- Email: [email protected]
Validation of reference genes in the feline endometrium
REPBIO-120; No. of Pages 5 reproductive biology xxx (2014) xxx–xxx
Available online at www.sciencedirect.com
ScienceDirect journal homepage: http://www.elsevier.com/locate/repbio
Technical Note
Validation of reference genes in the feline endometrium Ewelina Jursza, Dariusz J. Skarzynski, Marta J. Siemieniuch * Department of Reproductive Immunology and Pathology, Institute of Animal Reproduction and Food Research of the Polish Academy of Sciences, Tuwima 10, 10-748 Olsztyn, Poland
article info
abstract
Article history:
The aim of the study was to find the most stable reference genes from: ACTB, GAPDH, RPL30,
Received 4 June 2013
CYC, RPL17, RPS7 and YWHAZ in the feline endometrium. Three free software packages,
Received in revised form
geNorm, NormFinder and BestKeeper were used. In geNorm analysis, the most stable gene
11 March 2014
was RPS7 (at a primer concentration 1000 nM) or YWHAZ (500 and 250 nM). According to
Accepted 11 April 2014
NormFinder and BestKeeper, ACTB (at all examined primer concentrations) followed by RPS7 and CYC were the most stable genes. Based on geNorm results at least two genes from among
Keywords: Reference gene Endometrium
RPS7, RPL30, ACTB or YWHAZ should be chosen for Real Time-PCR result normalization. # 2014 Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
Domestic cat
1.
Introduction
The domestic cat is a valuable model for studying molecular mechanisms that link hormonal contraception in carnivorous animals to the development of endometritis–pyometra complex. At present, studies are often based on molecular techniques including gene expression methods e.g., real-time PCR (RT-PCR). The sensitivity of the method depends on applying a suitable reference gene. The expression of a reference gene should be constant in all cells, in different developmental stages and under all experimental conditions [1]. However, many genes being used as reference genes do not meet these requirements. In view of the limited information on the selection of reference genes in felines, the aim of the
present study was to find the most stable reference gene from among b-actin (ACTB), glyceraldehydes 3-phosphate dehydrogenase (GAPDH), 60S ribosomal protein L30 (RPL30), cyclophilin (CYC), 60S ribosomal protein L17 (RPL17), 40S ribosomal protein S7 (RPS7) and tyrosine 3-monooxygenase (YWHAZ) in the endometrium of: (1) luteal phase queens, (2) hormonally treated queens, and (3) queens with symptoms of pyometra. To establish stability expression of the genes, three free software packages, geNorm, NormFinder and BestKeeper were used in the study.
2.
Materials and methods
All procedures were approved by the Local Animal Care and Use Committee in Olsztyn, Poland (No. 60/2010/DTN). A total
* Corresponding author. Tel.: +48 89 539 31 28; fax: +48 89 539 31 30. E-mail addresses: [email protected] (E. Jursza), [email protected] (D.J. Skarzynski), [email protected] (M.J. Siemieniuch). http://dx.doi.org/10.1016/j.repbio.2014.04.003 1642-431X/# 2014 Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
Please cite this article in press as: Jursza E, et al. Validation of reference genes in the feline endometrium. Reprod Biol (2014), http://dx.doi. org/10.1016/j.repbio.2014.04.003
REPBIO-120; No. of Pages 5
2
reproductive biology xxx (2014) xxx–xxx
Table 1 – Characteristic of primers used for real-time PCR. Gene
Gene name
GAPDH Glyceraldehyde 3-phosphate dehydrogenase RPL17 60S ribosomal protein L17 RPL30 60S ribosomal protein L30 RPS7 40S ribosomal protein S7 YWHAZ Tyrosine 3-monooxygenase/ tryptophan 5-monooxy-genase activation protein CYC Cyclophilin
ACTB
b-Actin
Function
Forward primer (50 ! 30 )
Accession number
Reverse primer (50 ! 30 )
Ref.
Glycolytic enzyme
NM 001009307 AGTATGATTCCACCCACGGCA
GATCTCGCTCCTGGAAGATGGT [14]
Ribosomal protein
AY738264
CTCTGGTCATTGAGCACATCC
TCAATGTGGCAGGGAGAGC
Ribosomal protein
AY700577
CCTCGGCAGATAAATTGGACTGTC
TGATGGCCCTCTGGAATTTGAC [14]
Ribosomal protein
AY800278
GTCCCAGAAGCCGCACTTTGAC
CTCTTGCCCACAATCTCGCTCG
[14]
GAAGAGTCCTACAAAGACAGCACGC AATTTTCCCCTCCTTCTCCTGC
[14]
AY029366
CCTTCTGTAGCTCGGGTCAG
CTTGGAGGGGAGGTAAGGAG
[2]
AB051104
ATCAAGGAGAAGCTGTGCTACGT
CGTTGCCGATGGTGATCA
[3]
Binds to EF458621 phosphatydylserine containing proteins
Isomerase involved in protein folding Cytoskeletal protein
[14]
All primers were purchased from Genomed (Warszawa, Poland).
of 11 domestic shorthair female cats (6–36 months old) were enrolled in the study. The cumulative information provided by inspection of the ovaries at ovariohysterectomy (OHE) [2] performed in the local veterinary clinics, blood progesterone concentration and information from the owner, were used to stage the estrous cycle of each animal. No pharmacological treatment was performed to provoke ovulation in the animals. Cats were assigned to: (1) luteal phase (LP) group (n = 3); (2) hormonally treated with octane medroxyprogesterone (OMP, Depo-Promone, Pfizer Animal Health, Louvainla-Neuve, France) group (n = 5), in which animals had been treated with OMP (5 mg/animal/week) for one month to prevent an estrus behavior; and (3) pyometric (PYO) group (n = 3). The uteri were washed immediately after surgery with saline, placed into fresh sterile saline (4 8C) and transported to the laboratory within 1 h. Uterine horns were cut longitudinally, pieces of endometrium (weighted 20–30 mg) were prepared, washed in fresh saline, kept overnight (4 8C) with RNAlater (Ambion Biotechnologie GmbH, Wiesbaden, Germany), and stored at 80 8C. Total RNA was isolated using TRIZOL-Reagent (Sigma–Aldrich, St. Louis, MO, USA). The RNA content was measured with a Nano-DropTM 1000 Spectrophotometer (Thermo, Wilmington, DE, USA). The RNA quality was confirmed by electrophoresis on 1.5% agarose gel. Prior to reverse transcription, genomic DNA contamination was removed by treatment with DNase (Sigma–Aldrich). Reverse transcription was performed using the ImProm-IITM Reverse Transcription System (Promega, Madison, WI, USA) [3]. In brief, each RT reaction mixture (volume 20.5 mL) contained: 1 mg of RNA in 12 mL of reaction mix, 4 mL of reaction buffer, 2.5 mL of MgCl2 (final concentration 3 mM), 1 mL of dNTP Mix (0.5 mM final concentration of each dNTP) and 1 mL of ImProm-IITM Reverse Transcriptase. Real-time PCR was carried out in an automated fluorometer Viia 7 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) using FAST-SYBR Green Master Mix (Applied
Biosystems). RT-PCR was performed in 96-well plates. The sequences of specific primers and the GenBank accession numbers are depicted in Table 1. Each reaction mixture (20 mL) contained 4 mL of cDNA (39 ng); 1000 nM, 500 nM or 250 nM forward (2 mL) and reverse (2 mL) primers; 10 mL FAST-SYBR Green Master Mix; and 2 mL nuclease free water. Amplification was carried out as follows: denaturation for 20 s at 95 8C, followed by 40 cycles at 95 8C for 1 s and 60 8C for 20 s. After RTPCR, melting curves were acquired in temperature from 60 8C to 95 8C to ensure that a single product was amplified in the reaction. To determine the most stable reference gene, three free software packages that use different algorithms were used: geNorm [4], NormFinder [5] and BestKeeper [6]. GeNorm software package determines stability of gene expression by calculating the stability value (M). The low M value (<1.5) determines the most stable gene [4]. In addition, geNorm software determines the optimal number of reference genes needed for gene expression normalization. A pairwise variation (V) was calculated for two sequential normalization factors NFn and NFn+1 (n = number of reference genes). When variation is lower than 0.15, using an additional reference gene is not required. NormFinder software package calculates gene expression stability based on the intra- and the inter-group variation. Genes characterized by the lowest gene expression stability value (r) are most stable [5]. BestKeeper software package estimates relations of possible reference gene pairs by performing numerous pairwise correlation analyses. Reference gene is assessed based on the average threshold cycle value (Ct) obtained from RT-PCR analysis, standard deviation (SD), coefficient of variance (CV) and coefficient of correlation (r). A good stability gene is characterized by low (<1) standard deviation value [6]. Differences in mRNA levels among the examined groups (LP, OMP, PYO) were analyzed by the Kruskal–Wallis test followed by the Newman–Keuls multiple comparison test using the statistical software program GraphPad6 (GraphPad
Please cite this article in press as: Jursza E, et al. Validation of reference genes in the feline endometrium. Reprod Biol (2014), http://dx.doi. org/10.1016/j.repbio.2014.04.003
REPBIO-120; No. of Pages 5
3
reproductive biology xxx (2014) xxx–xxx
Fig. 1 – Stability values (M) of the selected reference genes in the feline endometrium according to geNorm. Concentration of primers, from left to right 1000, 500 and 250 nM. The average expression stability value (M) is the pairwise variation of single reference gene with all other candidate reference genes. The more stable the gene, the lower its M value.
3.
Results and discussion
The expression stability of the seven candidate reference genes was examined in the current study. No difference in the genes expression stability was found among the three experimental groups (LP, OMP, PYO). Therefore, the stability results were pooled. The expression stability of the reference genes differed significantly depending on the primer concentration and the software used. Usually, a primer concentration in a RT-PCR ranges from 100 to 500 nM. An increased primer concentration may improve the RT-PCR outcome. However, too high increase in primer concentration may inhibit the reaction since primers compete with the product for the target sequence [7]. When geNorm was used, the most stable gene at a primer concentration 1000 nM was RPS7 followed by RPL30 and RPL17 (Fig. 1). At a primer concentration 500 nM, YWHAZ followed by RPL17 were ranked to be the most stable. Whereas, at a primer concentration 250 nM YWHAZ followed by ACTB were ranked to be the best. GAPDH was the least stable reference gene at a primer concentration 1000 nM and 250 nM. CYC was the least stable gene at 500 nM and was the second worse at 1000 and 250 nM. Based on the geNorm analysis, CYC should not be consider as a reference gene. Penning and coworkers [8] used geNorm to examine 10 reference genes in cat heart, kidneys, liver, lungs, prostate gland and teeth. They found RPL17, RPS7 and RPL30 to be the most stable genes at primer concentration of 400 nM. In another study, that did not include the uterus or ovaries, and was based on geNorm and NormFinder analyses, the most stable genes differed significantly between the tissues or software used [9]. In 11 out of the 14 feline tissues, RPS7 ranked among the three most stable genes, followed by ACTB in 8 of the 14 tissues, whilst GAPDH had an acceptable stability only in a few tissues [9]. The optimal number of reference genes was calculated using geNorm (Fig. 2). Based on obtained results, we suggest to use RPS7 and RPL30 at a primer concentration 1000 nM or YWHAZ and RPL17 at a primer concentration 500 nM. If primer
concentration 250 nM was used, an additional, third reference gene was required for accurate normalization of RT-PCR. In this case, we suggest to use YWHAZ, ACTB and RPL30. RT-PCR data analysis normalization by multiple reference genes instead of one is strongly recommended by Vandesompele et al. [4]. Based on geNorm analysis, Kessler and coworkers calculated, that two to three reference genes were required for accurate RT-PCR normalization in the most feline tissues [9]. They recommended using RPS7 as the most suitable reference gene and ACTB, glucuronidase (GUSB) and/or YWHAZ for confirmation of the results [9]. When NormFinder was used, ACTB was found to be the most stable gene at all primer concentrations, the second best was RPS7 (primer concentrations: 500 and 250 nM) followed by CYC (1000 nM) (Fig. 3). These results confirmed that applying of ACTB as a reference gene in our previous studies performed in
0.2
Pairwise variation (V)
PRISM v 6.0; GraphPad Software Inc., San Diego, CA, USA). Significance was defined as p < 0.05.
1000 nM 500 nM 250 nM
0.15
0.1
0.05
0 V2/3
V3/4
V4/5
V5/6
V6/7
Fig. 2 – Determination of the optimal number of the reference genes for gene expression normalization with geNorm. A pairwise variation (V) was calculated for two sequential normalization factors NFn and NFn+1 (n = number of reference genes) for all samples. When variation is lower than 0.15, an additional reference gene is not required. Because the pairwise variation V2/3 was less than 0.15 at primer concentration of 1000 nM or 500 nM, a third reference gene was not needed for accurate normalization at these concentrations. At a concentration of 250 nM, the use of at least three reference genes is recommended.
Please cite this article in press as: Jursza E, et al. Validation of reference genes in the feline endometrium. Reprod Biol (2014), http://dx.doi. org/10.1016/j.repbio.2014.04.003
REPBIO-120; No. of Pages 5
4
reproductive biology xxx (2014) xxx–xxx
Fig. 3 – Stability values (r) of selected reference genes in feline endometrium by NormFinder. Concentration of primers, from left to right 1000, 500 and 250 nM.
the feline endometrium under physiological conditions was accurate [3,10,11]. The third most stable gene was GAPDH at a primer concentration 1000 nM and 500 nM, but it was ranked fourth when primer concentration of 250 nM was used. Using NormFinder software, regardless of the concentration of primers, ACTB was the most stable of the proposed reference genes and RPL30 was most unstable. GAPDH is one of the most commonly used reference genes. In the mouse uterus during the peri-implantation period, GAPDH was sufficiently stable to be used as reference gene according to NormFinder, geNorm and BestKeeper [12], as well as GAPDH was found to be the most stable gene in the equine endometrium during early pregnancy [13]. In contrast, reports on bovine endometrium during early pregnancy found GAPDH to be the least stable gene based on NormFinder and geNorm analyses [14]. GAPDH was among the three most
Table 2 – Results of the BestKeeper analysis. ACTB GAPDH RPL 30
CYC
RPL 17 RPS 7 YWHAZ
(a) Primer concentration of 1000 nM Ct 30.82 32.29 19.93 20.10 0.67 0.65 1.26 0.82 SD 2.19 2.01 6.30 4.07 CV 0.43 0.06 0.32 0.55 r
18.04 1.22 6.76 0.56
19.87 0.78 3.90 0.23
29.69 1.32 4.45 0.11
(b) Primer concentration of 500 nM 31.02 31.86 20.07 20.39 Ct 0.64 1.29 1.29 0.88 SD CV 2.06 4.04 6.44 4.33 0.74 0.60 0.32 0.34 r
18.66 1.00 5.38 0.79
19.71 0.63 3.17 0.79
29.98 1.40 4.66 0.15
(c) Primer concentration Ct 31.83 31.71 0.67 0.67 SD 2.12 2.10 CV 0.41 0.32 r
19.13 1.22 6.36 0.67
20.41 0.90 4.42 0.56
29.78 1.52 5.09 0.48
of 250 nM 20.25 21.01 1.34 0.89 6.61 4.25 0.49 0.26
Descriptive statistics of 7 candidate reference genes according to the BestKeeper software. Number of samples using for optimization n = 11. Low standard deviation (SD; <1) and high coefficient of correlation (r) indicate the most stable gene (bold letters). Ct, geometric mean of raw threshold cycle value; SD, standard deviation of the Ct; CV, coefficient of variance expressed as percentage of Ct level; r, coefficient of correlation.
stable genes only in 4 out of 14 feline tissues in the NormFinder ranking [9]. When BestKeeper was used, GAPDH, ACTB, CYC and RPS7 were among the most stable genes at all examined primer concentrations, with the exception of GAPDH at a primer concentration of 500 nM (Table 2). At the primer concentrations of 1000, 500 and 250 nM, RPL30, RPL17 and YWHAZ were ranked as not stable. The Pearson correlation coefficient (r), determined by BestKeeper, should not be used to compare genes with Cts of around 30–35 to genes with Cts around 15–20 [6]. Therefore in the present study we compared only five candidate reference genes, excluding ACTB and GAPDH. Thus, CYC (1000 nM) and RPS7 (500 or 250 nM) were demonstrated to be the most stable reference genes. In summary, geNorm, NormFinder and BestKeeper software packages did not rank the expression stability of the examined genes in the same order. In geNorm analysis, the most stable gene was RPS7 (1000 nM) or YWHAZ (500 and 250 nM). Furthermore, two reference genes: RPS7 and RPL30 (1000 nM) or YWHAZ and RPL17 (500 nM), or three reference genes: YWHAZ, ACTB and RPL30 (250 nM) should be used for accurate RT-PCR results normalization. According to NormFinder, ACTB (at all examined primer concentrations) followed by RPS7 (500 and 250 nM) were the most stable reference genes. BestKeeper ranked ACTB (at all primers concentrations) as suitable reference gene, followed by RPS7 and CYC. We suggest to chose at least two genes from among RPS7, RPL30, ACTB or YWHAZ for RT-PCR results normalization in the feline endometrium.
Author's contribution EJ participated in the study design, laboratory analysis, interpretation of the results and preparation of the manuscript. DJS helped in editing the manuscript. MJS designed the experiments and drafted the manuscript. All authors read and approved the final version of the manuscript.
Conflict of interest The authors declare no conflict of interest.
Please cite this article in press as: Jursza E, et al. Validation of reference genes in the feline endometrium. Reprod Biol (2014), http://dx.doi. org/10.1016/j.repbio.2014.04.003
REPBIO-120; No. of Pages 5 reproductive biology xxx (2014) xxx–xxx
Acknowledgements [6]
This study was supported by grants-in-aid for Scientific Research from the Polish Ministry of Scientific Research and High Education (N308 560740). EJ was supported by the European Union through the European Social Fund. Authors are indebted to the staff of the Department of Animal Reproduction with Clinic, the Faculty of Veterinary Medicine, University of Warmia & Mazury Olsztyn and DOGMED Veterinary Clinic from Olsztyn for allowing the tissue collection.
[7]
references
[9]
[1] Peinnequin A, Mouret C, Birot O, Alonso A, Mathieu J, Clarençon D, et al. Rat pro-inflammatory cytokine and cytokine related mRNA quantification by real-time polymerase chain reaction using SYBR green. BMC Immunol 2004;5:3. [2] Siemieniuch MJ, Jursza E, Szostek AZ, Skarzynski DJ, Boos A, Kowalewski MP. Steroidogenic capacity of the placenta as a supplemental source of progesterone during pregnancy in domestic cats. Reprod Biol Endocrinol 2012;10:89. [3] Siemieniuch MJ, Jursza E, Kowalewski MP, Majewska M, Skarzynski DJ. Prostaglandin endoperoxide synthase 2 (PTGS2) and prostaglandins F2a and E2 synthases (PGFS and PGES) expression and prostaglandin F2a and E2 secretion following oestrogen and/or progesterone stimulation of the feline endometrium. Reprod Domest Anim 2013;48(1):72–8. [4] Vandesompele J, Preter KD, Pattyn F, Poppe B, Roy NV, Paepe AD, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002;3(7):1–11. [5] Andersen CL, Jensen JL, Ørntoft TF. Normalization of real-time quantitative reverse transcription-PCR data:
[8]
[10]
[11]
[12]
[13]
[14]
a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 2004;64(15):5245–50. Pfaffl MW, Tichopád A, Prgomet C, Neuvians TP. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper – excel-based tool using pair-wise correlations. Biotechnol Lett 2004;26(6):509–15. Czerny T. High primer concentration improves PCR amplification from random pools. Nucleic Acids Res 1996;24 (5):985–6. Penning LC, Vrieling HE, Brinkhof B, Riemers FM, Rothuizen J, Rutteman GR, et al. A validation of 10 feline reference genes for gene expression measurements in snap-frozen tissues. Vet Immunol Immunopathol 2007;120 (3/4):212–22. Kessler Y, Helfer-Hungerbuehler AK, Cattori V, Meli ML, Zellweger B, Ossent P, et al. Quantitative TaqMan real-time PCR assays for gene expression normalisation in feline tissues. BMC Mol Biol 2009;10:106. Siemieniuch MJ, Bowolaksono A, Skarzynski DJ, Okuda K. Ovarian steroids regulate prostaglandin secretion in the feline endometrium. Anim Reprod Sci 2010;120(1–4):142–50. Siemieniuch MJ, Mlynarczuk JJ, Skarzynski DJ, Okuda K. Possible involvement of oxytocin and its receptor in the local regulation of prostaglandin secretion in the cat endometrium. Anim Reprod Sci 2011;123(1/2):89–97. Sun Z, Su R, Yang Z, Shi H, Liu C, Wang J. Expression of the novel gene embryo implantation factor 2 (EMO2) in the mouse uterus at the implantation sites. Fertil Steril 2009;91 (5 Suppl.):2116–22. Kayis SA, Atli MO, Kurar E, Bozkaya F, Semacan A, Aslan S, et al. Rating of putative housekeeping genes for quantitative gene expression analysis in cyclic and early pregnant equine endometrium. Anim Reprod Sci 2011;125 (1–4):124–32. Walker CG, Meier S, Mitchell MD, Roche JR, Littlejohn M. Evaluation of real-time PCR endogenous control genes for analysis of gene expression in bovine endometrium. BMC Mol Biol 2009;10:100.
Please cite this article in press as: Jursza E, et al. Validation of reference genes in the feline endometrium. Reprod Biol (2014), http://dx.doi. org/10.1016/j.repbio.2014.04.003
5
Available online at www.sciencedirect.com
ScienceDirect journal homepage: http://www.elsevier.com/locate/repbio
Technical Note
Validation of reference genes in the feline endometrium Ewelina Jursza, Dariusz J. Skarzynski, Marta J. Siemieniuch * Department of Reproductive Immunology and Pathology, Institute of Animal Reproduction and Food Research of the Polish Academy of Sciences, Tuwima 10, 10-748 Olsztyn, Poland
article info
abstract
Article history:
The aim of the study was to find the most stable reference genes from: ACTB, GAPDH, RPL30,
Received 4 June 2013
CYC, RPL17, RPS7 and YWHAZ in the feline endometrium. Three free software packages,
Received in revised form
geNorm, NormFinder and BestKeeper were used. In geNorm analysis, the most stable gene
11 March 2014
was RPS7 (at a primer concentration 1000 nM) or YWHAZ (500 and 250 nM). According to
Accepted 11 April 2014
NormFinder and BestKeeper, ACTB (at all examined primer concentrations) followed by RPS7 and CYC were the most stable genes. Based on geNorm results at least two genes from among
Keywords: Reference gene Endometrium
RPS7, RPL30, ACTB or YWHAZ should be chosen for Real Time-PCR result normalization. # 2014 Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
Domestic cat
1.
Introduction
The domestic cat is a valuable model for studying molecular mechanisms that link hormonal contraception in carnivorous animals to the development of endometritis–pyometra complex. At present, studies are often based on molecular techniques including gene expression methods e.g., real-time PCR (RT-PCR). The sensitivity of the method depends on applying a suitable reference gene. The expression of a reference gene should be constant in all cells, in different developmental stages and under all experimental conditions [1]. However, many genes being used as reference genes do not meet these requirements. In view of the limited information on the selection of reference genes in felines, the aim of the
present study was to find the most stable reference gene from among b-actin (ACTB), glyceraldehydes 3-phosphate dehydrogenase (GAPDH), 60S ribosomal protein L30 (RPL30), cyclophilin (CYC), 60S ribosomal protein L17 (RPL17), 40S ribosomal protein S7 (RPS7) and tyrosine 3-monooxygenase (YWHAZ) in the endometrium of: (1) luteal phase queens, (2) hormonally treated queens, and (3) queens with symptoms of pyometra. To establish stability expression of the genes, three free software packages, geNorm, NormFinder and BestKeeper were used in the study.
2.
Materials and methods
All procedures were approved by the Local Animal Care and Use Committee in Olsztyn, Poland (No. 60/2010/DTN). A total
* Corresponding author. Tel.: +48 89 539 31 28; fax: +48 89 539 31 30. E-mail addresses: [email protected] (E. Jursza), [email protected] (D.J. Skarzynski), [email protected] (M.J. Siemieniuch). http://dx.doi.org/10.1016/j.repbio.2014.04.003 1642-431X/# 2014 Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
Please cite this article in press as: Jursza E, et al. Validation of reference genes in the feline endometrium. Reprod Biol (2014), http://dx.doi. org/10.1016/j.repbio.2014.04.003
REPBIO-120; No. of Pages 5
2
reproductive biology xxx (2014) xxx–xxx
Table 1 – Characteristic of primers used for real-time PCR. Gene
Gene name
GAPDH Glyceraldehyde 3-phosphate dehydrogenase RPL17 60S ribosomal protein L17 RPL30 60S ribosomal protein L30 RPS7 40S ribosomal protein S7 YWHAZ Tyrosine 3-monooxygenase/ tryptophan 5-monooxy-genase activation protein CYC Cyclophilin
ACTB
b-Actin
Function
Forward primer (50 ! 30 )
Accession number
Reverse primer (50 ! 30 )
Ref.
Glycolytic enzyme
NM 001009307 AGTATGATTCCACCCACGGCA
GATCTCGCTCCTGGAAGATGGT [14]
Ribosomal protein
AY738264
CTCTGGTCATTGAGCACATCC
TCAATGTGGCAGGGAGAGC
Ribosomal protein
AY700577
CCTCGGCAGATAAATTGGACTGTC
TGATGGCCCTCTGGAATTTGAC [14]
Ribosomal protein
AY800278
GTCCCAGAAGCCGCACTTTGAC
CTCTTGCCCACAATCTCGCTCG
[14]
GAAGAGTCCTACAAAGACAGCACGC AATTTTCCCCTCCTTCTCCTGC
[14]
AY029366
CCTTCTGTAGCTCGGGTCAG
CTTGGAGGGGAGGTAAGGAG
[2]
AB051104
ATCAAGGAGAAGCTGTGCTACGT
CGTTGCCGATGGTGATCA
[3]
Binds to EF458621 phosphatydylserine containing proteins
Isomerase involved in protein folding Cytoskeletal protein
[14]
All primers were purchased from Genomed (Warszawa, Poland).
of 11 domestic shorthair female cats (6–36 months old) were enrolled in the study. The cumulative information provided by inspection of the ovaries at ovariohysterectomy (OHE) [2] performed in the local veterinary clinics, blood progesterone concentration and information from the owner, were used to stage the estrous cycle of each animal. No pharmacological treatment was performed to provoke ovulation in the animals. Cats were assigned to: (1) luteal phase (LP) group (n = 3); (2) hormonally treated with octane medroxyprogesterone (OMP, Depo-Promone, Pfizer Animal Health, Louvainla-Neuve, France) group (n = 5), in which animals had been treated with OMP (5 mg/animal/week) for one month to prevent an estrus behavior; and (3) pyometric (PYO) group (n = 3). The uteri were washed immediately after surgery with saline, placed into fresh sterile saline (4 8C) and transported to the laboratory within 1 h. Uterine horns were cut longitudinally, pieces of endometrium (weighted 20–30 mg) were prepared, washed in fresh saline, kept overnight (4 8C) with RNAlater (Ambion Biotechnologie GmbH, Wiesbaden, Germany), and stored at 80 8C. Total RNA was isolated using TRIZOL-Reagent (Sigma–Aldrich, St. Louis, MO, USA). The RNA content was measured with a Nano-DropTM 1000 Spectrophotometer (Thermo, Wilmington, DE, USA). The RNA quality was confirmed by electrophoresis on 1.5% agarose gel. Prior to reverse transcription, genomic DNA contamination was removed by treatment with DNase (Sigma–Aldrich). Reverse transcription was performed using the ImProm-IITM Reverse Transcription System (Promega, Madison, WI, USA) [3]. In brief, each RT reaction mixture (volume 20.5 mL) contained: 1 mg of RNA in 12 mL of reaction mix, 4 mL of reaction buffer, 2.5 mL of MgCl2 (final concentration 3 mM), 1 mL of dNTP Mix (0.5 mM final concentration of each dNTP) and 1 mL of ImProm-IITM Reverse Transcriptase. Real-time PCR was carried out in an automated fluorometer Viia 7 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) using FAST-SYBR Green Master Mix (Applied
Biosystems). RT-PCR was performed in 96-well plates. The sequences of specific primers and the GenBank accession numbers are depicted in Table 1. Each reaction mixture (20 mL) contained 4 mL of cDNA (39 ng); 1000 nM, 500 nM or 250 nM forward (2 mL) and reverse (2 mL) primers; 10 mL FAST-SYBR Green Master Mix; and 2 mL nuclease free water. Amplification was carried out as follows: denaturation for 20 s at 95 8C, followed by 40 cycles at 95 8C for 1 s and 60 8C for 20 s. After RTPCR, melting curves were acquired in temperature from 60 8C to 95 8C to ensure that a single product was amplified in the reaction. To determine the most stable reference gene, three free software packages that use different algorithms were used: geNorm [4], NormFinder [5] and BestKeeper [6]. GeNorm software package determines stability of gene expression by calculating the stability value (M). The low M value (<1.5) determines the most stable gene [4]. In addition, geNorm software determines the optimal number of reference genes needed for gene expression normalization. A pairwise variation (V) was calculated for two sequential normalization factors NFn and NFn+1 (n = number of reference genes). When variation is lower than 0.15, using an additional reference gene is not required. NormFinder software package calculates gene expression stability based on the intra- and the inter-group variation. Genes characterized by the lowest gene expression stability value (r) are most stable [5]. BestKeeper software package estimates relations of possible reference gene pairs by performing numerous pairwise correlation analyses. Reference gene is assessed based on the average threshold cycle value (Ct) obtained from RT-PCR analysis, standard deviation (SD), coefficient of variance (CV) and coefficient of correlation (r). A good stability gene is characterized by low (<1) standard deviation value [6]. Differences in mRNA levels among the examined groups (LP, OMP, PYO) were analyzed by the Kruskal–Wallis test followed by the Newman–Keuls multiple comparison test using the statistical software program GraphPad6 (GraphPad
Please cite this article in press as: Jursza E, et al. Validation of reference genes in the feline endometrium. Reprod Biol (2014), http://dx.doi. org/10.1016/j.repbio.2014.04.003
REPBIO-120; No. of Pages 5
3
reproductive biology xxx (2014) xxx–xxx
Fig. 1 – Stability values (M) of the selected reference genes in the feline endometrium according to geNorm. Concentration of primers, from left to right 1000, 500 and 250 nM. The average expression stability value (M) is the pairwise variation of single reference gene with all other candidate reference genes. The more stable the gene, the lower its M value.
3.
Results and discussion
The expression stability of the seven candidate reference genes was examined in the current study. No difference in the genes expression stability was found among the three experimental groups (LP, OMP, PYO). Therefore, the stability results were pooled. The expression stability of the reference genes differed significantly depending on the primer concentration and the software used. Usually, a primer concentration in a RT-PCR ranges from 100 to 500 nM. An increased primer concentration may improve the RT-PCR outcome. However, too high increase in primer concentration may inhibit the reaction since primers compete with the product for the target sequence [7]. When geNorm was used, the most stable gene at a primer concentration 1000 nM was RPS7 followed by RPL30 and RPL17 (Fig. 1). At a primer concentration 500 nM, YWHAZ followed by RPL17 were ranked to be the most stable. Whereas, at a primer concentration 250 nM YWHAZ followed by ACTB were ranked to be the best. GAPDH was the least stable reference gene at a primer concentration 1000 nM and 250 nM. CYC was the least stable gene at 500 nM and was the second worse at 1000 and 250 nM. Based on the geNorm analysis, CYC should not be consider as a reference gene. Penning and coworkers [8] used geNorm to examine 10 reference genes in cat heart, kidneys, liver, lungs, prostate gland and teeth. They found RPL17, RPS7 and RPL30 to be the most stable genes at primer concentration of 400 nM. In another study, that did not include the uterus or ovaries, and was based on geNorm and NormFinder analyses, the most stable genes differed significantly between the tissues or software used [9]. In 11 out of the 14 feline tissues, RPS7 ranked among the three most stable genes, followed by ACTB in 8 of the 14 tissues, whilst GAPDH had an acceptable stability only in a few tissues [9]. The optimal number of reference genes was calculated using geNorm (Fig. 2). Based on obtained results, we suggest to use RPS7 and RPL30 at a primer concentration 1000 nM or YWHAZ and RPL17 at a primer concentration 500 nM. If primer
concentration 250 nM was used, an additional, third reference gene was required for accurate normalization of RT-PCR. In this case, we suggest to use YWHAZ, ACTB and RPL30. RT-PCR data analysis normalization by multiple reference genes instead of one is strongly recommended by Vandesompele et al. [4]. Based on geNorm analysis, Kessler and coworkers calculated, that two to three reference genes were required for accurate RT-PCR normalization in the most feline tissues [9]. They recommended using RPS7 as the most suitable reference gene and ACTB, glucuronidase (GUSB) and/or YWHAZ for confirmation of the results [9]. When NormFinder was used, ACTB was found to be the most stable gene at all primer concentrations, the second best was RPS7 (primer concentrations: 500 and 250 nM) followed by CYC (1000 nM) (Fig. 3). These results confirmed that applying of ACTB as a reference gene in our previous studies performed in
0.2
Pairwise variation (V)
PRISM v 6.0; GraphPad Software Inc., San Diego, CA, USA). Significance was defined as p < 0.05.
1000 nM 500 nM 250 nM
0.15
0.1
0.05
0 V2/3
V3/4
V4/5
V5/6
V6/7
Fig. 2 – Determination of the optimal number of the reference genes for gene expression normalization with geNorm. A pairwise variation (V) was calculated for two sequential normalization factors NFn and NFn+1 (n = number of reference genes) for all samples. When variation is lower than 0.15, an additional reference gene is not required. Because the pairwise variation V2/3 was less than 0.15 at primer concentration of 1000 nM or 500 nM, a third reference gene was not needed for accurate normalization at these concentrations. At a concentration of 250 nM, the use of at least three reference genes is recommended.
Please cite this article in press as: Jursza E, et al. Validation of reference genes in the feline endometrium. Reprod Biol (2014), http://dx.doi. org/10.1016/j.repbio.2014.04.003
REPBIO-120; No. of Pages 5
4
reproductive biology xxx (2014) xxx–xxx
Fig. 3 – Stability values (r) of selected reference genes in feline endometrium by NormFinder. Concentration of primers, from left to right 1000, 500 and 250 nM.
the feline endometrium under physiological conditions was accurate [3,10,11]. The third most stable gene was GAPDH at a primer concentration 1000 nM and 500 nM, but it was ranked fourth when primer concentration of 250 nM was used. Using NormFinder software, regardless of the concentration of primers, ACTB was the most stable of the proposed reference genes and RPL30 was most unstable. GAPDH is one of the most commonly used reference genes. In the mouse uterus during the peri-implantation period, GAPDH was sufficiently stable to be used as reference gene according to NormFinder, geNorm and BestKeeper [12], as well as GAPDH was found to be the most stable gene in the equine endometrium during early pregnancy [13]. In contrast, reports on bovine endometrium during early pregnancy found GAPDH to be the least stable gene based on NormFinder and geNorm analyses [14]. GAPDH was among the three most
Table 2 – Results of the BestKeeper analysis. ACTB GAPDH RPL 30
CYC
RPL 17 RPS 7 YWHAZ
(a) Primer concentration of 1000 nM Ct 30.82 32.29 19.93 20.10 0.67 0.65 1.26 0.82 SD 2.19 2.01 6.30 4.07 CV 0.43 0.06 0.32 0.55 r
18.04 1.22 6.76 0.56
19.87 0.78 3.90 0.23
29.69 1.32 4.45 0.11
(b) Primer concentration of 500 nM 31.02 31.86 20.07 20.39 Ct 0.64 1.29 1.29 0.88 SD CV 2.06 4.04 6.44 4.33 0.74 0.60 0.32 0.34 r
18.66 1.00 5.38 0.79
19.71 0.63 3.17 0.79
29.98 1.40 4.66 0.15
(c) Primer concentration Ct 31.83 31.71 0.67 0.67 SD 2.12 2.10 CV 0.41 0.32 r
19.13 1.22 6.36 0.67
20.41 0.90 4.42 0.56
29.78 1.52 5.09 0.48
of 250 nM 20.25 21.01 1.34 0.89 6.61 4.25 0.49 0.26
Descriptive statistics of 7 candidate reference genes according to the BestKeeper software. Number of samples using for optimization n = 11. Low standard deviation (SD; <1) and high coefficient of correlation (r) indicate the most stable gene (bold letters). Ct, geometric mean of raw threshold cycle value; SD, standard deviation of the Ct; CV, coefficient of variance expressed as percentage of Ct level; r, coefficient of correlation.
stable genes only in 4 out of 14 feline tissues in the NormFinder ranking [9]. When BestKeeper was used, GAPDH, ACTB, CYC and RPS7 were among the most stable genes at all examined primer concentrations, with the exception of GAPDH at a primer concentration of 500 nM (Table 2). At the primer concentrations of 1000, 500 and 250 nM, RPL30, RPL17 and YWHAZ were ranked as not stable. The Pearson correlation coefficient (r), determined by BestKeeper, should not be used to compare genes with Cts of around 30–35 to genes with Cts around 15–20 [6]. Therefore in the present study we compared only five candidate reference genes, excluding ACTB and GAPDH. Thus, CYC (1000 nM) and RPS7 (500 or 250 nM) were demonstrated to be the most stable reference genes. In summary, geNorm, NormFinder and BestKeeper software packages did not rank the expression stability of the examined genes in the same order. In geNorm analysis, the most stable gene was RPS7 (1000 nM) or YWHAZ (500 and 250 nM). Furthermore, two reference genes: RPS7 and RPL30 (1000 nM) or YWHAZ and RPL17 (500 nM), or three reference genes: YWHAZ, ACTB and RPL30 (250 nM) should be used for accurate RT-PCR results normalization. According to NormFinder, ACTB (at all examined primer concentrations) followed by RPS7 (500 and 250 nM) were the most stable reference genes. BestKeeper ranked ACTB (at all primers concentrations) as suitable reference gene, followed by RPS7 and CYC. We suggest to chose at least two genes from among RPS7, RPL30, ACTB or YWHAZ for RT-PCR results normalization in the feline endometrium.
Author's contribution EJ participated in the study design, laboratory analysis, interpretation of the results and preparation of the manuscript. DJS helped in editing the manuscript. MJS designed the experiments and drafted the manuscript. All authors read and approved the final version of the manuscript.
Conflict of interest The authors declare no conflict of interest.
Please cite this article in press as: Jursza E, et al. Validation of reference genes in the feline endometrium. Reprod Biol (2014), http://dx.doi. org/10.1016/j.repbio.2014.04.003
REPBIO-120; No. of Pages 5 reproductive biology xxx (2014) xxx–xxx
Acknowledgements [6]
This study was supported by grants-in-aid for Scientific Research from the Polish Ministry of Scientific Research and High Education (N308 560740). EJ was supported by the European Union through the European Social Fund. Authors are indebted to the staff of the Department of Animal Reproduction with Clinic, the Faculty of Veterinary Medicine, University of Warmia & Mazury Olsztyn and DOGMED Veterinary Clinic from Olsztyn for allowing the tissue collection.
[7]
references
[9]
[1] Peinnequin A, Mouret C, Birot O, Alonso A, Mathieu J, Clarençon D, et al. Rat pro-inflammatory cytokine and cytokine related mRNA quantification by real-time polymerase chain reaction using SYBR green. BMC Immunol 2004;5:3. [2] Siemieniuch MJ, Jursza E, Szostek AZ, Skarzynski DJ, Boos A, Kowalewski MP. Steroidogenic capacity of the placenta as a supplemental source of progesterone during pregnancy in domestic cats. Reprod Biol Endocrinol 2012;10:89. [3] Siemieniuch MJ, Jursza E, Kowalewski MP, Majewska M, Skarzynski DJ. Prostaglandin endoperoxide synthase 2 (PTGS2) and prostaglandins F2a and E2 synthases (PGFS and PGES) expression and prostaglandin F2a and E2 secretion following oestrogen and/or progesterone stimulation of the feline endometrium. Reprod Domest Anim 2013;48(1):72–8. [4] Vandesompele J, Preter KD, Pattyn F, Poppe B, Roy NV, Paepe AD, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002;3(7):1–11. [5] Andersen CL, Jensen JL, Ørntoft TF. Normalization of real-time quantitative reverse transcription-PCR data:
[8]
[10]
[11]
[12]
[13]
[14]
a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 2004;64(15):5245–50. Pfaffl MW, Tichopád A, Prgomet C, Neuvians TP. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper – excel-based tool using pair-wise correlations. Biotechnol Lett 2004;26(6):509–15. Czerny T. High primer concentration improves PCR amplification from random pools. Nucleic Acids Res 1996;24 (5):985–6. Penning LC, Vrieling HE, Brinkhof B, Riemers FM, Rothuizen J, Rutteman GR, et al. A validation of 10 feline reference genes for gene expression measurements in snap-frozen tissues. Vet Immunol Immunopathol 2007;120 (3/4):212–22. Kessler Y, Helfer-Hungerbuehler AK, Cattori V, Meli ML, Zellweger B, Ossent P, et al. Quantitative TaqMan real-time PCR assays for gene expression normalisation in feline tissues. BMC Mol Biol 2009;10:106. Siemieniuch MJ, Bowolaksono A, Skarzynski DJ, Okuda K. Ovarian steroids regulate prostaglandin secretion in the feline endometrium. Anim Reprod Sci 2010;120(1–4):142–50. Siemieniuch MJ, Mlynarczuk JJ, Skarzynski DJ, Okuda K. Possible involvement of oxytocin and its receptor in the local regulation of prostaglandin secretion in the cat endometrium. Anim Reprod Sci 2011;123(1/2):89–97. Sun Z, Su R, Yang Z, Shi H, Liu C, Wang J. Expression of the novel gene embryo implantation factor 2 (EMO2) in the mouse uterus at the implantation sites. Fertil Steril 2009;91 (5 Suppl.):2116–22. Kayis SA, Atli MO, Kurar E, Bozkaya F, Semacan A, Aslan S, et al. Rating of putative housekeeping genes for quantitative gene expression analysis in cyclic and early pregnant equine endometrium. Anim Reprod Sci 2011;125 (1–4):124–32. Walker CG, Meier S, Mitchell MD, Roche JR, Littlejohn M. Evaluation of real-time PCR endogenous control genes for analysis of gene expression in bovine endometrium. BMC Mol Biol 2009;10:100.
Please cite this article in press as: Jursza E, et al. Validation of reference genes in the feline endometrium. Reprod Biol (2014), http://dx.doi. org/10.1016/j.repbio.2014.04.003
5