- Email: [email protected]
Validation of a quantitative real-time PCR assay for HTLV-1 proviral load in peripheral blood mononuclear cells
G Model VIRMET 12243 1–6
ARTICLE IN PRESS Journal of Virological Methods xxx (2013) xxx–xxx
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Validation of a quantitative real-time PCR assay for HTLV-1 proviral load in peripheral blood mononuclear cells
1
2
3 4 5 6 7 8 9 10
Q1
Carolina Rosadas a,∗ , Mauro Jorge Cabral-Castro a,b , Ana Carolina Paulo Vicente c , José Mauro Peralta b , Marzia Puccioni-Sohler a,d a Laboratório de Líquido Cefalorraquiano, Servic¸o de Patologia Clínica, Hospital Universitário Clementino Fraga Filho (HUCFF)/Programa de Pós Graduac¸ão em Doenc¸as Infecciosas e Parasitárias, Faculdade de Medicina,Universidade Federal do Rio de Janeiro (UFRJ), Rio de Janeiro, Brazil b Laboratório de Diagnóstico Imunológico e Molecular de Doenc¸as Infecciosas e Parasitárias/Programa de Pós Graduac¸ão do Instituto de Microbiologia Paulo Góes, UFRJ, Rio de Janeiro, Brazil c Laboratório de Genética de Microorganismos, Instituto Oswaldo Cruz (IOC), Fundac¸ão Oswaldo Cruz (FIOCRUZ), Rio de Janeiro, Brazil d Escola de Medicina e Cirurgia, Universidade Federal do Estado do Rio de Janeiro (UNIRIO), Brazil
11
a b s t r a c t
12 13 14 15 16 17
Article history: Received 18 February 2013 Received in revised form 9 July 2013 Accepted 15 July 2013 Available online xxx
18
23
Keywords: HTLV-1 Real-time PCR Proviral load PBMCs
24
1. Introduction
19 20 21 22
25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
The objective of this study was to validate a TaqMan real-time PCR assay for HTLV-1 proviral load detection in peripheral blood mononuclear cells. TARL-2 cells were used to generate a standard curve. Peripheral blood mononuclear cell gDNA from 27 seropositive and 23 seronegative samples was analyzed. The sensitivity, specificity, accuracy, precision, dynamic range of the standard curve and qPCR efficiency were evaluated. All of the positive samples amplified the target gene. All of the negative samples amplified only the control gene (ˇ-actin). The assay presented 100% specificity and sensibility. The intra- and interassay variability was 2.4% and 2.2%, respectively. The qPCR efficiency, slope and correlation coefficients (r2 ) were all acceptable. The limit of detection was 1 copy/rxn. This assay can reliably quantify HTLV-1 proviral load. © 2013 Published by Elsevier B.V.
The human T-cell lymphotropic virus type 1 (HTLV-1) was the first retrovirus described in humans (Poiesz et al., 1980). HTLV-1 infection remains asymptomatic in most infected individuals. However, the virus may cause a neurological chronic disorder referred to as HTLV-1-associated myelopathy (HAM/TSP) (Gessain et al., 1985; Osame et al., 1986). HTLV-1 infection is also related to adult T-cell leukemia/lymphoma (Poiesz et al., 1980). The laboratory diagnosis of this viral infection is based on immunoassays such as ELISA and Western blot. These techniques have several disadvantages, as in cases with indeterminate results and their impossibility of being used in immunosuppressed patients or in neonatal infections. These immunoassays, which are based on antibody detection, may also yield false-negative results for recent infections (Tamegão-Lopes et al., 2006). In such cases, molecular biology techniques are an alternative (Andrade et al., 2010). Beyond qualitative results, real-time PCR can quantify
∗ Corresponding author at: Laboratório de Líquido Cefalorraquiano, Servic¸o de Patologia Clínica, Hospital Universitário Clementino Fraga Filho, Universidade Federal do Rio de Janeiro (UFRJ). Rua Professor Rodolpho Paulo Rocco 255, 3 andar, Zipcode: 21941-913, Rio de Janeiro, RJ, Brazil. Tel.: +55 21 25622494. E-mail address: [email protected] (C. Rosadas).
proviral load, which may help to assess disease progression (Besson and Kazanji, 2009; Nagai et al., 1998; Olindo et al., 2005). Although real-time PCR has a high sensitivity and specificity, the method is still an in-house technique. Thus, prior validation is essential before the implementation of this technique in routine laboratory (Kamihira et al., 2010). The present study aimed to validate a TaqMan real-time PCR assay for HTLV-1 proviral load detection in peripheral blood mononuclear cells (PBMCs) based on a conserved region of the pX gene.
41 42 43 44 45 46 47 48 49
2. Materials and methods
50
2.1. Clinical samples
51
Samples of frozen PBMCs were obtained from 27 HTLV-1seropositive patients seen at the Neuroinfection Outpatient Clinic, Hospital Universitário Gaffrée e Guinle (HUGG/UNIRIO). These samples were tested by ELISA (Murex HTLV-I + II, Diasorin, United Kingdom). The presence of anti-HTLV-1 antibodies was confirmed by Western blotting. In total, 23 seronegative individuals (screened by ELISA) were included in the study. The genomic DNA (gDNA) was extracted using a QiAmp DNA Mini Kit (Qiagen) according to the manufacturer’s instructions.
0166-0934/$ – see front matter © 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.jviromet.2013.07.040
Please cite this article in press as: Rosadas, C., et al., Validation of a quantitative real-time PCR assay for HTLV-1 proviral load in peripheral blood mononuclear cells. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.07.040
52 53 54 55 56 57 58 59 60
ARTICLE IN PRESS
G Model VIRMET 12243 1–6
C. Rosadas et al. / Journal of Virological Methods xxx (2013) xxx–xxx
2
Table 1 Description of primers and probes used in real time PCR. Primers and probes
Sequence
pX (HTLV-1) pX Forward primer pX Reverse primer pX TaqMan probe
Position
ACAAAGTTAACCATGCTTATTATCAGC ACACGTAGACTGGGTATCCGAA FAM-TTCCCAGGGTTTGGACAGAGTCTTCT-TAMRA
7299–7325 7378–7357 7330–7355
-actin Actin Forward primer Actin Forward primer Actin TaqMan probe
CACATCGTGCCCATCTACGA CTCAGTGAGGATCTTCATGAGGTAGT FAM-ATGCCCTCCCCCATGCCATCCTGCGT-TAMRA
2146–2165 2250–2225 2171–2196
Fig. 1. Sequence alignments of target sequence used in real-time PCR.
Table 2 Reproducibility experiments: intra- and inter-assay reproducibility of TARL-2 cells DNA standard dilutions analyzed in triplicate on four different assays. CT Mean
Intra-assay variability Experiment 1
61
62 63 64
65
66 67 68 69 70 71 72 73 74 75 76 77 78
pX 50,000 50,00 500 50 5 -actin 66,600 13,320 2664 532 106.6
Inter-assay Experiment 2
Experiment 3
Experiment 4
SD
CV (%)
SD
CV (%)
SD
CV (%)
SD
CV (%)
22.7 26.0 29.5 33.0 36.3
0.1 0 0.1 0.2 0.6
0.6 0.2 0.4 0.6 1.7
0.1 0.1 0.1 0.2 0.1
0.3 0.2 0.2 0.6 0.3
0.1 0.1 0 0 0.1
0.3 0.3 0 0 0.2
0 0.1 0.1 0.2 0.8
0.1 0.4 0.5 0.7 2.2
1.5 1.5 1.2 0.7 2.1
23.4 24.3 25.0 25.6 26.8
0 0.1 0.2 0.1 0.1
0.1 0.5 0.9 0.5 0.4
0 0.1 0.2 0.1 0.1
0.2 0.5 0.6 0.4 0.3
0 0.1 0.1 0.1 0.1
0 0.3 0.4 0.2 0.2
0 0.1 0.2 0.1 0.1
0.2 0.6 0.7 0.3 0.3
2.2 2.2 1.9 1.8 2.0
2.2. Cell line description
2.4. TaqMan real-time quantitative PCR
The gDNA of TARL-2 cells was kindly provided by National Institutes of Health (USA). TARL-2 cells are a rat T-cell line that contains a single copy of HTLV-1 provirus (Tateno et al., 1984).
Real-time PCRs were conducted using a 7500 ABI (Applied Biosystems). The DNA of HTLV-1-infected TARL-2 cells was used for the standard curve. Serial 10-fold dilutions were analyzed from 5 × 104 to 5 copies of pX. The DNA of PBMCs from non-infected individuals was used for the ˇ-actin standard curve. The series represented a five-fold dilution of up to 6.6 × 104 copies of ˇactin (Table 2). Both standard curves were repeated during each experiment. Because there is a wide range of proviral loads among patients, to evaluate the intra- and inter-assay variation, each standard curve dilution was analyzed in triplicate in four different assays. Moreover, one sample was tested 15 times on two consecutive days. Five clinical samples with different proviral loads (0.1; 1.8; 18.8; 24.5; 109.2 copies/100PBMCs) were selected and also analyzed in triplicate on two different days. To evaluate the limit of detection, a sample containing only one copy of the target gene was added and analyzed in duplicate in three consecutive days. The real-time PCR mixtures consisted of 12.5 L of 2X TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA), 0.9 M of forward and reverse primers and 0.25 M of probe brought up to 2.5 L with nuclease-free water and 10 L of gDNA (10 ng/L clinical samples or standard template), totaling 25 L
2.3. Primers and probes The primers and probes used were described previously (Nagai et al., 1998). Briefly, for the HTLV-1 pX region, the primer set was 5 -ACAAAGTTAACCATGCTTATTATCAGC-3 and 5 ACACGTAGACTGGGTATCCGAA-3 (positioned at 7299–7325 and 7378–7357, respectively; GenBank: J02029.1). The TaqMan fluorescent probe used was FAM- TTCCCAGGGTTTGGACAGAGTCTTCT – TAMRA (positioned at 7330–7355; GenBank: J02029.1). The ˇ-actin gene was used as an internal control and to determine the input cell number to avoid variation due to differences in DNA input into the reaction. The primer set was 5 -CACATCGTGCCCATCTACGA-3 and 5 -CTCAGTGAGGATCTTCATGAGGTAGT-3 . The ˇ-actin probe was FAM- ATGCCCTCCCCCATGCCATCCTGCGT – TAMRA (Table 1). The BioEdit program was used for sequence alignments (Fig. 1).
Please cite this article in press as: Rosadas, C., et al., Validation of a quantitative real-time PCR assay for HTLV-1 proviral load in peripheral blood mononuclear cells. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.07.040
79
80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100
G Model VIRMET 12243 1–6
ARTICLE IN PRESS C. Rosadas et al. / Journal of Virological Methods xxx (2013) xxx–xxx
3
Fig. 2. Reproducibility Experiments: Amplification plot of target (pX) and control (actin) gene of the same sample analyzed 15 times: (A) Experiment 1; (B) Experiment 2.
101 102 103 104 105
106
107 108 109 110 111 112 113 114 115 116 117 118 119
per reaction. The amplification conditions were 2 min at 50 ◦ C (activation of UNG); 10 min at 95 ◦ C (inactivation of UNG and activation of Taq polymerase); 45 cycles of 15 s at 95 ◦ C (denaturation) and 1 min at 60 ◦ C (annealing and extension); and 25 ◦ C for 2 min.
2.6. Statistical analysis To evaluate the intra- and the inter-assay reproducibility, the coefficient of variation (CV) of the CT values was calculated. According to previous data, a CV of a CT of 3% or 10% for intra- and inter-assay reproducibility, respectively, is acceptable (Dehée et al., 2002; Estes and Sevall, 2003; Moens et al., 2009). For proviral load comparison between the two study groups (HAM/TSP and nonHAM/TSP), a Mann–Whitney test was used.
120
121 122 123 124 125 126 127
2.5. Determination of HTLV-1 proviral load Based on the threshold cycle (CT ) of the standard dilutions of TARL-2 cell and PBMC DNA, standard curves were produced. The copy number of the unknown samples was determined by plotting each CT on the standard curves. To determine the HTLV-1 proviral load, the following formula was used: copy number of HTLV-1 pX gene per 1 × 102 PBMCs = [(copy number of pX)/(copy number of actin)/2)] × 102 (Nagai et al., 1998). The copy number of the pX and actin genes was the mean value of the triplicate analysis of each sample. The HTLV-1-infected individuals were classified into two study groups: HAM/TSP (patients with a definite diagnosis according to Osame’s criteria) and non-HAM/TSP (HTLV-1-infected individuals without a HAM/TSP diagnosis).
2.7. Ethical considerations The present study was developed in accordance with the Helsinki Declaration of 1975, as revised in 1983. The study was approved by the Ethical Committee of the HUCFF/UFRJ and HUGG/UNIRIO.
128
129 130 131 132
3. Results
133
3.1. Intra- and inter-assay reproducibility
134
To test the intra- and inter-assay reproducibility, the standard curve was evaluated on triplicate. The assay gave a CV for the
Please cite this article in press as: Rosadas, C., et al., Validation of a quantitative real-time PCR assay for HTLV-1 proviral load in peripheral blood mononuclear cells. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.07.040
135 136
G Model VIRMET 12243 1–6
ARTICLE IN PRESS C. Rosadas et al. / Journal of Virological Methods xxx (2013) xxx–xxx
4
Fig. 3. Amplification plot of standard curve, obtained with serial dilution performed in the ratio of 10 to a range of 5 × 104 to 5 copies of pX gene (TARL-2 cells). Each dilution was tested in triplicate.
137 138 139 140 141 142 143 144 145
146 147
CT values of less than 2.2% for intra- and inter-assay variability (Table 2). One sample was also tested 15 times on two consecutive days. For this sample, the intra-assay reproducibility was 0.3% and 0.4% on each experiment, and the inter-assay reproducibility was 2.0% (Fig. 2). The mean CT values and the CV for each dilution of the standard curves are listed in Table 2. Confirming the intra-assay reproducibility of all clinical samples in triplicate presented a CV of less than 2.4%. Moreover, the five clinical samples analyzed on two different days showed a CV of less than 0.6%. 3.2. Standard curve, dynamic range of the assay and limit of detection
156
The qPCR efficiency, slope and correlation coefficients (r2 ) were all acceptable (at least 98.6%, −3.316 and 0.993, respectively) (Fig. 3). To determine the limit of detection, one sample containing one copy of the pX gene (from TARL-2 cells) was tested. The assay was able to detect the infection (Fig. 4). Therefore, the limit of detection was 1 copy/rxn. The mean CT value and the CV for the replicates of the sample containing only one copy of the pX gene were 38.2 (SD ± 0.4) and 0.6% (intra-assay) and 1.1% (inter-assay). The CT values of the replicates varied from 37.8 to 38.8.
157
3.3. Specificity and sensitivity
148 149 150 151 152 153 154 155
161
All seropositive samples (n = 27) presented gene amplification. The negative samples were not amplified for the HTLV-1 pX gene (n = 23) but presented amplification of the reference gene (actin). Therefore, the assay presented 100% specificity and sensitivity.
162
3.4. HTLV-1 proviral load
158 159 160
163 164 165
The mean proviral load of the seropositive samples was 26.5 (SD: 35.8; SE: 6.9; 95% CI: 12.3–40.6). The proviral load varied in a range of 0.05–146.8 copies/100 PBMCs. The mean proviral load of
the HAM/TSP patients (mean ± SD = 36.3 ± 40.2; SE: 9.5) was higher than in the non-HAM/TSP group (mean ± SD = 6.9 ± 8.8; SE: 2.9; p < 0.005).
4. Discussion For the validation of clinical molecular tests, sensitivity, specificity, accuracy, precision, reproducibility and linearity have to be established (Mattocks et al., 2010). In this study, the assay had 100% sensitivity and specificity once all of the seropositive samples showed gene amplification and all of the seronegative samples did not amplify the target gene. These results also reflect the high test accuracy. Regarding precision, the intra- and inter-assay reproducibility was acceptable both for the standard curve and for the sample repeated 15 times. It is important to emphasize that even the triplicates of the sample containing a single copy of the target gene showed good reproducibility. This finding contrasts with the data described by Miley et al. (2000), who reported greater variability at lower copy numbers. When considering the dynamic range of the assay, the test showed a strong linear relationship between the CT values and the log10 of the number of copies of HTLV-1 (TARL-2 cells). The assay also presented acceptable efficiency and can detect low levels of proviral load (1 copy/rxn). It is important to highlight that in the present assay, the gDNA of PBMCs was used for proviral load quantification. Although this protocol requires a step of sample preparation, the use of PBMC gDNA enhances the sensibility of the test. This feature also influences the test’s limit of detection. In this context, when evaluating the HTLV-1 proviral load in whole blood, a previous study detected three of nine replicates with one copy of HTLV-1, resulting in a limit of detection between 1 and 10 copies/rxn (Naderi et al., 2012). In the present technique and in a study by Lee et al. (2004), the assay was able to detect a single viral
Please cite this article in press as: Rosadas, C., et al., Validation of a quantitative real-time PCR assay for HTLV-1 proviral load in peripheral blood mononuclear cells. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.07.040
166 167 168
169
170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197
G Model VIRMET 12243 1–6
ARTICLE IN PRESS C. Rosadas et al. / Journal of Virological Methods xxx (2013) xxx–xxx
5
Fig. 4. Amplification plot of the sample containing one copy of pX gene from HTLV-1.
239
copy. However, in the assay developed by Lee et al. (2004), SYBR Green was used rather than the TaqMan system. It is known that the PCR is a very sensitive technique once it can amplify the target gene and is also a high specific technique. This high specificity is related to primer annealing. In this context, the TaqMan system increases the assay specificity when this method is based on a fluorometric probe. This probe hybridizes to a complementary target sequence but not to nonspecific PCR products or primer dimers, which may happen when intercalating dyes, such as SYBR Green, are used (Heid et al., 1996; Holland et al., 1991). Thus, the primer and probe design is particularly important. The probe and the primer set used in this study were very specific. However, these reagents presented high similarity for different HTLV-1 strains from distinct regions of the world. It is important to emphasize that in virology, molecular tests can be used for diagnostic purposes and also as a prognostic tool. In this context, previous studies demonstrated that HTLV-1 proviral load is correlated with clinical disease. In HTLV-1 infection, proviral load detection is indicated once the virus is not usually found as a cell-free virus, in contrast to HIV infection. Thus, the objective is the identification and quantification of viral DNA integrated into the genome of the target cell. Previous studies showed that patients with clinical manifestations of HTLV-1 infection (HAM/TSP and ATLL) presented a higher proviral load than asymptomatic individuals. In this study, the seropositive samples were from patients with HAM/TSP and from asymptomatic carriers, and similar differences were observed. The HAM/TSP group presented a higher proviral load than the non-HAM/TSP individuals. Two individuals with HAM/TSP presented a proviral load greater than 100%, indicating that there is more than one provirus per PBMC (Demontis et al., 2013). It is important to highlight that the quantity of ˇ-actin detected in those two samples was similar to the amount in other samples (CT values: 24.1 and 22.8). This finding was observed in other previous studies. In the present study, a wide variation in proviral load was detected. This variation was also described by Kamihira et al. (2010). It is suggested that the biological characteristics of the virus (such as defects or mutations in target regions) or multiple integration of the proviral genome could explain the variation. Also, it cannot be excluded that the observed differences may be due to both individual factors, such as the host immune response, and viral genetics.
240
5. Conclusion
198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238
241
This assay can reliably quantify HTLV-1 proviral load.
Financial support This work had the financial support from Fundac¸ão de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ), a PhD fellowship to C.R. from Coordenac¸ão de Aperfeic¸oamento de Pessoal de Nível Superior (CAPES) and a PhD fellowship to M.J.C.C. from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Brazil.
242
243 244 245 246 247 248
Competing interests
249
None declared.
250
Acknowledgments The authors thank Dr. Steven Jacobson (NIH) for providing the TARL-2 cell DNA and Rosangela Aparecida Martins Noé (Divisão de Pesquisa do HUCFF/UFRJ) for statistical support. References Andrade, R.G., Ribeiro, M.A., Namen-Lopes, M.S., Silva, S.M., Basques, F.V., Ribas, J.G., Carneiro-Proietti, A.B., Martins, M.L., 2010. Evaluation of the use of real-time PCR for human T cell lymphotropic virus 1 and 2 as a confirmatory test in screening for blood donors. Rev. Soc. Bras. Med. Trop. 43, 111–115. Besson, G., Kazanji, M., 2009. One-step, multiplex, real-time PCR assay with molecular beacon probes for simultaneous detection, differentiation, and quantification of human T-cell leukemia virus types 1, 2, and 3. J. Clin. Microbiol. 47, 1129–1135. Dehée, A., Césaire, R., Désiré, N., Lézin, A., Bourdonné, O., Béra, O., Plumelle, Y., Smadja, D., Nicolas, J.C., 2002. Quantitation of HTLV-I proviral load by a TaqMan real-time PCR assay. J. Virol. Methods 102, 37–51. Demontis, M.A., Hilburn, S., Taylor, G.P., 2013. Human T cell lymphotropic virus Type 1 viral load variability and long-term trends in asymptomatic carriers and in patients with human T cell lymphotropic virus Type 1-related diseases. AIDS Res. Hum. Retroviruses 29, 359–364. Estes, M.C., Sevall, J.S., 2003. Multiplex PCR using real time DNA amplification for the rapid detection and quantitation of HTLV I or II. Mol. Cell Probes 17, 59–68. Gessain, A., Barin, F., Vernant, J.C., Gout, O., Maurs, L., Calender, A., de Thé, G., 1985. Antibodies to human T-lymphotropic virus type-I in patients with tropical spastic paraparesis. Lancet 2, 407–410. Heid, C.A., Stevens, J., Livak, K.J., Williams, P.M., 1996. Real time quantitative PCR. Genome Res. 6, 986–994. Holland, P.M., Abramson, R.D., Watson, R., Gelfand, D.H., 1991. Detection of specific polymerase chain reaction product by utilizing the 5 –3 exonuclease activity of Thermus aquaticus DNA polymerase. Proc. Natl. Acad. Sci. U. S. A. 88, 7276–7280. Kamihira, S., Yamano, Y., Iwanaga, M., Sasaki, D., Satake, M., Okayama, A., Umeki, K., Kubota, R., Izumo, S., Yamaguchi, K., Watanabe, T., 2010. Intra- and interlaboratory variability in human T-cell leukemia virus type-1 proviral load quantification using real-time polymerase chain reaction assays: a multi-center study. Cancer Sci. 101, 2361–2367.
Please cite this article in press as: Rosadas, C., et al., Validation of a quantitative real-time PCR assay for HTLV-1 proviral load in peripheral blood mononuclear cells. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.07.040
251
252 253 254
255
256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286
G Model VIRMET 12243 1–6 6
287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308
ARTICLE IN PRESS C. Rosadas et al. / Journal of Virological Methods xxx (2013) xxx–xxx
Lee, T.H., Chafets, D.M., Busch, M.P., Murphy, E.L., 2004. Quantitation of HTLV-I and II proviral load using real-time quantitative PCR with SYBR Green chemistry. J. Clin. Virol. 31, 275–282. Mattocks, C.J., Morris, M.A., Matthijs, G., Swinnen, E., Corveleyn, A., Dequeker, E., Müller, C.R., Pratt, V., Wallace, A., EuroGentest Validation Group, 2010. A standardized framework for the validation and verification of clinical molecular genetic tests. Eur. J. Hum. Genet. 18, 1276–1288. Miley, W.J., Suryanarayana, K., Manns, A., Kubota, R., Jacobson, S., Lifson, J.D., Waters, D., 2000. Real-time polymerase chain reaction assay for cellassociated HTLV type I DNA viral load. AIDS Res. Hum. Retroviruses 16, 665–675. Moens, B., López, G., Adaui, V., González, E., Kerremans, L., Clark, D., Verdonck, K., Gotuzzo, E., Vanham, G., Cassar, O., Gessain, A., Vandamme, A.M., Van Dooren, S., 2009. Development and validation of a multiplex realtime PCR assay for simultaneous genotyping and human T-lymphotropic virus type 1, 2, and 3 proviral load determination. J. Clin. Microbiol. 47, 3682–3691. Naderi, M., Paryan, M., Azadmanesh, K., Rafatpanah, H., Rezvan, H., Mirab Samiee, S., 2012. Design and development of a quantitative real time PCR assay for monitoring of HTLV-1 provirus in whole blood. J. Clin. Virol. 53, 302–307.
Nagai, M., Usuku, K., Matsumoto, W., Kodama, D., Takenouchi, N., Moritoyo, T., Hashiguchi, S., Ichinose, M., Bangham, C.R., Izumo, S., Osame, M., 1998. Analysis of HTLV-I proviral load in 202 HAM/TSP patients and 243 asymptomatic HTLV-I carriers: high proviral load strongly predisposes to HAM/TSP. J. Neurovirol. 4, 586–593. Olindo, S., Lézin, A., Cabre, P., Merle, H., Saint-Vil, M., Edimonana Kaptue, M., Signate, A., Césaire, R., Smadja, D., 2005. HTLV-1 proviral load in peripheral blood mononuclear cells quantified in 100 HAM/TSP patients: a marker of disease progression. J. Neurol. Sci. 237, 53–59. Osame, M., Usuku, K., Izumo, S., Ijichi, N., Amitani, H., Igata, A., Matsumoto, M., Tara, M., 1986. HTLV-I associated myelopathy, a new clinical entity. Lancet 1, 1031–1032. Poiesz, B.J., Ruscetti, F.W., Gazdar, A.F., Bunn, P.A., Minna, J.D., Gallo, R.C., 1980. Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc. Natl. Acad. Sci. U. S. A. 77, 7415–7419. Tamegão-Lopes, B.P., Rezende, P.R., Maradei-Pereira, L.M., de Lemos, J.Á., 2006. HTLV-1 and HTLV-2 proviral load: a simple method using quantitative real-time PCR. Rev. Soc. Bras. Med. Trop. 39, 548–552. Tateno, M., Kondo, N., Itoh, T., Chubachi, T., Togashi, T., Yoshiki, T., 1984. Rat lymphoid cell lines with human T cell leukemia virus production: biological and serological characterization. J. Exp. Med. 159, 1105–1116.
Please cite this article in press as: Rosadas, C., et al., Validation of a quantitative real-time PCR assay for HTLV-1 proviral load in peripheral blood mononuclear cells. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.07.040
309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330
ARTICLE IN PRESS Journal of Virological Methods xxx (2013) xxx–xxx
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Validation of a quantitative real-time PCR assay for HTLV-1 proviral load in peripheral blood mononuclear cells
1
2
3 4 5 6 7 8 9 10
Q1
Carolina Rosadas a,∗ , Mauro Jorge Cabral-Castro a,b , Ana Carolina Paulo Vicente c , José Mauro Peralta b , Marzia Puccioni-Sohler a,d a Laboratório de Líquido Cefalorraquiano, Servic¸o de Patologia Clínica, Hospital Universitário Clementino Fraga Filho (HUCFF)/Programa de Pós Graduac¸ão em Doenc¸as Infecciosas e Parasitárias, Faculdade de Medicina,Universidade Federal do Rio de Janeiro (UFRJ), Rio de Janeiro, Brazil b Laboratório de Diagnóstico Imunológico e Molecular de Doenc¸as Infecciosas e Parasitárias/Programa de Pós Graduac¸ão do Instituto de Microbiologia Paulo Góes, UFRJ, Rio de Janeiro, Brazil c Laboratório de Genética de Microorganismos, Instituto Oswaldo Cruz (IOC), Fundac¸ão Oswaldo Cruz (FIOCRUZ), Rio de Janeiro, Brazil d Escola de Medicina e Cirurgia, Universidade Federal do Estado do Rio de Janeiro (UNIRIO), Brazil
11
a b s t r a c t
12 13 14 15 16 17
Article history: Received 18 February 2013 Received in revised form 9 July 2013 Accepted 15 July 2013 Available online xxx
18
23
Keywords: HTLV-1 Real-time PCR Proviral load PBMCs
24
1. Introduction
19 20 21 22
25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
The objective of this study was to validate a TaqMan real-time PCR assay for HTLV-1 proviral load detection in peripheral blood mononuclear cells. TARL-2 cells were used to generate a standard curve. Peripheral blood mononuclear cell gDNA from 27 seropositive and 23 seronegative samples was analyzed. The sensitivity, specificity, accuracy, precision, dynamic range of the standard curve and qPCR efficiency were evaluated. All of the positive samples amplified the target gene. All of the negative samples amplified only the control gene (ˇ-actin). The assay presented 100% specificity and sensibility. The intra- and interassay variability was 2.4% and 2.2%, respectively. The qPCR efficiency, slope and correlation coefficients (r2 ) were all acceptable. The limit of detection was 1 copy/rxn. This assay can reliably quantify HTLV-1 proviral load. © 2013 Published by Elsevier B.V.
The human T-cell lymphotropic virus type 1 (HTLV-1) was the first retrovirus described in humans (Poiesz et al., 1980). HTLV-1 infection remains asymptomatic in most infected individuals. However, the virus may cause a neurological chronic disorder referred to as HTLV-1-associated myelopathy (HAM/TSP) (Gessain et al., 1985; Osame et al., 1986). HTLV-1 infection is also related to adult T-cell leukemia/lymphoma (Poiesz et al., 1980). The laboratory diagnosis of this viral infection is based on immunoassays such as ELISA and Western blot. These techniques have several disadvantages, as in cases with indeterminate results and their impossibility of being used in immunosuppressed patients or in neonatal infections. These immunoassays, which are based on antibody detection, may also yield false-negative results for recent infections (Tamegão-Lopes et al., 2006). In such cases, molecular biology techniques are an alternative (Andrade et al., 2010). Beyond qualitative results, real-time PCR can quantify
∗ Corresponding author at: Laboratório de Líquido Cefalorraquiano, Servic¸o de Patologia Clínica, Hospital Universitário Clementino Fraga Filho, Universidade Federal do Rio de Janeiro (UFRJ). Rua Professor Rodolpho Paulo Rocco 255, 3 andar, Zipcode: 21941-913, Rio de Janeiro, RJ, Brazil. Tel.: +55 21 25622494. E-mail address: [email protected] (C. Rosadas).
proviral load, which may help to assess disease progression (Besson and Kazanji, 2009; Nagai et al., 1998; Olindo et al., 2005). Although real-time PCR has a high sensitivity and specificity, the method is still an in-house technique. Thus, prior validation is essential before the implementation of this technique in routine laboratory (Kamihira et al., 2010). The present study aimed to validate a TaqMan real-time PCR assay for HTLV-1 proviral load detection in peripheral blood mononuclear cells (PBMCs) based on a conserved region of the pX gene.
41 42 43 44 45 46 47 48 49
2. Materials and methods
50
2.1. Clinical samples
51
Samples of frozen PBMCs were obtained from 27 HTLV-1seropositive patients seen at the Neuroinfection Outpatient Clinic, Hospital Universitário Gaffrée e Guinle (HUGG/UNIRIO). These samples were tested by ELISA (Murex HTLV-I + II, Diasorin, United Kingdom). The presence of anti-HTLV-1 antibodies was confirmed by Western blotting. In total, 23 seronegative individuals (screened by ELISA) were included in the study. The genomic DNA (gDNA) was extracted using a QiAmp DNA Mini Kit (Qiagen) according to the manufacturer’s instructions.
0166-0934/$ – see front matter © 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.jviromet.2013.07.040
Please cite this article in press as: Rosadas, C., et al., Validation of a quantitative real-time PCR assay for HTLV-1 proviral load in peripheral blood mononuclear cells. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.07.040
52 53 54 55 56 57 58 59 60
ARTICLE IN PRESS
G Model VIRMET 12243 1–6
C. Rosadas et al. / Journal of Virological Methods xxx (2013) xxx–xxx
2
Table 1 Description of primers and probes used in real time PCR. Primers and probes
Sequence
pX (HTLV-1) pX Forward primer pX Reverse primer pX TaqMan probe
Position
ACAAAGTTAACCATGCTTATTATCAGC ACACGTAGACTGGGTATCCGAA FAM-TTCCCAGGGTTTGGACAGAGTCTTCT-TAMRA
7299–7325 7378–7357 7330–7355
-actin Actin Forward primer Actin Forward primer Actin TaqMan probe
CACATCGTGCCCATCTACGA CTCAGTGAGGATCTTCATGAGGTAGT FAM-ATGCCCTCCCCCATGCCATCCTGCGT-TAMRA
2146–2165 2250–2225 2171–2196
Fig. 1. Sequence alignments of target sequence used in real-time PCR.
Table 2 Reproducibility experiments: intra- and inter-assay reproducibility of TARL-2 cells DNA standard dilutions analyzed in triplicate on four different assays. CT Mean
Intra-assay variability Experiment 1
61
62 63 64
65
66 67 68 69 70 71 72 73 74 75 76 77 78
pX 50,000 50,00 500 50 5 -actin 66,600 13,320 2664 532 106.6
Inter-assay Experiment 2
Experiment 3
Experiment 4
SD
CV (%)
SD
CV (%)
SD
CV (%)
SD
CV (%)
22.7 26.0 29.5 33.0 36.3
0.1 0 0.1 0.2 0.6
0.6 0.2 0.4 0.6 1.7
0.1 0.1 0.1 0.2 0.1
0.3 0.2 0.2 0.6 0.3
0.1 0.1 0 0 0.1
0.3 0.3 0 0 0.2
0 0.1 0.1 0.2 0.8
0.1 0.4 0.5 0.7 2.2
1.5 1.5 1.2 0.7 2.1
23.4 24.3 25.0 25.6 26.8
0 0.1 0.2 0.1 0.1
0.1 0.5 0.9 0.5 0.4
0 0.1 0.2 0.1 0.1
0.2 0.5 0.6 0.4 0.3
0 0.1 0.1 0.1 0.1
0 0.3 0.4 0.2 0.2
0 0.1 0.2 0.1 0.1
0.2 0.6 0.7 0.3 0.3
2.2 2.2 1.9 1.8 2.0
2.2. Cell line description
2.4. TaqMan real-time quantitative PCR
The gDNA of TARL-2 cells was kindly provided by National Institutes of Health (USA). TARL-2 cells are a rat T-cell line that contains a single copy of HTLV-1 provirus (Tateno et al., 1984).
Real-time PCRs were conducted using a 7500 ABI (Applied Biosystems). The DNA of HTLV-1-infected TARL-2 cells was used for the standard curve. Serial 10-fold dilutions were analyzed from 5 × 104 to 5 copies of pX. The DNA of PBMCs from non-infected individuals was used for the ˇ-actin standard curve. The series represented a five-fold dilution of up to 6.6 × 104 copies of ˇactin (Table 2). Both standard curves were repeated during each experiment. Because there is a wide range of proviral loads among patients, to evaluate the intra- and inter-assay variation, each standard curve dilution was analyzed in triplicate in four different assays. Moreover, one sample was tested 15 times on two consecutive days. Five clinical samples with different proviral loads (0.1; 1.8; 18.8; 24.5; 109.2 copies/100PBMCs) were selected and also analyzed in triplicate on two different days. To evaluate the limit of detection, a sample containing only one copy of the target gene was added and analyzed in duplicate in three consecutive days. The real-time PCR mixtures consisted of 12.5 L of 2X TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA), 0.9 M of forward and reverse primers and 0.25 M of probe brought up to 2.5 L with nuclease-free water and 10 L of gDNA (10 ng/L clinical samples or standard template), totaling 25 L
2.3. Primers and probes The primers and probes used were described previously (Nagai et al., 1998). Briefly, for the HTLV-1 pX region, the primer set was 5 -ACAAAGTTAACCATGCTTATTATCAGC-3 and 5 ACACGTAGACTGGGTATCCGAA-3 (positioned at 7299–7325 and 7378–7357, respectively; GenBank: J02029.1). The TaqMan fluorescent probe used was FAM- TTCCCAGGGTTTGGACAGAGTCTTCT – TAMRA (positioned at 7330–7355; GenBank: J02029.1). The ˇ-actin gene was used as an internal control and to determine the input cell number to avoid variation due to differences in DNA input into the reaction. The primer set was 5 -CACATCGTGCCCATCTACGA-3 and 5 -CTCAGTGAGGATCTTCATGAGGTAGT-3 . The ˇ-actin probe was FAM- ATGCCCTCCCCCATGCCATCCTGCGT – TAMRA (Table 1). The BioEdit program was used for sequence alignments (Fig. 1).
Please cite this article in press as: Rosadas, C., et al., Validation of a quantitative real-time PCR assay for HTLV-1 proviral load in peripheral blood mononuclear cells. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.07.040
79
80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100
G Model VIRMET 12243 1–6
ARTICLE IN PRESS C. Rosadas et al. / Journal of Virological Methods xxx (2013) xxx–xxx
3
Fig. 2. Reproducibility Experiments: Amplification plot of target (pX) and control (actin) gene of the same sample analyzed 15 times: (A) Experiment 1; (B) Experiment 2.
101 102 103 104 105
106
107 108 109 110 111 112 113 114 115 116 117 118 119
per reaction. The amplification conditions were 2 min at 50 ◦ C (activation of UNG); 10 min at 95 ◦ C (inactivation of UNG and activation of Taq polymerase); 45 cycles of 15 s at 95 ◦ C (denaturation) and 1 min at 60 ◦ C (annealing and extension); and 25 ◦ C for 2 min.
2.6. Statistical analysis To evaluate the intra- and the inter-assay reproducibility, the coefficient of variation (CV) of the CT values was calculated. According to previous data, a CV of a CT of 3% or 10% for intra- and inter-assay reproducibility, respectively, is acceptable (Dehée et al., 2002; Estes and Sevall, 2003; Moens et al., 2009). For proviral load comparison between the two study groups (HAM/TSP and nonHAM/TSP), a Mann–Whitney test was used.
120
121 122 123 124 125 126 127
2.5. Determination of HTLV-1 proviral load Based on the threshold cycle (CT ) of the standard dilutions of TARL-2 cell and PBMC DNA, standard curves were produced. The copy number of the unknown samples was determined by plotting each CT on the standard curves. To determine the HTLV-1 proviral load, the following formula was used: copy number of HTLV-1 pX gene per 1 × 102 PBMCs = [(copy number of pX)/(copy number of actin)/2)] × 102 (Nagai et al., 1998). The copy number of the pX and actin genes was the mean value of the triplicate analysis of each sample. The HTLV-1-infected individuals were classified into two study groups: HAM/TSP (patients with a definite diagnosis according to Osame’s criteria) and non-HAM/TSP (HTLV-1-infected individuals without a HAM/TSP diagnosis).
2.7. Ethical considerations The present study was developed in accordance with the Helsinki Declaration of 1975, as revised in 1983. The study was approved by the Ethical Committee of the HUCFF/UFRJ and HUGG/UNIRIO.
128
129 130 131 132
3. Results
133
3.1. Intra- and inter-assay reproducibility
134
To test the intra- and inter-assay reproducibility, the standard curve was evaluated on triplicate. The assay gave a CV for the
Please cite this article in press as: Rosadas, C., et al., Validation of a quantitative real-time PCR assay for HTLV-1 proviral load in peripheral blood mononuclear cells. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.07.040
135 136
G Model VIRMET 12243 1–6
ARTICLE IN PRESS C. Rosadas et al. / Journal of Virological Methods xxx (2013) xxx–xxx
4
Fig. 3. Amplification plot of standard curve, obtained with serial dilution performed in the ratio of 10 to a range of 5 × 104 to 5 copies of pX gene (TARL-2 cells). Each dilution was tested in triplicate.
137 138 139 140 141 142 143 144 145
146 147
CT values of less than 2.2% for intra- and inter-assay variability (Table 2). One sample was also tested 15 times on two consecutive days. For this sample, the intra-assay reproducibility was 0.3% and 0.4% on each experiment, and the inter-assay reproducibility was 2.0% (Fig. 2). The mean CT values and the CV for each dilution of the standard curves are listed in Table 2. Confirming the intra-assay reproducibility of all clinical samples in triplicate presented a CV of less than 2.4%. Moreover, the five clinical samples analyzed on two different days showed a CV of less than 0.6%. 3.2. Standard curve, dynamic range of the assay and limit of detection
156
The qPCR efficiency, slope and correlation coefficients (r2 ) were all acceptable (at least 98.6%, −3.316 and 0.993, respectively) (Fig. 3). To determine the limit of detection, one sample containing one copy of the pX gene (from TARL-2 cells) was tested. The assay was able to detect the infection (Fig. 4). Therefore, the limit of detection was 1 copy/rxn. The mean CT value and the CV for the replicates of the sample containing only one copy of the pX gene were 38.2 (SD ± 0.4) and 0.6% (intra-assay) and 1.1% (inter-assay). The CT values of the replicates varied from 37.8 to 38.8.
157
3.3. Specificity and sensitivity
148 149 150 151 152 153 154 155
161
All seropositive samples (n = 27) presented gene amplification. The negative samples were not amplified for the HTLV-1 pX gene (n = 23) but presented amplification of the reference gene (actin). Therefore, the assay presented 100% specificity and sensitivity.
162
3.4. HTLV-1 proviral load
158 159 160
163 164 165
The mean proviral load of the seropositive samples was 26.5 (SD: 35.8; SE: 6.9; 95% CI: 12.3–40.6). The proviral load varied in a range of 0.05–146.8 copies/100 PBMCs. The mean proviral load of
the HAM/TSP patients (mean ± SD = 36.3 ± 40.2; SE: 9.5) was higher than in the non-HAM/TSP group (mean ± SD = 6.9 ± 8.8; SE: 2.9; p < 0.005).
4. Discussion For the validation of clinical molecular tests, sensitivity, specificity, accuracy, precision, reproducibility and linearity have to be established (Mattocks et al., 2010). In this study, the assay had 100% sensitivity and specificity once all of the seropositive samples showed gene amplification and all of the seronegative samples did not amplify the target gene. These results also reflect the high test accuracy. Regarding precision, the intra- and inter-assay reproducibility was acceptable both for the standard curve and for the sample repeated 15 times. It is important to emphasize that even the triplicates of the sample containing a single copy of the target gene showed good reproducibility. This finding contrasts with the data described by Miley et al. (2000), who reported greater variability at lower copy numbers. When considering the dynamic range of the assay, the test showed a strong linear relationship between the CT values and the log10 of the number of copies of HTLV-1 (TARL-2 cells). The assay also presented acceptable efficiency and can detect low levels of proviral load (1 copy/rxn). It is important to highlight that in the present assay, the gDNA of PBMCs was used for proviral load quantification. Although this protocol requires a step of sample preparation, the use of PBMC gDNA enhances the sensibility of the test. This feature also influences the test’s limit of detection. In this context, when evaluating the HTLV-1 proviral load in whole blood, a previous study detected three of nine replicates with one copy of HTLV-1, resulting in a limit of detection between 1 and 10 copies/rxn (Naderi et al., 2012). In the present technique and in a study by Lee et al. (2004), the assay was able to detect a single viral
Please cite this article in press as: Rosadas, C., et al., Validation of a quantitative real-time PCR assay for HTLV-1 proviral load in peripheral blood mononuclear cells. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.07.040
166 167 168
169
170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197
G Model VIRMET 12243 1–6
ARTICLE IN PRESS C. Rosadas et al. / Journal of Virological Methods xxx (2013) xxx–xxx
5
Fig. 4. Amplification plot of the sample containing one copy of pX gene from HTLV-1.
239
copy. However, in the assay developed by Lee et al. (2004), SYBR Green was used rather than the TaqMan system. It is known that the PCR is a very sensitive technique once it can amplify the target gene and is also a high specific technique. This high specificity is related to primer annealing. In this context, the TaqMan system increases the assay specificity when this method is based on a fluorometric probe. This probe hybridizes to a complementary target sequence but not to nonspecific PCR products or primer dimers, which may happen when intercalating dyes, such as SYBR Green, are used (Heid et al., 1996; Holland et al., 1991). Thus, the primer and probe design is particularly important. The probe and the primer set used in this study were very specific. However, these reagents presented high similarity for different HTLV-1 strains from distinct regions of the world. It is important to emphasize that in virology, molecular tests can be used for diagnostic purposes and also as a prognostic tool. In this context, previous studies demonstrated that HTLV-1 proviral load is correlated with clinical disease. In HTLV-1 infection, proviral load detection is indicated once the virus is not usually found as a cell-free virus, in contrast to HIV infection. Thus, the objective is the identification and quantification of viral DNA integrated into the genome of the target cell. Previous studies showed that patients with clinical manifestations of HTLV-1 infection (HAM/TSP and ATLL) presented a higher proviral load than asymptomatic individuals. In this study, the seropositive samples were from patients with HAM/TSP and from asymptomatic carriers, and similar differences were observed. The HAM/TSP group presented a higher proviral load than the non-HAM/TSP individuals. Two individuals with HAM/TSP presented a proviral load greater than 100%, indicating that there is more than one provirus per PBMC (Demontis et al., 2013). It is important to highlight that the quantity of ˇ-actin detected in those two samples was similar to the amount in other samples (CT values: 24.1 and 22.8). This finding was observed in other previous studies. In the present study, a wide variation in proviral load was detected. This variation was also described by Kamihira et al. (2010). It is suggested that the biological characteristics of the virus (such as defects or mutations in target regions) or multiple integration of the proviral genome could explain the variation. Also, it cannot be excluded that the observed differences may be due to both individual factors, such as the host immune response, and viral genetics.
240
5. Conclusion
198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238
241
This assay can reliably quantify HTLV-1 proviral load.
Financial support This work had the financial support from Fundac¸ão de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ), a PhD fellowship to C.R. from Coordenac¸ão de Aperfeic¸oamento de Pessoal de Nível Superior (CAPES) and a PhD fellowship to M.J.C.C. from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Brazil.
242
243 244 245 246 247 248
Competing interests
249
None declared.
250
Acknowledgments The authors thank Dr. Steven Jacobson (NIH) for providing the TARL-2 cell DNA and Rosangela Aparecida Martins Noé (Divisão de Pesquisa do HUCFF/UFRJ) for statistical support. References Andrade, R.G., Ribeiro, M.A., Namen-Lopes, M.S., Silva, S.M., Basques, F.V., Ribas, J.G., Carneiro-Proietti, A.B., Martins, M.L., 2010. Evaluation of the use of real-time PCR for human T cell lymphotropic virus 1 and 2 as a confirmatory test in screening for blood donors. Rev. Soc. Bras. Med. Trop. 43, 111–115. Besson, G., Kazanji, M., 2009. One-step, multiplex, real-time PCR assay with molecular beacon probes for simultaneous detection, differentiation, and quantification of human T-cell leukemia virus types 1, 2, and 3. J. Clin. Microbiol. 47, 1129–1135. Dehée, A., Césaire, R., Désiré, N., Lézin, A., Bourdonné, O., Béra, O., Plumelle, Y., Smadja, D., Nicolas, J.C., 2002. Quantitation of HTLV-I proviral load by a TaqMan real-time PCR assay. J. Virol. Methods 102, 37–51. Demontis, M.A., Hilburn, S., Taylor, G.P., 2013. Human T cell lymphotropic virus Type 1 viral load variability and long-term trends in asymptomatic carriers and in patients with human T cell lymphotropic virus Type 1-related diseases. AIDS Res. Hum. Retroviruses 29, 359–364. Estes, M.C., Sevall, J.S., 2003. Multiplex PCR using real time DNA amplification for the rapid detection and quantitation of HTLV I or II. Mol. Cell Probes 17, 59–68. Gessain, A., Barin, F., Vernant, J.C., Gout, O., Maurs, L., Calender, A., de Thé, G., 1985. Antibodies to human T-lymphotropic virus type-I in patients with tropical spastic paraparesis. Lancet 2, 407–410. Heid, C.A., Stevens, J., Livak, K.J., Williams, P.M., 1996. Real time quantitative PCR. Genome Res. 6, 986–994. Holland, P.M., Abramson, R.D., Watson, R., Gelfand, D.H., 1991. Detection of specific polymerase chain reaction product by utilizing the 5 –3 exonuclease activity of Thermus aquaticus DNA polymerase. Proc. Natl. Acad. Sci. U. S. A. 88, 7276–7280. Kamihira, S., Yamano, Y., Iwanaga, M., Sasaki, D., Satake, M., Okayama, A., Umeki, K., Kubota, R., Izumo, S., Yamaguchi, K., Watanabe, T., 2010. Intra- and interlaboratory variability in human T-cell leukemia virus type-1 proviral load quantification using real-time polymerase chain reaction assays: a multi-center study. Cancer Sci. 101, 2361–2367.
Please cite this article in press as: Rosadas, C., et al., Validation of a quantitative real-time PCR assay for HTLV-1 proviral load in peripheral blood mononuclear cells. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.07.040
251
252 253 254
255
256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286
G Model VIRMET 12243 1–6 6
287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308
ARTICLE IN PRESS C. Rosadas et al. / Journal of Virological Methods xxx (2013) xxx–xxx
Lee, T.H., Chafets, D.M., Busch, M.P., Murphy, E.L., 2004. Quantitation of HTLV-I and II proviral load using real-time quantitative PCR with SYBR Green chemistry. J. Clin. Virol. 31, 275–282. Mattocks, C.J., Morris, M.A., Matthijs, G., Swinnen, E., Corveleyn, A., Dequeker, E., Müller, C.R., Pratt, V., Wallace, A., EuroGentest Validation Group, 2010. A standardized framework for the validation and verification of clinical molecular genetic tests. Eur. J. Hum. Genet. 18, 1276–1288. Miley, W.J., Suryanarayana, K., Manns, A., Kubota, R., Jacobson, S., Lifson, J.D., Waters, D., 2000. Real-time polymerase chain reaction assay for cellassociated HTLV type I DNA viral load. AIDS Res. Hum. Retroviruses 16, 665–675. Moens, B., López, G., Adaui, V., González, E., Kerremans, L., Clark, D., Verdonck, K., Gotuzzo, E., Vanham, G., Cassar, O., Gessain, A., Vandamme, A.M., Van Dooren, S., 2009. Development and validation of a multiplex realtime PCR assay for simultaneous genotyping and human T-lymphotropic virus type 1, 2, and 3 proviral load determination. J. Clin. Microbiol. 47, 3682–3691. Naderi, M., Paryan, M., Azadmanesh, K., Rafatpanah, H., Rezvan, H., Mirab Samiee, S., 2012. Design and development of a quantitative real time PCR assay for monitoring of HTLV-1 provirus in whole blood. J. Clin. Virol. 53, 302–307.
Nagai, M., Usuku, K., Matsumoto, W., Kodama, D., Takenouchi, N., Moritoyo, T., Hashiguchi, S., Ichinose, M., Bangham, C.R., Izumo, S., Osame, M., 1998. Analysis of HTLV-I proviral load in 202 HAM/TSP patients and 243 asymptomatic HTLV-I carriers: high proviral load strongly predisposes to HAM/TSP. J. Neurovirol. 4, 586–593. Olindo, S., Lézin, A., Cabre, P., Merle, H., Saint-Vil, M., Edimonana Kaptue, M., Signate, A., Césaire, R., Smadja, D., 2005. HTLV-1 proviral load in peripheral blood mononuclear cells quantified in 100 HAM/TSP patients: a marker of disease progression. J. Neurol. Sci. 237, 53–59. Osame, M., Usuku, K., Izumo, S., Ijichi, N., Amitani, H., Igata, A., Matsumoto, M., Tara, M., 1986. HTLV-I associated myelopathy, a new clinical entity. Lancet 1, 1031–1032. Poiesz, B.J., Ruscetti, F.W., Gazdar, A.F., Bunn, P.A., Minna, J.D., Gallo, R.C., 1980. Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc. Natl. Acad. Sci. U. S. A. 77, 7415–7419. Tamegão-Lopes, B.P., Rezende, P.R., Maradei-Pereira, L.M., de Lemos, J.Á., 2006. HTLV-1 and HTLV-2 proviral load: a simple method using quantitative real-time PCR. Rev. Soc. Bras. Med. Trop. 39, 548–552. Tateno, M., Kondo, N., Itoh, T., Chubachi, T., Togashi, T., Yoshiki, T., 1984. Rat lymphoid cell lines with human T cell leukemia virus production: biological and serological characterization. J. Exp. Med. 159, 1105–1116.
Please cite this article in press as: Rosadas, C., et al., Validation of a quantitative real-time PCR assay for HTLV-1 proviral load in peripheral blood mononuclear cells. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.07.040
309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330