30 lM) against UVA-induced downregulation of c-GCLC and c-GCLM (C) as well as GST (D) mRNA in G361 cells or B16F10 cells was determined at 2 h after irradiation. The data shown as the fold change in gene expression normalized to GAPDH and relative to the control sample. For the control (non-irradiated and untreated cells), DDCt equals zero and 20 equals one, so that the fold change in gene expression relative to the control equals one, by definition. For the UV-irradiated and treated cells, assessment of 2 DDCt indicates the fold change in gene expression relative to the control. Data was expressed as mean ± SEM. The statistical significance of differences between the control and UVA-irradiated cells was evaluated by Student’s t test and between UVAirradiated and GA-treated cells by one-way ANOVA followed by Tukey’s post hoc test. ###P < 0.001 compared with UVA-irradiated cells. ⁄P < 0.05; ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001 compared with untreated cells exposed to UVA.
Fig. 4. Inhibition by GA against UVA (8 J/cm2)-induced intracellular oxidant formation in G361 cells or B16F10 cells. Oxidation of DCFH-DA to fluorescent DCF by ROS produced in the cells was measured at 485 nm excitation and 530 nm emission. DCF fluorescence was measured within 2 h after UV exposure as described in Section 2. Intracellular oxidant levels were expressed as a percentage of control (100%, non-irradiated and untreated cells) using a microplate reader. Data was expressed as mean ± SEM. The statistical significance of differences between the control and UVA-irradiated cells was evaluated by Student’s t test and between UVA-irradiated and GA-treated cells by one-way ANOVA followed by Tukey’s post hoc test. ###P < 0.001 compared with UVA irradiated cells. ⁄P < 0.05; ⁄⁄ P < 0.01; ⁄⁄⁄P < 0.001 compared with untreated cells exposed to UVA.
of GSH–GCL system and GST, a restoration of GSH-related antioxidant defenses in G361 cells or B16F10 cells was observed at various time points. Previous studies have reported a similar pattern of changes in antioxidant parameters observed in skin and non-
skin tissues, showing that a single UV radiation caused an acute reduction of antioxidants including GSH, c-GCL and GST at cellular and molecular levels and the restoration was observed at various time points after UV irradiation [6,22,23]. Furthermore, UVA exposure led to an immediate loss of GSH in melanocytes and its recovery was found by 24 h after irradiation [24]. Cellular adaptation to oxidative stress through upregulation of mRNA expression may take place in response to a single UV dose-induced ROS formation in order to maintain redox state balance. Induction of cellular ROS or oxidative stress can either upregulate or downregulate mRNA expression of detoxification enzymes including GCL and GST through the electrophile response element, depending on several factors such as the degree of oxidative stress and exposure time [18,20,25]. GA-treated G361 and B16F10 cells demonstrated to protect against ROS formation, GSH depletion, GST inactivation as well as GCL and GST mRNA downregulation. The immediate increases in GSH content and GST activity within 1 h after UVA irradiation in GA-treated cells may be because GA attenuated antioxidant consumption by acting as a powerful free radical scavenger [26] and subsequently reserved cellular antioxidants. Since ROS formation could influence regulation of antioxidant defense mechanisms at cellular and molecular level, GA probably inhibited UVA-induced suppression of c-GCL and GST mRNA levels as a result of the ability of GA to rapidly decrease ROS levels induced by UVA irradiation. In our study, GA did not provide a direct regulatory effect on the mRNA levels since GA alone (up to 30 lM) did not significantly affect mRNA expression nor ROS levels in non-irradiated cells (data not shown), indicating that, in the early event within 2 h after a
22
U. Panich et al. / Journal of Photochemistry and Photobiology B: Biology 108 (2012) 16–22
single exposure of UVA, GA probably did not serve as an electrophile capable of upregulating mRNA expression of detoxification enzymes. In summary, GA exhibited antimelanogenic effect in association with the redox regulation of GSH–GCL system and GST at transcriptional and post-translational levels in G361 and B16F10 cells representing different redox status. Further studies using physiologically relevant skin models such as primary human melanocytes are also needed because different types of melanin-producing cells including melanocytes and melanoma cells from different sources (e.g., mouse and human) display different redox states that might affect the responses of the cells to UVA-mediated melanogenesis.
[10]
[11]
[12]
[13]
Acknowledgements
[14]
Appreciation is expressed to Thailand Research Fund (Grant No. DBG5380040), Mahidol University and the Faculty of Medicine, Siriraj Hospital, Mahidol University, for research funding. We are grateful to Mrs. Srisamorn Sudtim and Department of Dermatology, Faculty of Medicine, Siriraj Hospital, Mahidol University, for the generous valuable technical support related to the UV device.
[15]
[16]
[17]
References [1] A. Slominski, D.J. Tobin, S. Shibahara, J. Wortsman, Melanin pigmentation in mammalian skin and its hormonal regulation, Physiol. Rev. 84 (2004) 1155– 1228. [2] H.T. Wang, B. Choi, M.S. Tang, Melanocytes are deficient in repair of oxidative DNA damage and UV-induced photoproducts, Proc. Natl. Acad. Sci. USA 107 (2010) 12180–12185. [3] U. Panich, V. Tangsupaanan, T. Onkoksoong, K. Kongtaphan, K. Kasetsinsombat, P. Akarasereenont, A. Wongkajornsilp, Inhibition of UVA-mediated melanogenesis by ascorbic acid through modulation of antioxidant defense and nitric oxide system, Arch. Pharm. Res. 34 (2011) 811–820. [4] N.P. Smit, F.A. van Nieuwpoort, L. Marrot, C. Out, B. Poorthuis, H. van Pelt, J.R. Meunier, S. Pavel, Increased melanogenesis is a risk factor for oxidative DNA damage – study on cultured melanocytes and atypical nevus cells, Photochem. Photobiol. 84 (2008) 550–555. [5] H.J. Niggli, L.A. Applegate, Glutathione response after UVA irradiation in mitotic and postmitotic human skin fibroblasts and keratinocytes, Photochem. Photobiol. 65 (1997) 680–684. [6] M. Meloni, J.F. Nicolay, Dynamic monitoring of glutathione redox status in UVB irradiated reconstituted epidermis: effect of antioxidant activity on skin homeostasis, Toxicol. In Vitro 17 (2003) 609–613. [7] L.G. Chen, W.L. Chang, C.J. Lee, L.T. Lee, C.M. Shih, C.C. Wang, Melanogenesis inhibition by gallotannins from Chinese galls in B16 mouse melanoma cells, Biol. Pharm. Bull. 32 (2009) 1447–1452. [8] D. Barker, K. Dixon, E.E. Medrano, D. Smalara, S. Im, D. Mitchell, G. Babcock, Z.A. Abdel-Malek, Comparison of the responses of human melanocytes with different melanin contents to ultraviolet B irradiation, Cancer Res. 55 (1995) 4041–4046. [9] S. Takeuchi, W. Zhang, K. Wakamatsu, S. Ito, V.J. Hearing, K.H. Kraemer, D.E. Brash, Melanin acts as a potent UVB photosensitizer to cause an atypical mode
[18]
[19] [20]
[21]
[22]
[23]
[24]
[25]
[26]
of cell death in murine skin, Proc. Natl. Acad. Sci. USA 101 (2004) 15076– 15081. V. Maresca, E. Flori, S. Briganti, A. Mastrofrancesco, C. Fabbri, A.M. Mileo, M.G. Paggi, M. Picardo, Correlation between melanogenic and catalase activity in in vitro human melanocytes: a synergic strategy against oxidative stress, Pigment Cell Melanoma Res. 21 (2008) 200–205. Y.G. Kang, E.J. Choi, Y. Choi, J.K. Hwang, 5,7-dimethoxyflavone induces melanogenesis in B16F10 melanoma cells through cAMP-dependent signaling, Exp. Dermatol. 20 (2011) 445–447. U. Panich, K. Kongtaphan, T. Onkoksoong, K. Jaemsak, R. Phadungrakwittaya, A. Thaworn, P. Akarasereenont, A. Wongkajornsilp, Modulation of antioxidant defense by Alpinia galanga and Curcuma aromatica extracts correlates with their inhibition of UVA-induced melanogenesis, Cell Biol. Toxicol. 26 (2010) 103–116. U. Ketsawatsakul, Modulation by bicarbonate of the protective effects of phenolic antioxidants on peroxynitrite-mediated cell cytotoxicity, ScienceAsia 33 (2007) 273–282. D. Schadendorf, K. Jurgovsky, C.M. Kohlmus, B.M. Czarnetzki, Glutathione and related enzymes in tumor progression and metastases of human melanoma, J. Invest. Dermatol. 105 (1995) 109–112. A. Kokot, D. Metze, N. Mouchet, M.D. Galibert, M. Schiller, T.A. Luger, M. Bohm, Alpha-melanocyte-stimulating hormone counteracts the suppressive effect of UVB on Nrf2 and Nrf-dependent gene expression in human skin, Endocrinology 150 (2009) 3197–3206. M.A. Cotter, J. Thomas, P. Cassidy, K. Robinette, N. Jenkins, S.R. Florell, S. Leachman, W.E. Samlowski, D. Grossman, N-acetylcysteine protects melanocytes against oxidative stress/damage and delays onset of ultravioletinduced melanoma in mice, Clin. Cancer Res. 13 (2007) 5952–5958. Y. Zhang, V. Gonzalez, M.J. Xu, Expression and regulation of glutathione Stransferase P1-1 in cultured human epidermal cells, J. Dermatol. Sci. 30 (2002) 205–214. L. Marrot, C. Jones, P. Perez, J.R. Meunier, The significance of Nrf2 pathway in (photo)-oxidative stress response in melanocytes and keratinocytes of the human epidermis, Pigment Cell Melanoma Res. 21 (2008) 79–88. T. Yokozawa, Y.J. Kim, Piceatannol inhibits melanogenesis by its antioxidative actions, Biol. Pharm. Bull. 30 (2007) 2007–2011. D.A. Dickinson, A.L. Levonen, D.R. Moellering, E.K. Arnold, H. Zhang, V.M. Darley-Usmar, H.J. Forman, Human glutamate cysteine ligase gene regulation through the electrophile response element, Free Rad. Biol. Med. 37 (2004) 1152–1159. Y. Shindo, T. Hashimoto, Time course of changes in antioxidant enzymes in human skin fibroblasts after UVA irradiation, J. Dermatol. Sci. 14 (1997) 225– 232. A.R. Svobodova, A. Galandakova, J. Sianska, D. Dolezal, J. Ulrichova, J. Vostalova, Acute exposure to solar simulated ultraviolet radiation affects oxidative stress-related biomarkers in skin, liver and blood of hairless mice, Biol. Pharm. Bull. 34 (2011) 471–479. M. Zhu, G.T. Bowden, Molecular mechanism(s) for UV-B irradiation-induced glutathione depletion in cultured human keratinocytes, Photochem. Photobiol. 80 (2004) 191–196. P. Larsson, E. Andersson, U. Johansson, K. Ollinger, I. Rosdahl, Ultraviolet A and B affect human melanocytes and keratinocytes differently, a study of oxidative alterations and apoptosis, Exp. Dermatol. 14 (2005) 117–123. M. Schafer, S. Dutsch, U. auf dem Keller, F. Navid, A. Schwarz, D.A. Johnson, J.A. Johnson, S. Werner, Nrf2 establishes a glutathione-mediated gradient of UVB cytoprotection in the epidermis, Genes Dev. 24 (2010) 1045–1058. U. Ketsawatsakul, M. Whiteman, B. Halliwell, A reevaluation of the peroxynitrite scavenging activity of some dietary phenolics, Biochem. Biophy. Res. Commun. 279 (2000) 692–699.
Contents lists available at SciVerse ScienceDirect
Journal of Photochemistry and Photobiology B: Biology journal homepage: www.elsevier.com/locate/jphotobiol
UVA-induced melanogenesis and modulation of glutathione redox system in different melanoma cell lines: The protective effect of gallic acid Uraiwan Panich a,⇑, Tasanee Onkoksoong a, Saowalak Limsaengurai a, Pravit Akarasereenont a,b, Adisak Wongkajornsilp a a b
Department of Pharmacology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand Center of Applied Thai Traditional Medicine, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand
a r t i c l e
i n f o
Article history: Received 30 September 2011 Received in revised form 8 November 2011 Accepted 6 December 2011 Available online 28 December 2011 Keywords: Ultraviolet A Melanogenesis Glutathione Redox Gallic acid
a b s t r a c t Oxidative stress has been suggested to play a role in ultraviolet A (UVA)-mediated melanogenesis. Glutathione (GSH) and GSH-related enzymes including c-glutamate cysteine ligase (c-GCL) and glutathione S-transferase (GST) are important antioxidant defenses responsible for maintaining cellular redox balance. Hence, improving GSH redox system to cope with oxidative insults may be essential for attenuation of abnormal melanin production. Gallic acid (GA), a dietary phenolic, has been shown to provide beneficial effects against hyperpigmentation possibly through its antioxidant properties. This study thus aimed to assess the antimelanogenic action of GA with regard to modulation of GSH–GCL system and GST in two melanoma cell lines, lightly pigmented G361 human melanoma and more pigmented B16F10 mouse melanoma cells, irradiated with UVA. G361 cells were shown to have lower basal GSH content and GST activity than B16F10 cells. Moreover, GA provided antimelanogenic effects in correlation with promotion of GSH levels, GST activity as well as c-GCL and GST mRNA in both G361 and B16F10 cells at 2-h post-irradiation. In summary, GA exhibits protective effects on UVA-mediated melanogenesis possibly through improvement of GSH-related antioxidant defenses. Furthermore, different redox state in G361 and B16F10 cells may affect the responses of melanoma cells to GA. Ó 2011 Elsevier B.V. All rights reserved.
1. Introduction Ultraviolet (UV) radiation has been recognized as a primary environmental factor implicated in alteration of melanin synthesis, mainly regulated by tyrosinase in melanocytes and/or melanoma cells [1]. Damaging effects on the skin due to overproduction of melanin has been extensively studied because melanin can possess either photoprotective or phototoxic properties and its excess could therefore be biologically toxic and mutagenic that probably increases malignant melanoma risk, especially in light-skinned individuals [2]. UVA (400–315 nm) has been demonstrated to trigger melanogenesis in association with increased oxidative stress caused by excessive production of oxidants and/or deterioration of antioxidant defense network in melanocytes and/or melanoma cells [3,4]. Glutathione (GSH) and its related enzymes including c-glutamate cysteine ligase (c-GCL) consisting of a catalytic subunit (c-GCLC) and modifier subunit (c-GCLM), the rate-limiting enzyme for GSH synthesis, and glutathione S-transferase (GST), are
⇑ Corresponding author. Tel.: +66 (0)2 419 7569; fax: +66 (0)2 411 5026. E-mail address: [email protected] (U. Panich). 1011-1344/$ - see front matter Ó 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.jphotobiol.2011.12.004
important endogenous antioxidants in various tissues including the skin. GSH redox system is essential for protecting the skin against photooxidative stress through maintaining intracellular redox balance and detoxifying xenobiotics and oxidants [5,6]. Since there is a correlation between melanogenesis and intracellular redox state primarily maintained by thiol-based antioxidants, in particular GSH, GSH–GCL system and GST probably thus play a crucial role either in regulation of pigmentation or in adaptation to melanogenesis-mediated oxidative stress. Therefore, potentiating the capacity of GSH redox system to maintain redox balance might be useful for control of melanogenesis. Gallic acid (GA) is an antioxidant phenolic distributed in medicinal and dietary plants widely developed as potential antimelanogenic agents [7], although the mechanisms by which cellular redox state influences melanogenesis are complex and therefore antimelanogenic action of GA involving GSH-related antioxidants needs elucidation. It has been suggested that differences in melanin content in darkly and lightly pigmented melanocytes contributed to various responses of the cells that include DNA damage and cell death induced by UVB irradiation implicated in photocarcinogenesis, particularly in fair/light skin [8,9]. Low levels of antioxidant content and/or activity in lightly pigmented cells could make them
U. Panich et al. / Journal of Photochemistry and Photobiology B: Biology 108 (2012) 16–22
continuously exposed to an oxidative environment and predisposed to oxidative damage and loss of cell homeostasis. In addition, different redox status represented in various pigment cell types could also in turn affect melanogenesis in response to UV irradiation [10]. Our study was therefore performed using two melanoma cell lines, lightly pigmented G361 human melanoma cell line and more pigmented B16F10 mouse melanoma cell line. Lightly pigmented cells generally have increased susceptibility to oxidative damage induced by UVR [8]. B16F10 cells are more pigmented and have commonly been used as models for the study of antimelanogenic effects and mechanisms of putative depigmenting compounds [11]. Our study thus evaluated the effects of UVA radiation on melanogenic and GSH-related antioxidant responses in both cell lines and explored the underlying mechanisms of GA in inhibiting UVA-induced melanogenesis involving modulation of GSH redox system including c-GCL and GST at the cellular and molecular level.
2. Materials and methods
17
2.4. Cell viability assay Metabolically viable cells were evaluated by reduction of 3-(4,5-dimethylthiazol-2-yl) 2,2 diphenyltetrazolium bromide (MTT) to the purple formazan. Absorbance of the formazan was measured at 595 nm by a spectrophotometer (SpectraMax M2 of Molecular Device, CA, USA). Cell viability is expressed as a percentage of the control (100%, non-irradiated and untreated cells). 2.5. Melanin content assay An evaluation of melanin production was performed as described previously [12]. Cells were collected at 1 h after UV radiation and the cell pellets were solubilized in 1 N NaOH for 1 h to dissolve melanin. The melanin content was then determined spectrophotometrically at 475 nm and calculated by comparison to a standard curve derived using synthetic melanin. The results are expressed as a percentage of the melanin content (lg/mg protein) of non-irradiated and untreated control cells (100%).
2.1. Materials
2.6. Tyrosinase activity assay
G361 and B16F10 cell lines from American Type Culture Collection (ATCC, Rockville, MD, USA) was a gift from Assoc. Prof. Tengamnuay, Faculty of Pharmaceutical Sciences, Chulalongkorn University and Assoc. Prof. Wajjwalku, Faculty of Veterinary Medicine, Kasetsart University, respectively. Dulbecco’s modified Eagle medium (DMEM) and all cell culture reagents were purchased from Invitrogen (NY, USA). Chemicals and reagents of the highest quality available were used and purchased from Sigma–Aldrich (MO, USA or Germany).
The rate of L-DOPA oxidation was measured to assess cellular tyrosinase activity in G361 and B16F10 cells exposed to a UVA dose of 8 J/cm2. The assay was performed as previously described [12]. Briefly, 20 mM L-DOPA used as the substrates was added to each lysate in a 96-well plate and absorbance of dopachrome formation was measured spectrophotometrically at 475 nm every 10 min for 1 h at 37 °C by a spectrophotometer. The tyrosinase activity was calculated by comparison to a standard curve using tyrosinase (2034 U/mg) and was expressed as unit/mg protein. The data are expressed as a percentage of the tyrosinase activity (unit/mg protein) of non-irradiated and untreated control cells (100%).
2.2. Cell cultures G361 and B16F10 cells were grown in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% penicillin (100 units/ ml)/streptomycin (100 lg/ml) and maintained at 37 °C in a humidified air of 5% CO2 (PCO2 = 40 Torr) (a Forma Scientific CO2 Water Jacketed Incubator).
2.3. Treatment of cells with UVA irradiation and gallic acid Cells were treated with GA dissolved in water (7.5, 15, 30, 60 lM) for up to 30 min prior to UVA irradiation for all assays and for 24 h to examine the cytotoxicity. DMEM was replaced with phosphate buffered saline (PBS) to avoid generation of medium-derived toxic photoproducts prior to UVA (320–400 nm) irradiation. Dose-dependent effects of UVA irradiation on melanin production in both cell lines were investigated using the UVA doses of 4, 8 and 16 J/cm2. The UVA doses selected in our study were non-cytotoxic to both G361 [12] and B16F10 cells (data not shown) and were physiologically relevant. Cells were collected at various times after UVA irradiation and assayed for GSH content, GST activity and mRNA expression. The UVA source was a xenon arc lamp (Dermalight ultrA1; Hoenle, Martinsried, Germany). For preparation of cell lysate, the harvested cells were pelleted by centrifugation and lysed in lysis buffer containing 50 mM Tris– HCl, 10 mM ethylene diaminetetraacetic acid (EDTA), 1% (v/v) Triton X-100, phenylmethylsulfonyl fluoride (PMSF) (100 mg/ml) and pepstatin A (1 mg/ml) in DMSO and leupeptin (1 mg/ml) in H2O, pH 6.8. The cells were centrifuged at 10,000 rpm for 10 min and the total cell lysate was collected and stored at 80 °C.
2.7. Measurement of intracellular glutathione content Determination of intracellular GSH content was based on the reaction of GSH with the fluorescent probe o-phthalaldehyde (OPA) at pH 8 as previously described [13]. Briefly, cells were lysed with ice-cold 6.5% (w/v) trichloroacetic acid (TCA). TCA extract was added to 96-well fluorescence plates followed by the addition of buffer (100 mM KH2PO4, 10 mM EDTA and 1 mM NaOH) and OPA (1 mg/ml in methanol). The fluorescence of the GSH-OPA adduct was measured with excitation and emission wavelengths of 350 and 420 nm, respectively. The GSH content was calculated by comparing the valued obtained with a standard curve of GSH. The results are expressed as a percentage of the GSH content (nmol/mg protein) of the non-irradiated and untreated control cells (100%). 2.8. Measurement of glutathione-S-transferase activity GST activity was assessed following the kit protocol from Cayman chemical (Ann Arbor, MI). GST catalyzed the conjugation of GSH with 1-chloro-2,4-dinitrobenzene (CDNB) to form the GSDNB conjugate which was then determined spectrophotometrically at 340 nm immediately and every 30 s for 10 min. 10 ll of 100 mM CDNB was added to start the reaction of 20 ll of sample or positive control GST with 20 ll of 200 mM GSH in 150 ll of assay buffer (100 mM potassium phosphate, pH 6.5, containing 0.1% Triton X-100). One unit of GST activity is defined as the amount of enzyme generating 1 lmol of GS-DNB conjugate/min. The data are expressed as a percentage of the GST activity (lmol/min/mg protein) of the non-irradiated and untreated control cells (100%).
18
U. Panich et al. / Journal of Photochemistry and Photobiology B: Biology 108 (2012) 16–22
2.9. Determination of protein content
3. Results
Protein concentration was measured using the Bio-Rad Protein Assay Kit (Bio-Rad, Germany) and bovine serum albumin (BSA) was used as protein standard.
3.1. GA at non-cytotoxic concentrations inhibited melanin content and tyrosinase activity in G361 and B16F10 cells
2.10. Determination of intracellular oxidant formation The assay is based on oxidation of non-fluorescent dichlorofluorescein (DCFH) by intracellular ROS (e.g., H2O2) to fluorescent 2, 7-DCF which could reflect oxidant formation mediated by UVA irradiation. After UVA irradiation, GA-treated cells and untreated cells were incubated in DMEM without phenol red and preloaded with 5 lM DCFHDA for 1 h at 37 °C. DCF fluorescence intensity for ROS formation was evaluated for 30 min at excitation/emission wavelengths of 485/530 nm using a spectrofluorometer. The data are expressed as a percentage of intracellular oxidant formation (relative fluorescence units, RFUs) of the non-irradiated and untreated control cells (100%). 2.11. Quantitative real-time reverse transcriptase–polymerase chain reaction: measurement of tyrosinase, c-GCLC, c-GCLM and GST mRNA expression For the time-course study, mRNA expression in G361 and B16F10 cells was determined at 2, 4, 8 and 16 h after UVA irradiation. In addition, modulation of mRNA expression by GA (7.5–30 lM) in UV-irradiated cells was assessed at 2 h after UVA irradiation (8 J/cm2). Total RNA was isolated using the illustra RNAspin Mini RNA Isolation Kit (GE Healthcare, UK). Reverse transcription was carried out with 1 lg of total RNA using the Improm-II reverse transcriptase (Promega, Medison, USA) under the conditions described in the kit manual. Reactions were performed in triplicate for each sample in the ABI Prism 7500 Real Time PCR System (Applied Biosystems, USA) under the following amplification conditions: 95 °C for 10 min, 40 cycles of 95 °C for 15 s, 60 °C for 40 s, and 72 °C for 40 s. Real-time RTPCR was performed in a total volume of 25 ll of reaction mixtures containing 5 ll cDNA template with FastStart universal SYBR Green Master (ROX) and 10 lM concentrations of primers. Primers for PCR were designed using the Primer Express software version 3.0 (Applied Biosystems, USA). Sequences of PCR primer sets of c-GCL-C, c-GCL-M, GST and GAPDH (in 5-3 direction) were as follows: c-GCLC sense (product sizes = 160 bp), GCTGTCTTGCAGGGAATGTT, and antisense, ACACACCTTCCTTCCCATTG; c-GCLM sense (product sizes = 200 bp), TTGGAGTTGCACAGCTGGATTC, and antisense, TGGTTTTACCTGTGCCCACTG; GST sense (product sizes = 72 bp), CCTGTACCAGTCCAATACCATCCT, and antisense, TCCTGCTGGTCCTTCCCATA; GAPDH sense (product size = 124 bp), GAAATCCCATCACCATCTTCC, and antisense, AAATGAGCCCCAGCCTTCTC. The mRNA level was normalized with reference to the amount of housekeeping gene transcripts (GAPDH mRNA). The mean Ct from mRNA expression in cDNA from each sample was compared with the mean Ct from GAPDH determinations from the same cDNA samples. 2.12. Statistical analysis Data are expressed as means ± standard error of the mean (SEM) of separate experiments (n P 3) performed on different days using freshly prepared reagents. The significance of non-irradiated controls or individual treatment groups in comparison to the UVAirradiated groups was evaluated by independent t-test (Student’s; 2 populations) or one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test, where appropriate, using Prism (GraphPad Software Inc., San Diego, CA).
Cytotoxicity of GA on both cell lines was first assessed in order to confirm that the protective effects of GA against UVA-induced melanin synthesis were not due to decreased cell number. The addition of GA up to 60 lM to the cells did not cause a remarkable reduction of cell viability as evaluated by MTT assay (Fig. 1A). To determine the antimelanogenic effects of GA, we first investigated the dose-dependent effect of UVA irradiation (4, 8 and 16 J/ cm2) on melanin content in G361 cells or B16F10 cells. Non-UVAirradiated control G361 and B16F10 cells showed melanin levels of 6.7 ± 0.2 and 7.4 ± 0.3 lg/mg protein, respectively, indicating that B16F10 cells had higher basal melanin content (P < 0.05) than G361 cells. A substantial increase in melanin production of 29.09 ± 3.50% (P < 0.01) was observed in G361 cells irradiated with a UVA dose of 16 J/cm2 and 29.64 ± 4.6% (P < 0.001) in B16F10 cells irradiated with a UVA dose of 8 J/cm2 (Fig. 1B). Whereas a UVA dose of 16 J/cm2 also significantly promoted melanin content in B16F10 cells, such UV dose was observed to cause cytotoxicity (data not shown). Hence, a UVA dose of 16 J/cm2 for G361 cells and 8 J/cm2 for B16F10 cells was then chosen for the study of inhibitory effects of GA on UVA-induced melanin production. The presence of GA prior to UV irradiation resulted in a suppression of melanin formation in both G361 and B16F10 cells with significant and a concentration-dependent reduction observed with 30–60 lM and 15–60 lM GA, respectively (Fig. 1C). We further investigated whether the antimelanogenic effects of GA were attributed to its inhibitory effects on tyrosinase, a rate-limiting step enzyme for melanin synthesis. G361 cells were observed to have lower tyrosinase activity (P < 0.01) than B16F10 cells as the tyrosinase activity of 1.5 ± 0.1 and 2.8 ± 0.3 U/mg protein were observed in non-UVA-irradiated control G361 and B16F10 cells, respectively. UVA irradiation (8 J/cm2) was demonstrated to cause 45.37 ± 5.4% (P < 0.001) increase in tyrosinase activity in G361 cells and 54.03 ± 7.56% (P < 0.001) in B16F10 cells. Nevertheless, the addition of GA at concentrations of 30–60 lM and 15–60 lM led to a concentration-dependent protection against UVA-mediated tyrosinase activation in G361 cells and B16F10 cells, respectively (Fig. 1D).
3.2. UVA mediated time-dependent changes in GSH content and GST activity: the inhibition by GA against GSH depletion and GST inactivation To examine whether redox mechanisms associated with antimelanogenic effects of GA, we determined GSH-related antioxidant parameters including cellular GSH content and GST activity. In non-irradiated G361 cells, the GSH content observed was 2.9 ± 0.1 nmol/mg protein and GST activity was 16.83 ± 2.7 lmol/ min/mg protein. Additionally, the GSH content of 12.54 ± 0.3 nmol/mg protein and GST activity of 35.52 ± 1.9 lmol/min/mg protein were observed in non-irradiated B16F10 cells, indicating that B16F10 cells had greater basal GSH content (P < 0.001; Student’s t-test) and GST activity (P < 0.001; Student’s t-test) than G361 cells. To determine time-course changes of antioxidant parameters studied, a substantial loss of GSH content by 47.51 ± 3.5% and decrease in GST activity by 41.5 ± 2.8% was observed in irradiated G361 cells compared to non-irradiated cells at 1 h after UVA (8 J/ cm2) exposure, although a significant restoration in GSH content (Fig. 2A) and GST activity (Fig. 2B) was detected by 24 h and 16 h, respectively. A similar pattern of changes in GSH content and GST activity mediated by UVA irradiation was also observed
U. Panich et al. / Journal of Photochemistry and Photobiology B: Biology 108 (2012) 16–22
19
Fig. 1. The effects of GA at non-cytotoxic concentrations on UVA-induced melanin content and tyrosinase activity in G361 and B16F10 cells. (A) The cytotoxic effects of GA were evaluated after treatment of the cells with GA (7.5–60 lM) for up to 24 h without UVA irradiation. Cell viability determined by MTT reduction was expressed as a percentage of control (100%, non-UVA-irradiated and untreated cells). (B) Dose-dependent effect of UVA (4, 8 and 16 J/cm2) on melanin content in G361 cells or B16F10 cells collected at 1 h after UVA irradiation. (C) Antimelanogenic effects of GA (15–60 lM) on G361 cells or B16F10 cells exposed to a UVA dose of 16 or 8 J/cm2, respectively. (D) Antityrosinase effects of GA on G361 cells or B16F10 cells exposed to 8 J/cm2 UVA. The tyrosinase activity and melanin production related to the protein concentration were expressed as a percentage of control (100%, non-UVA-irradiated and untreated cells). Data was expressed as mean ± SEM. The statistical significance of differences between the control and UVA-irradiated cells was evaluated by Student’s t test and between UVA-irradiated and GA-treated cells by one-way ANOVA followed by Tukey’s post hoc test. ### P < 0.001 compared with UVA-irradiated cells. ⁄P < 0.05; ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001 compared with untreated cells exposed to UVA.
in B16F10 cells. UVA irradiation caused a rapid depletion of GSH by 28.8 ± 1.8% and reduction in GST activity by 33.16 ± 2.2% by 1 h after irradiation as compared to non-irradiated cells. In contrast, a significant restoration of GSH content (Fig. 2A) and GST activity (Fig. 2B) was detected and the levels elevated to basal levels by 16 h for GSH content and by 8 h for GST activity after UV exposure. We further evaluated protective effects of GA against UVA-mediated GSH depletion and GST inactivation. At 1 h after UVA irradiation, the presence of GA prior to UVA irradiation resulted in a dose-dependent rise in cellular GSH content (Fig. 3C) and GST activity (Fig. 2D) as compared to UV-irradiated G361 cells or B16F10 cells without GA treatment. Moreover, a lower GA dose (30 lM) was required to prevent GSH depletion in irradiated B16F10 cells. 3.3. UVA mediated time-dependent changes in mRNA expression of c-GCLC, c-GCLM and GST: the inhibition by GA against mRNA downregulation The time-course changes in mRNA expression mediated by UVA were first examined in G361 cells or B16F10 cells harvested at 2, 4, 8 and 16 h after UVA (8 J/cm2) exposure. UVA irradiation caused a time-dependent change of c-GCLC and c-GCLM (Fig. 3A) as well as GST (Fig. 3B) mRNA expression in both cell lines. A significant decline in c-GCLC, c-GCLM and GST mRNA expressions was observed after 2-h post-irradiation but the mRNA recovery was partially achieved by 4 h and the mRNA levels were markedly restored and increased to a level greater than basal levels of mRNA expression by 8 h. In our study, GST mRNA expression was most prominently affected in both G361 and B16F10 cells at 2-h postirradiation. We further examined protective effects of GA (7.5–30 lM) against mRNA downregulation mediated by UVA at
2-h post-irradiation. Fig. 3C and 3D shows that the addition of GA to G361 cells or B16F10 cells led to a concentration-dependent inhibition on UVA-mediated a significant decrease in c-GCLC, cGCLM and GST mRNA levels. 3.4. GA inhibited UVA irradiation-induced intracellular oxidant formation in G361 and B16F10 cells G361 cells were observed to have higher basal ROS levels (P < 0.05) than B16F10 cells, as determined by the levels of DCFDA-detectable ROS of 6.6 ± 1 and 3.5 ± 0.2 RFU observed in non-UVA-irradiated G361 and B16F10 cells, respectively. Within 2 h after irradiation, a UVA dose of 8 J/cm2 produced a significant rise in intracellular ROS by 137.27 ± 14.66% (P < 0.001) in G361 cells and by 71.76 ± 6% (P < 0.01) in B16F10 cells compared to non-irradiated cells (Fig. 4). By contrast, both cell lines pretreated with GA showed a dose-dependent decrease of ROS formation as compared to irradiated cells without GA. We also examined the effect of GA alone on ROS formation in non-irradiated G361 or B16F10 cells to rule out whether the upregulation of c-GCL and GST mRNA expressions in UVA-irradiated cells was mediated by the electrophilic property of GA capable of activating antioxidant enzyme genes associated with ROS generation. The addition of GA (7.5–30 lM) to G361 cells or B16F10 cells did not result in a significant change in intracellular ROS levels by 2 h after UV exposure compared to untreated cells (data not shown). 4. Discussion GA is a powerful antioxidant ubiquitously present in plants and fruits and shown to exhibit beneficial effect against hyperpigmentation.
20
U. Panich et al. / Journal of Photochemistry and Photobiology B: Biology 108 (2012) 16–22
Fig. 2. The inhibitory effects of GA on UVA-induced GSH depletion and GST inactivation. Time-course changes of GSH content (A) and GST activity (B) in G361 cells or B16F10 cells collected at 1, 4, 8, 16 and 24 h after UVA irradiation (8 J/cm2). The GSH content and GST activity related to the protein concentrations were expressed as a percentage of control (100%, non-UVA-irradiated and untreated cells). ⁄P < 0.05; ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001 compared with non-UVA-irradiated cells. Inhibition by GA (15–60 lM) against UVA-mediated GSH depletion (C) and GST inactivation (D) was examined in G361 cells or B16F10 cells at 1 h after irradiation. Determination of intracellular GSH content and GST activity was performed as described in Section 2. Data was expressed as mean ± SEM. The statistical significance of differences between the control and UVA-irradiated cells was evaluated by Student’s t test and between UVA-irradiated and GA-treated cells by one-way ANOVA followed by Tukey’s post hoc test. ###P < 0.001 compared with UVA-irradiated cells. ⁄P < 0.05; ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001 compared with untreated cells exposed to UVA.
We investigated the antimelanogenic effects of GA in association with modulation of GSH redox system in different melanoma cell lines, G361 and B16F10 cells irradiated with UVA. We observed a lower basal melanin level in G361 cells than that in B16F10 cells and a higher UVA dose (16 J/cm2) required to substantially induce melanin production in G361 cells than that (8 J/cm2) in B16F10 cells, indicating that G361 cells were less melanogenic than B16F10 cells. In addition, treatment of G361 cells or B16F10 cells with GA at non-cytotoxic concentrations was able to reduce UVA-induced melanin synthesis and tyrosinase activity. We previously demonstrated that ROS production mediated by UVR has been shown to be in direct proportion with enhanced melanin levels and tyrosinase upregulation in human melanoma cells [3], although a link between melanogenesis and cellular redox state is complicated and needs clarification. In this study, we showed that G361 and B16F10 cells had different redox states of the GSH–GCL system and GST as G361 cells had higher basal ROS levels but lower GSH content and GST activity than B16F10 cells. Furthermore, we observed that UV-irradiated B16F10 cells appeared to be more responsive to antimelanogenic effect of GA than G361 cells as lower concentrations of GA were required to suppress UVA-induced melanin production in B16F10 cells. Different degrees of oxidative insult in various pigment cell types may contribute to different responses of the cells to antimelanogenic effect of an antioxidant. GSH, a thiol antioxidant, involved in melanin synthesis is capable of protecting pigment cells against detrimental effects of photooxidative stress by neutralization of ROS and is also responsible for the conjugation reaction catalyzed by GST to convert a xenobiotic to a non-toxic metabolite [14–18]. Previous studies have
shown an inverse relationship between melanogenesis and GSH in melanoma cells [3,4,19]. We observed that a single dose of UVA radiation resulted in time-dependent changes in GSH level, GST activity as well as mRNA expression of c-GCLC, c-GCLM and GST in both cell lines. UVA exposure led to GSH loss and GST inactivation as early as 1 h after irradiation as well as downregulation of c-GCLC, c-GCLM and GST mRNA at 2 h following irradiation. Additionally, UVA irradiation induced a GSH depletion and ROS formation to the greater extent in G361 cells than in B16F10 cells. Our study has suggested that lightly pigmented melanoma cells were more susceptible to UV-induced cellular redox imbalance than more pigmented B16F10 cells. Lightly pigmented melanocytes were previously also shown to display lower levels of catalase activity [10]. Acute GSH depletion and GST inactivation in G361 cells and B16F10 cells exposed to UVA radiation could occur as a result of increased antioxidant consumption to eliminate excessive ROS and/ or direct inactivation of the enzymes by UVA or by ROS produced in response to UV irradiation [20]. UVA irradiation was observed to reduce activities of antioxidant enzymes including catalase in skin fibroblast through altering the protein structures [21]. However, the cellular and molecular mechanisms by which UVA affects GSH-related enzymes including c-GCL and GST in the pigmentproducing skin cells remain unclear and need further investigation in order to understand how cellular redox state regulates melanogenesis and antioxidant mechanisms underlying the antimelanogenic effects of phenolic antioxidants. UVA irradiation exhibited a time-dependent effect on cellular and molecular changes in GSH redox system in both G361 and B16F10 cells. While UVA radiation could mediate downregulation
U. Panich et al. / Journal of Photochemistry and Photobiology B: Biology 108 (2012) 16–22
21
Fig. 3. The inhibitory effects of GA on UVA-mediated downregulation of c-GCLC, c-GCLM and GST mRNA. Gene expression was quantitatively analyzed by real-time PCR with the 2 DDCt method. Time-course changes of c-GCLC and c-GCLM (A) as well as GST (B) in G361 cells or B16F10 cells harvested at 2, 4, 8 and 16 h after UVA irradiation (8 J/ cm2). ⁄P < 0.05; ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001 compared with non-UVA-irradiated cells. Protection by GA (7.5–30 lM) against UVA-induced downregulation of c-GCLC and c-GCLM (C) as well as GST (D) mRNA in G361 cells or B16F10 cells was determined at 2 h after irradiation. The data shown as the fold change in gene expression normalized to GAPDH and relative to the control sample. For the control (non-irradiated and untreated cells), DDCt equals zero and 20 equals one, so that the fold change in gene expression relative to the control equals one, by definition. For the UV-irradiated and treated cells, assessment of 2 DDCt indicates the fold change in gene expression relative to the control. Data was expressed as mean ± SEM. The statistical significance of differences between the control and UVA-irradiated cells was evaluated by Student’s t test and between UVAirradiated and GA-treated cells by one-way ANOVA followed by Tukey’s post hoc test. ###P < 0.001 compared with UVA-irradiated cells. ⁄P < 0.05; ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001 compared with untreated cells exposed to UVA.
Fig. 4. Inhibition by GA against UVA (8 J/cm2)-induced intracellular oxidant formation in G361 cells or B16F10 cells. Oxidation of DCFH-DA to fluorescent DCF by ROS produced in the cells was measured at 485 nm excitation and 530 nm emission. DCF fluorescence was measured within 2 h after UV exposure as described in Section 2. Intracellular oxidant levels were expressed as a percentage of control (100%, non-irradiated and untreated cells) using a microplate reader. Data was expressed as mean ± SEM. The statistical significance of differences between the control and UVA-irradiated cells was evaluated by Student’s t test and between UVA-irradiated and GA-treated cells by one-way ANOVA followed by Tukey’s post hoc test. ###P < 0.001 compared with UVA irradiated cells. ⁄P < 0.05; ⁄⁄ P < 0.01; ⁄⁄⁄P < 0.001 compared with untreated cells exposed to UVA.
of GSH–GCL system and GST, a restoration of GSH-related antioxidant defenses in G361 cells or B16F10 cells was observed at various time points. Previous studies have reported a similar pattern of changes in antioxidant parameters observed in skin and non-
skin tissues, showing that a single UV radiation caused an acute reduction of antioxidants including GSH, c-GCL and GST at cellular and molecular levels and the restoration was observed at various time points after UV irradiation [6,22,23]. Furthermore, UVA exposure led to an immediate loss of GSH in melanocytes and its recovery was found by 24 h after irradiation [24]. Cellular adaptation to oxidative stress through upregulation of mRNA expression may take place in response to a single UV dose-induced ROS formation in order to maintain redox state balance. Induction of cellular ROS or oxidative stress can either upregulate or downregulate mRNA expression of detoxification enzymes including GCL and GST through the electrophile response element, depending on several factors such as the degree of oxidative stress and exposure time [18,20,25]. GA-treated G361 and B16F10 cells demonstrated to protect against ROS formation, GSH depletion, GST inactivation as well as GCL and GST mRNA downregulation. The immediate increases in GSH content and GST activity within 1 h after UVA irradiation in GA-treated cells may be because GA attenuated antioxidant consumption by acting as a powerful free radical scavenger [26] and subsequently reserved cellular antioxidants. Since ROS formation could influence regulation of antioxidant defense mechanisms at cellular and molecular level, GA probably inhibited UVA-induced suppression of c-GCL and GST mRNA levels as a result of the ability of GA to rapidly decrease ROS levels induced by UVA irradiation. In our study, GA did not provide a direct regulatory effect on the mRNA levels since GA alone (up to 30 lM) did not significantly affect mRNA expression nor ROS levels in non-irradiated cells (data not shown), indicating that, in the early event within 2 h after a
22
U. Panich et al. / Journal of Photochemistry and Photobiology B: Biology 108 (2012) 16–22
single exposure of UVA, GA probably did not serve as an electrophile capable of upregulating mRNA expression of detoxification enzymes. In summary, GA exhibited antimelanogenic effect in association with the redox regulation of GSH–GCL system and GST at transcriptional and post-translational levels in G361 and B16F10 cells representing different redox status. Further studies using physiologically relevant skin models such as primary human melanocytes are also needed because different types of melanin-producing cells including melanocytes and melanoma cells from different sources (e.g., mouse and human) display different redox states that might affect the responses of the cells to UVA-mediated melanogenesis.
[10]
[11]
[12]
[13]
Acknowledgements
[14]
Appreciation is expressed to Thailand Research Fund (Grant No. DBG5380040), Mahidol University and the Faculty of Medicine, Siriraj Hospital, Mahidol University, for research funding. We are grateful to Mrs. Srisamorn Sudtim and Department of Dermatology, Faculty of Medicine, Siriraj Hospital, Mahidol University, for the generous valuable technical support related to the UV device.
[15]
[16]
[17]
References [1] A. Slominski, D.J. Tobin, S. Shibahara, J. Wortsman, Melanin pigmentation in mammalian skin and its hormonal regulation, Physiol. Rev. 84 (2004) 1155– 1228. [2] H.T. Wang, B. Choi, M.S. Tang, Melanocytes are deficient in repair of oxidative DNA damage and UV-induced photoproducts, Proc. Natl. Acad. Sci. USA 107 (2010) 12180–12185. [3] U. Panich, V. Tangsupaanan, T. Onkoksoong, K. Kongtaphan, K. Kasetsinsombat, P. Akarasereenont, A. Wongkajornsilp, Inhibition of UVA-mediated melanogenesis by ascorbic acid through modulation of antioxidant defense and nitric oxide system, Arch. Pharm. Res. 34 (2011) 811–820. [4] N.P. Smit, F.A. van Nieuwpoort, L. Marrot, C. Out, B. Poorthuis, H. van Pelt, J.R. Meunier, S. Pavel, Increased melanogenesis is a risk factor for oxidative DNA damage – study on cultured melanocytes and atypical nevus cells, Photochem. Photobiol. 84 (2008) 550–555. [5] H.J. Niggli, L.A. Applegate, Glutathione response after UVA irradiation in mitotic and postmitotic human skin fibroblasts and keratinocytes, Photochem. Photobiol. 65 (1997) 680–684. [6] M. Meloni, J.F. Nicolay, Dynamic monitoring of glutathione redox status in UVB irradiated reconstituted epidermis: effect of antioxidant activity on skin homeostasis, Toxicol. In Vitro 17 (2003) 609–613. [7] L.G. Chen, W.L. Chang, C.J. Lee, L.T. Lee, C.M. Shih, C.C. Wang, Melanogenesis inhibition by gallotannins from Chinese galls in B16 mouse melanoma cells, Biol. Pharm. Bull. 32 (2009) 1447–1452. [8] D. Barker, K. Dixon, E.E. Medrano, D. Smalara, S. Im, D. Mitchell, G. Babcock, Z.A. Abdel-Malek, Comparison of the responses of human melanocytes with different melanin contents to ultraviolet B irradiation, Cancer Res. 55 (1995) 4041–4046. [9] S. Takeuchi, W. Zhang, K. Wakamatsu, S. Ito, V.J. Hearing, K.H. Kraemer, D.E. Brash, Melanin acts as a potent UVB photosensitizer to cause an atypical mode
[18]
[19] [20]
[21]
[22]
[23]
[24]
[25]
[26]
of cell death in murine skin, Proc. Natl. Acad. Sci. USA 101 (2004) 15076– 15081. V. Maresca, E. Flori, S. Briganti, A. Mastrofrancesco, C. Fabbri, A.M. Mileo, M.G. Paggi, M. Picardo, Correlation between melanogenic and catalase activity in in vitro human melanocytes: a synergic strategy against oxidative stress, Pigment Cell Melanoma Res. 21 (2008) 200–205. Y.G. Kang, E.J. Choi, Y. Choi, J.K. Hwang, 5,7-dimethoxyflavone induces melanogenesis in B16F10 melanoma cells through cAMP-dependent signaling, Exp. Dermatol. 20 (2011) 445–447. U. Panich, K. Kongtaphan, T. Onkoksoong, K. Jaemsak, R. Phadungrakwittaya, A. Thaworn, P. Akarasereenont, A. Wongkajornsilp, Modulation of antioxidant defense by Alpinia galanga and Curcuma aromatica extracts correlates with their inhibition of UVA-induced melanogenesis, Cell Biol. Toxicol. 26 (2010) 103–116. U. Ketsawatsakul, Modulation by bicarbonate of the protective effects of phenolic antioxidants on peroxynitrite-mediated cell cytotoxicity, ScienceAsia 33 (2007) 273–282. D. Schadendorf, K. Jurgovsky, C.M. Kohlmus, B.M. Czarnetzki, Glutathione and related enzymes in tumor progression and metastases of human melanoma, J. Invest. Dermatol. 105 (1995) 109–112. A. Kokot, D. Metze, N. Mouchet, M.D. Galibert, M. Schiller, T.A. Luger, M. Bohm, Alpha-melanocyte-stimulating hormone counteracts the suppressive effect of UVB on Nrf2 and Nrf-dependent gene expression in human skin, Endocrinology 150 (2009) 3197–3206. M.A. Cotter, J. Thomas, P. Cassidy, K. Robinette, N. Jenkins, S.R. Florell, S. Leachman, W.E. Samlowski, D. Grossman, N-acetylcysteine protects melanocytes against oxidative stress/damage and delays onset of ultravioletinduced melanoma in mice, Clin. Cancer Res. 13 (2007) 5952–5958. Y. Zhang, V. Gonzalez, M.J. Xu, Expression and regulation of glutathione Stransferase P1-1 in cultured human epidermal cells, J. Dermatol. Sci. 30 (2002) 205–214. L. Marrot, C. Jones, P. Perez, J.R. Meunier, The significance of Nrf2 pathway in (photo)-oxidative stress response in melanocytes and keratinocytes of the human epidermis, Pigment Cell Melanoma Res. 21 (2008) 79–88. T. Yokozawa, Y.J. Kim, Piceatannol inhibits melanogenesis by its antioxidative actions, Biol. Pharm. Bull. 30 (2007) 2007–2011. D.A. Dickinson, A.L. Levonen, D.R. Moellering, E.K. Arnold, H. Zhang, V.M. Darley-Usmar, H.J. Forman, Human glutamate cysteine ligase gene regulation through the electrophile response element, Free Rad. Biol. Med. 37 (2004) 1152–1159. Y. Shindo, T. Hashimoto, Time course of changes in antioxidant enzymes in human skin fibroblasts after UVA irradiation, J. Dermatol. Sci. 14 (1997) 225– 232. A.R. Svobodova, A. Galandakova, J. Sianska, D. Dolezal, J. Ulrichova, J. Vostalova, Acute exposure to solar simulated ultraviolet radiation affects oxidative stress-related biomarkers in skin, liver and blood of hairless mice, Biol. Pharm. Bull. 34 (2011) 471–479. M. Zhu, G.T. Bowden, Molecular mechanism(s) for UV-B irradiation-induced glutathione depletion in cultured human keratinocytes, Photochem. Photobiol. 80 (2004) 191–196. P. Larsson, E. Andersson, U. Johansson, K. Ollinger, I. Rosdahl, Ultraviolet A and B affect human melanocytes and keratinocytes differently, a study of oxidative alterations and apoptosis, Exp. Dermatol. 14 (2005) 117–123. M. Schafer, S. Dutsch, U. auf dem Keller, F. Navid, A. Schwarz, D.A. Johnson, J.A. Johnson, S. Werner, Nrf2 establishes a glutathione-mediated gradient of UVB cytoprotection in the epidermis, Genes Dev. 24 (2010) 1045–1058. U. Ketsawatsakul, M. Whiteman, B. Halliwell, A reevaluation of the peroxynitrite scavenging activity of some dietary phenolics, Biochem. Biophy. Res. Commun. 279 (2000) 692–699.