Variable effects of oxytetracycline on antibiotic resistance gene abundance and the bacterial community during aerobic composting of cow manure

Journal of Hazardous Materials 315 (2016) 61–69

Contents lists available at ScienceDirect

Journal of Hazardous Materials journal homepage: www.elsevier.com/locate/jhazmat

Variable effects of oxytetracycline on antibiotic resistance gene abundance and the bacterial community during aerobic composting of cow manure Xun Qian a , Wei Sun a , Jie Gu a,b,∗ , Xiao-Juan Wang a , Jia-Jun Sun a , Ya-Nan Yin a , Man-Li Duan a a b

College of Natural Resources and Environment, Northwest A&F University, Yangling, Shaanxi 712100, China Research Center of Recycle Agricultural Engineering and Technology of Shaanxi Province, Northwest A&F University, Yangling, Shaanxi 712100, China

h i g h l i g h t s

g r a p h i c a l

a b s t r a c t

• Relative abundance (RA) of ARGs in • • • •

compost was similar with four OTC treatment levels. RAs of tetC, tetX, sul1, sul2, and intI1 increased by 2–43 times after composting. OTC at 200 mg/kg increased the absolute abundances of 5/8 ARGs and intI. Changes in ARGs during composting associated with bacterial community succession. Composting did not remove most ARGs and the compost remained a reservoir of ARGs.

a r t i c l e

i n f o

Article history: Received 23 January 2016 Received in revised form 24 April 2016 Accepted 2 May 2016 Available online 3 May 2016 Keywords: Aerobic composting Antibiotic resistance gene Livestock manure Oxytetracycline

a b s t r a c t Livestock manure is often subjected to aerobic composting but little is known about the variation in antibiotic resistance genes (ARGs) during the composting process under different concentrations of antibiotics. This study compared the effects of three concentrations of oxytetracycline (OTC; 10, 60, and 200 mg/kg) on ARGs and the succession of the bacterial community during composting. Very similar trends were observed in the relative abundances (RAs) of each ARG among the OTC treatments and the control during composting. After composting, the RAs of tetC, tetX, sul1, sul2, and intI1 increased 2–43 times, whereas those of tetQ, tetM, and tetW declined by 44–99%. OTC addition significantly increased the absolute abundances and RAs of tetC and intI1, while 200 mg/kg OTC also enhanced those of tetM, tetQ, and drfA7. The bacterial community could be grouped according to the composting time under different treatments. The highest concentration of OTC had a more persistent effect on the bacterial community. In the present study, the succession of the bacterial community appeared to have a greater influence on the variation of ARGs during composting than the presence of antibiotics. Aerobic composting

∗ Corresponding author at: College of Natural Resources and Environment, Northwest A&F University, Yangling, Shaanxi 712100, China. E-mail address: [email protected] (J. Gu). http://dx.doi.org/10.1016/j.jhazmat.2016.05.002 0304-3894/© 2016 Published by Elsevier B.V.

62

X. Qian et al. / Journal of Hazardous Materials 315 (2016) 61–69

was not effective in reducing most of the ARGs, and thus the compost product should be considered as an important reservoir for ARGs. © 2016 Published by Elsevier B.V.

1. Introduction Aerobic composting is one of the main methods for the disposal and reuse of livestock manure. However, high concentrations of antibiotics and antibiotic resistance genes (ARGs) may be found in livestock manure due to the use of antibiotics for disease treatment and growth promotion [1–3]. The compost product is used widely as an organic fertilizer or soil amendment, and thus it is the main source of antibiotics and ARGs in the environment [4,5]. Therefore, there is growing concern about the risk of ARGs spreading to pathogens via horizontal gene transfer (HGT), which may make antibiotics ineffective [6–8]. Previous studies have shown that composting can effectively reduce the abundance of most classes of antibiotics, where the degradation occurs mainly in the first 2 weeks [9–11] and temperature is an important factor for the reduction of antibiotics via both degradation and absorption [12,13]. The presence of antibiotics may generate a selection pressure for ARGs, and thus some ARGs may persist even when the antibiotic pressure is gone [14,15]. Therefore, it has gradually been recognized that the removal of ARGs is as important as eliminating antibiotics, which is necessary for reducing the environmental risk related to the agricultural use of livestock manure [16]. Several studies have shown that the composting process is effective for reducing the abundance of several ARGs, but it is still unclear how and why the abundances of ARGs change during composting [9,17]. The presence of residual antibiotics in livestock manure may alter the microbial community during composting, thereby affecting the composting process and the quality of the compost product [18]. The types and concentrations of residual antibiotics vary greatly in animal manure [19,20], which may have diverse effects on the microbial community. Selvam et al. [9] found that the addition of 100, 20, and 20 mg/kg of chlortetracycline, sulfadiazine, and ciprofloxacin, respectively, led to transient perturbations of the bacterial community but the bacterial diversity recovered during the later stage of composting. Microbes are the main carriers of ARGs, so changes in the succession of the bacterial community may lead to variations in ARGs [21]. Therefore, exploring the relationship between the microbial community and ARGs is important for understanding the variation in ARGs during composting. In this study, we tested the effects of oxytetracycline (OTC), which is employed frequently in livestock production as a typical antibiotic [19,20], using 16S rDNA sequencing and quantitative PCR (qPCR) methods, where we compared the effects of three concentrations of OTC on the bacterial community and ARGs. The results obtained provide insights into the changes in ARGs during the composting process and they may facilitate the development of appropriate measures to improve the performance of ARG reduction by composting, thereby decreasing the environment risk associated with the compost product.

2 weeks before the manure was collected. The fresh manure was mixed, air dried to a water content <30%, crushed, and sieved through a 5-mm mesh. Wheat straw was cut into pieces measuring about 1 cm. The cow manure had a pH of 7.8, organic carbon content of 410.8 g/kg, and an organic nitrogen content of 1.91 g/kg. The wheat straw had an organic carbon content of 417.6 g/kg and an organic nitrogen content of 6.09 g/kg. The composting experiment was performed in the composting area at Northwest A&F University. The compost reactors comprised 12 identical bubble boxes, which measured: length × width × height × thickness = 45 × 27.5 × 51.5 × 3.5 cm. There were 2 × 2 cm holes on the top, bottom, and wall faces to facilitate aeration. A stock solution of OTC (50 mg/mL) was prepared and diluted with an appropriate volume of sterile water. The diluted OTC solution was then mixed thoroughly with the cow manure. The cow manure was spiked with 0 (CK), 10 (OTC10), 60 (OTC60), or 200 (OTC200) mg/kg of OTC (purity >98%, Sigma) on a dry weight (DW) basis and allowed to equilibrate for 2 h. The concentration levels were set according to the residual concentrations of OTC reported previously in animal manure [12,19]. The manure was mixed with wheat straw (4:1 DW) and the moisture content was adjusted to 55%. Each treatment was repeated in triplicate. The compost was allowed to process for 40 days and turning was performed on days 1, 3, 5, 8, 13, and 21. 2.2. Sampling The compost material was mixed homogeneously before sampling and ca 1 kg was sampled on days 1, 3, 8, 21, and 40 for each treatment. The initial mixture (CK) was sampled on day 0. All samples were analyzed for total culturable bacteria (TCB), OTC-resistant bacteria (ORB), and ARGs, but only the samples collected on days 3, 21, and 40 were used for 16S rDNA sequencing. The sample was divided into two parts, where one was cut on the benchtop to enumerate the bacterial content in 7 days, and the second was freeze dried using a vacuum freeze dryer (Songyuan, China), milled to 1 mm with an ultra-centrifugal mill (Retsch Z200, Germany), and stored at −80 ◦ C before DNA extraction. 2.3. Enumeration of TCB and ORB Five grams of each compost sample were suspended in 45 mL of phosphate-buffered saline and shaken for 30 min at 200 rpm. Control plates were also enumerated without the addition of compost samples. The supernatant was serially diluted to 10−3 using sterile saline dilution medium. Next, 150 ␮L of each diluted suspension was inoculated into Luria Bertani medium containing 0 or 50 ␮g/mL OTC to enumerate the TCB and ORB, respectively [22]. The numbers of colony-forming units were counted after incubating at 37 ◦ C for 36 h. Only plates with 20–200 colonies were used for enumeration. All of the analyses were performed using triplicate samples.

2. Materials and methods 2.1. Experimental setup

2.4. Isolation and identification of culturable ORB and sulfamethazine-resistant bacteria

The manure used in this study was collected from a mediumsized dairy farm in Yangling, Shaanxi, China. The dairy stopped using antibiotics for therapeutic or non-therapeutic purposes at

The compost samples collected from all of the treatments after 40 days were mixed and used to isolate ORB and sulfamethazineresistant bacteria. The same procedure was used to enumerate the

X. Qian et al. / Journal of Hazardous Materials 315 (2016) 61–69

63

ORB, but Luria Bertani media containing 50 ␮g/mL sulfamethazine was employed to isolate sulfamethazine-resistant bacteria. DNA from each bacterial isolate was extracted using a TIANamp Bacteria DNA Kit (TianGen, Shanghai). The 16S rDNA gene sequences were amplified using the primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT) [23]. The PCR products were confirmed by commercial sequencing (Shanghai Shengong Biotechnology Co., Shanghai, China) and compared with GenBank sequences.

2.5. DNA extraction and qPCR DNA was extracted from the compost samples using a FastDNA Kit for Soil (MP Biomedicals, USA) according to the manufacturer’s instructions. Standard PCR was employed to determine the presence of 11 tetracycline resistance genes (tetA, tetB, tetC, tetE, tetG, tetM, tetO, tetQ, tetT, tetW, and tetX), five sulfonamide resistance genes (sul1, sul2, sulA, dfrA1, and dfrA7), and the integrase gene of class 1 integrons (intI1). The primers and standard PCR conditions are described in the Supporting information (S1 and Table S1). The PCR products were analyzed by 1.5% (w/v) agarose gel electrophoresis. Five tetracycline resistance genes (tetC, tetM, tetQ, tetW, and tetX), three sulfonamide resistance genes (sul1, sul2, and drfA7), and intI1 were detected, so they were then quantified by qPCR using the BioRad iQ5 Real-Time PCR Detection System (BioRad). The qPCR conditions are described in the Supporting Information (S1). The absolute abundances (AAs) of the ARGs were expressed as copies/g of dry compost. The detection limit was 104 copies/g compost. The relative abundances (RAs) of the ARGs were calculated as: copy number of an ARG/copy number of 16S rDNA.

Fig. 1. (A) Total heterotrophic bacteria and (B) oxytetracycline-resistant bacteria (ORB)/total culturable bacteria (TCB) ratio during composting.

3. Results and discussion 3.1. Changes in ORB during composting

2.6. 16S rDNA sequencing The 16S rDNA high-throughput sequencing was performed by Realbio Genomics Institute (Shanghai, China) using the Illumina MiSeq platform. The 16S V3-V4 region was amplified using the primers U341F (ACTCCTACGGGAGGCAGCAG) and U806R (GGACTACHVGGGTWTCTAAT). The raw data were then subjected to a quality control procedure using UPARSE [24]. The qualified reads were clustered to generate operational taxonomic units (OTUs) at the 97% similarity level using USEARCH [25]. A representative sequence for each OTU was assigned to a taxonomic level in the RDP database by the RDP classifier [26]. Principal components analysis and heatmap analysis were performed using R3.1.0 [27]. The sequences of the OTUs were subjected to BLASTN by referring to the human pathogenic bacteria (HPB) database described by Fang et al. [8], with some modifications. The results with hits were then searched using BLASTX in the Antibiotic Resistance Genes Database to identify HPB carrying ARGs (Supporting information S2) [28].

2.7. Statistical analyses One-way ANOVA (least significant difference, p < 0.05) was performed to compare the ORB and ORB/TCB, as well as the AAs and RAs of ARGs with different treatments. Pearson’s correlation coefficients were calculated between the RAs of ARGs and intI1, as well as the RAs of ARGs and major phyla for different treatments. Redundancy analysis was conducted with CANOCO 4.5. Statistical analyses were performed using PASW Statistics 18.0.

The trends in ORB in the treatments with and without OTC were very similar during composting (Fig. 1A). The abundances of ORB increased sharply during days 0–3, which was mainly attributed to the rapid enhancement in the total number of bacteria. The ORB then varied little during days 3–40 in all treatments, except for OTC60. The number of ORB in OTC200 was 11.4 times higher than that in CK, whereas the numbers of ORB in OTC10, OTC60, and CK were very similar at the end of composting. The ORB/TCB ratio increased under the OTC treatments during days 0–1 and the ORB/TCB ratios were significantly higher under the OTC treatments compared with CK (Fig. 1B). The ORB/TCB ratio continued to rise in OTC200, whereas it declined during days 1–3 in OTC10 and OTC60. Compared with CK, OTC10 and OTC60 had significantly higher ORB/TCB ratios during the early composting period, but there was no significant difference between them at day 40. The ORB/TCB ratio was significantly higher in OTC200 compared with CK during the entire composting process. The ORB/TCB ratio was 23.4 times higher in OTC200 than that in CK at day 40. It is possible that the OTC was degraded adequately during composting at 10 and 60 mg/kg, and thus the selective pressure disappeared during the later period of composting [10,11]. However, the degradation of 200 mg/kg OTC was not sufficient and there was still residual OTC in the compost mass [29]. These results indicate that the presence of OTC enriched some culturable bacteria. By contrast, Youngquist et al. [30] reported that ciprofloxacin was effectively adsorbed by the compost material, and thus it did not increase the abundance of resistant bacteria. This difference indicates that the type and concentration of the antibiotic employed as well as the specific compost material may modulate the effects of antibiotics on microbes during composting.

64

X. Qian et al. / Journal of Hazardous Materials 315 (2016) 61–69

Fig. 2. Variation in selected ARGs/16S rDNA and intI1/16S rDNA during composting. CK, OTC10, OTC60, and OTC200 represent the addition of 0, 10, 60 and 200 mg/kg oxytetracycline to compost, respectively. Bars represent standard deviations (n = 3).

X. Qian et al. / Journal of Hazardous Materials 315 (2016) 61–69

65

Table 1 Pearson’s correlation coefficients between the relative abundances of selected antibiotic resistance genes and that of intI1. tetC tetM tetC 1 tetM tetQ tetW tetX sul1 sul2 dfrA7 intI1 * **

tetQ

tetW

−0.375 −0.358 −0.541* 1 0.621** 0.802** 1 0.555** 1

tetX

sul1

sul2

dfrA7

intI1

0.592** −0.381 −0.367 −0.580** 1

0.566** 0.056 −0.164 −0.104 0.597** 1

0.660** −0.429 −0.413 −0.625** 0.801** 0.441* 1

0.412 0.302 −0.032 0.105 0.532* 0.527* 0.408 1

0.590** 0.067 −0.167 −0.008 0.601** 0.647** 0.631** 0.748** 1

Correlation significant at p < 0.05. Correlation significant at p < 0.01.

3.2. Changes in ARGs during composting The RAs of ARGs could reflect the proportion of antibioticresistant bacteria present in the total population, which may vary with changes in the bacterial community structure as well as with the HGT of ARGs among bacteria [31,32]. The changes in the RAs of tetC, tetX, and sul2 were similar during the composting process (Fig. 2). The RAs of tetC, tetX, sul1, and sul2 were enhanced by 10–43, 12–25, 6–8, and 24–27 times, respectively, after composting. The RAs of tetQ, tetM, and tetW exhibited similar variation during composting, where the overall trend was decreasing in days 0–8 and it then fluctuated slightly. Among the three ARGs, the RA of tetQ declined most (1.2–5.9% of the initial level) after composting. The similar trends in the RAs of different ARGs were also confirmed by correlation analysis (Table 1). Positive correlations were detected between tetC with tetX, sul1, and sul2, as well as between tetM with tetQ and tetW, possibly because these ARGs had the same host bacteria or there were positive correlations between their host bacteria [33]. There were negative correlations between tetC with tetW and tetQ with sul2, which indicates that there may have been negative correlations between their host bacteria. Very similar variations were observed in the RA of each ARG among different treatments, thereby demonstrating that the changes in the RAs of the ARGs depended mainly on the composting stage rather than the antibiotic concentration. Similar results were also obtained in previous studies [34,35]. It should be noted that the addition of OTC improved the RA of some ARGs during composting, but other ARGs were not affected by the addition of OTC, which may be explained the different responses of various ARGs to antibiotics [33]. Low concentrations (10 and 60 mg/kg) of OTC enhanced the RAs of ARGs in the early stage (0–8 days), but the RAs of the ARGs decreased later (21–40 days), possibly because the OTC declined rapidly in the early stage, so the selection pressure disappeared during the later stage. However, the RAs of most of the ARGs were still significantly higher under OTC200 than CK at the end of composting. This result was consistent with that obtained using the culture-based method, which showed that the ORB/TCB ratio varied little when the compost material contained no OTC or a low concentration of OTC (10 and 60 mg/kg), whereas the highest concentration of OTC (200 mg/kg) increased the ORB/TCB ratio. However, the results obtained by the two methods were not completely consistent because: (1) not all of the bacteria that contain ARGs are culturable; (2) culturable resistant bacteria may have possessed ARGs that were not detected in this study [36]; (3) some of the ARGs detected by qPCR may have been extracellular DNA [37,38]; and (4) the increase in ARGs did not represent an improved level of resistance, and vice versa [38]. Interestingly, the RAs of all the ARGs except tetQ increased during days 0–1 and they then decreased in days 1–3, which may be explained by the sudden presence of OTC (0–1 days) enriching antibiotic-resistant bacteria [4,7], before the subsequent high

Fig. 3. Absolute abundances of ARGs and intI1 at the start and end of composting. Values represent the means of three replicates. Bars denote standard errors. The dotted line represents the number of gene copies at the start of composting. Different letters indicate significant differences at p < 0.05.

Fig. 4. Principal components analysis of the bacterial communities in compost supplemented with 0, 10, 60, and 200 mg/kg oxytetracycline.

temperature (1–3 days) killed the resistant bacteria that lacked thermo-tolerance [39]. OTC200 also improved the RA of drfA7, a sulfonamide resistance gene, which may have been due to the coresistance and cross-resistance of the two classes of antibiotics [40]. At some time points, the RAs of the ARGs in CK were higher than those in the OTC treatments, thereby demonstrating that other factors influenced the abundance of ARGs in addition to the antibiotic pressure [9]. Moreover, intI1 maintained a relatively high RA throughout composting, where its RA fluctuated from 0.2% to 1.7%. Furthermore, sul1 and dfrA7 were commonly associated with intI1 [41,42], and tetC and tetX were also positively correlated with intI1, which suggests that intI1 plays an important role in the propagation of ARGs [43,44]. 3.3. AAs of ARGs after composting The AAs of tetM, tetQ, and tetW declined by 7.9–35.1%, 1.1–3.7%, and 23.1–28.9%, respectively, after composting for 40 days (Fig. 3). By contrast, the AAs of tetC, tetX, sul1, sul2, and dfrA7 increased by

66

X. Qian et al. / Journal of Hazardous Materials 315 (2016) 61–69

Fig. 5. Heatmap showing the relative abundances of the 50 most abundant genera from compost supplemented with 0, 10, 60, and 200 mg/kg oxytetracycline.

7.4–41.5, 11.5–16.0, 4.3–8.2, 21.4–30.8, and 3.7–9.8 times, respectively, after composting. Diverse effects of composting on different ARGs were also found by Zhu et al. [5] who compared the ARGs in manure and manure compost from three swine farms. Due to the vast number of ARG classes and the distinct variations in different ARGs, it is difficult to conclude whether composting increased, decreased, or had no effect on the overall concentration of ARGs. In addition, although the abundance of some ARGs decreased, they were still detected at relatively high AAs (5.2 × 105 –2.1 × 108 copies per g compost). By contrast, Selvam et al. [9] reported the com-

plete removal of 11 ARGs (including tetQ, tetW, sul1, sul2, and dfrA7, which we also analyzed in the present study) after composting for 42 days. All of the ARGs analyzed by Chen et al. [43] and Wang et al. [17] were decreased by composting, where the AAs of six erm genes decreased by 1.5–7.3 logs and the AAs of six tet genes decreased by 1–4 logs after composting (tetM and tetW were decreased by approximately 4 logs). Thus, compared with previous reports that aerobic composting is effective in decreasing the abundance of ARGs [9,17,45], our results may appear to be relatively pessimistic. However, the composting conditions and the

X. Qian et al. / Journal of Hazardous Materials 315 (2016) 61–69

materials used may explain the inconsistency between our results and those obtained by other researchers. For example, Wang et al. [17] conducted composting at a temperature of 55 ◦ C, whereas natural composting was applied in most previous studies, and thus the results of the present study are representative. The condition of the manure may also influence the results obtained before and after composting. For example, fresh manure may have a higher AA of ARGs than manure that has been stored for several days. In addition to the AAs of ARGs, the status and hosts for ARGs should also be considered when evaluating the safety of compost products. The ARGs detected by qPCR include both extracellular and intracellular ARGs [37]. However, the HGT frequency of intracellular ARGs due to conjugation is much higher than that of extracellular ARGs by transformation [46]. The HGT capacity of different host bacteria also varies widely [47]. Thus, it is necessary to consider the ARGs that are readily transferred. It is not possible to evaluate whether a compost is safe because there is no standard for ARGs, although they were proposed as contaminants about 10 years ago [48]. Thus, suitable background studies on the risk of ARGs are needed to draft a standard for ARGs in manure compost in future research. The relationships among the AAs of ARGs before and after composting were not affected by the addition of OTC, which demonstrates that the composting process itself was more important than the addition of antibiotics for the AA of ARGs. However, the AAs were significantly higher in the OTC200 treatment than CK for five of eight ARGs and intI1, thereby suggesting that the presence of a high concentration of OTC in the manure could enhance the abundance of ARGs [49]. It should be noted that the AA of intI1 increased by 1.6–3.7 times after composting, which indicates that the composting process may lead to the generation of multiantibiotic resistance genes. The presence of a high AA of intI1 in compost may also enhance the dissemination of ARGs in the soil environment [50]. 3.4. Bacterial community and its association with ARGs and intI1 According to the principal components analysis, PC1 and PC2 accounted for 58.0% of the total variation (Fig. 4). The bacterial community profiles were separated by composting time, which was also supported by clustering analysis of the main genera (Fig. 5). The OTC treatments had higher scores for PC1 than CK, and OTC200 was most distinct from CK at day 3. The bacterial community structures in OTC60 and OTC200 differed more than that in OTC10 compared with CK at 21 and 40 days, which demonstrates that the higher concentrations of OTC had more persistent effects on the bacterial community [9,47]. Redundancy analyses were performed to assess the associations between ARGs with intI1 and bacterial communities (Fig. 6), which showed that the bacterial community explained 93.0% of the total variance in ARGs. Similar to the bacterial community, the ARG profiles of treatments were also divided into two groups according to the composting time, where the results showed that the ARG profiles were correlated significantly with the bacterial community structure, which is consistent with previous studies of sludge composting and water chlorination processes [51,52]. The results also confirmed that the variation in ARGs during composting was affected more greatly by the natural succession of the microbial community than the presence of OTC. However, the presence of antibiotics should still be considered because high concentrations of antibiotics may increase the AAs and RAs of some ARGs in compost. Actinobacteria, Bacteroidetes, Chloroflexi, Firmicutes and Proteobacteria were the main phyla present during aerobic composting, where they accounted for 84.4–95.3% of the total bacteria (Fig. S2). Actinobacteria are the main producers of antibiotics and they usually carry multiple resistance genes [53], and thus they were

67

Fig. 6. Redundancy analysis of the relationships between the main bacterial phyla (red arrows) with ARGs and intI (blue arrows). L: OTC10; M: OTC60; H: thermophilic OTC200; Actino: actinobacteria; Bacter: aacteroidetes; Chloro: ahloroflexi; Proteo: proteobacteria; Firmic: firmicutes. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

enriched at days 3 and 21 in OTC60 and OTC200. Correlation analyses detected significant positive correlations between Firmicutes with tetQ and tetW (Table S2). The decrease in the abundance of Firmicutes during composting may explain the declines in tetQ and teW. Bacteroidetes and Chloroflexi had significant positive correlations with tetC, tetX, sul2, dfrA7, and intI1, thereby indicating that they are important hosts of ARGs and intI1 during composting [54,55]. The increases in these ARGs may be attributed to the presence of Bacteroidetes and Chloroflexi during composting. Four taxa from the genera Corynebacterium, Brachybacterium, Dietzia, and Nocardioides, which may be OTC-tolerant bacteria, were enriched in the OTC treatments at day 3 but they declined to a level similar to CK after day 21 (Fig. 5). In addition, Saccharomonospora spp. were enriched in OTC200 at 3 days but they declined gradually to a level similar to CK subsequently. The increased abundance of these species may have been related to the degradation of OTC and the acquisition of OTC resistance. Actinomadura spp. were enriched whereas Ammoniibacillus spp. were inhibited by the addition of OTC. Planifilum spp. and Idiomarina spp. were inhibited by the OTC200 treatment throughout the entire composting process. In addition, two pathogenic bacteria, Corynebacterium diphtheriae and Clostridium difficile, were found in the compost (Table S3), where Corynebacterium diphtheriae can carry 10 different types of sul1 (Table S4). Similar results were also obtained by Fang et al. [8] who found that Corynebacterium diphtheriae harboring ARGs encoding sulfonamide dihydropteroate synthase was one of the dominant HPB species in chicken manure and manure-treated soil. In our study, eight ORB and nine sulfamethazine-resistant bacteria were isolated from the mixed compost product (Table S5), thereby suggesting that the host bacteria of the ARGs had high diversity. Among the isolated bacteria, Arthrobacter arilaitensis and Bacillus licheniformis were found to be resistant to both of the antibiotics. Bacillus sp. and Pseudomonas sp. are known to transfer ARGs via conjunction [56,57]. Thus, our results demonstrate that compost is an important reservoir of ARGs and its application to land may promote the dissemination of ARGs. In conclusion, this study confirmed that the variation in ARGs during composting was affected more greatly by the succession of the bacterial community than the presence of OTC. However, high concentrations of the antibiotic increased the AAs and RAs of some ARGs. Aerobic composting was not effective in reducing most of

68

X. Qian et al. / Journal of Hazardous Materials 315 (2016) 61–69

the ARGs, and thus the compost product should be considered as an important reservoir for ARGs. In addition to the AAs of ARGs, the RAs of ARGs, as well as the status and hosts of ARGs should be considered when evaluating the environment risk of compost products. Acknowledgments This study was funded by the Special Fund for Agro-scientific Research in the Public Interest (201303094), the Chinese Ministry of Science and Technology (863 program, grant 2013AA102802) and the National Natural Science Foundation of China (41171203). We thank Dr. Duncan E. Jackson for language editing. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jhazmat.2016.05. 002. References [1] A.K. Sarmah, M.T. Meyer, A.B. Boxall, A global perspective on the use sales, exposure pathways, occurrence, fate and effects of veterinary antibiotics (VAs) in the environment, Chemosphere 65 (2006) 725–759. [2] G.Y. Cheng, H.H. Hao, S.Y. Xie, X. Wang, M.H. Dai, L.L. Huang, Z.H. Yuan, Antibiotic alternatives: the substitution of antibiotics in animal husbandry? Front. Microbiol. 5 (2014) 217. [3] F. Wichmann, N. Udikovic-Kolic, S. Andrew, J. Handelsman, Diverse antibiotic resistance genes in dairy cow manure, mBio 5 (2014) 379–382. [4] Q.X. Yang, S.W. Ren, T.Q. Niu, Y.H. Guo, S.Y. Qi, X.K. Han, D. Liu, F. Pan, Distribution of antibiotic-resistant bacteria in chicken manure and manure-fertilized vegetables, Environ. Sci. Pollut. Res. 21 (2014) 1231–1241. [5] Y.G. Zhu, T.A. Johnson, J.Q. Su, M. Qiao, G.X. Guo, R.D. Stedtfeld, S.A. Hashsham, J.M. Tiedje, Diverse and abundant antibiotic resistance genes in Chinese swine farms, Proc. Natl. Acad. Sci. U. S. A. 110 (2013) 3435–3440. [6] World Health Organization, Global strategy for the containment of antimicrobial resistance, 2004, Available: http://www.who.International/ emc/diseases/zoo/edg/draft.html. [7] L.M. Durso, K.L. Cook, Impacts of antibiotic use in agriculture: what are the benefits and risks? Curr. Opin. Microbiol. 19 (2014) 37–44. [8] H. Fang, H. Wang, L. Cai, Y. Yu, Prevalence of antibiotic resistance genes and bacterial pathogens in long-term manured greenhouse soils as revealed by metagenomic survey, Environ. Sci. Technol. 49 (2015) 1095–1104. [9] A. Selvam, D. Xu, Z. Zhao, J.W.C. Wong, Fate of tetracycline, sulfonamide and fluoroquinolone resistance genes and the changes in bacterial diversity during composting of swine manure, Bioresour. Technol. 126 (2012) 383–390. [10] Y.B. Ho, M.P. Zakaria, P.A. Latif, N. Saari, Degradation of veterinary antibiotics and hormone during broiler manure composting, Bioresour. Technol. 131 (2013) 476–484. [11] B. Liu, Y. Li, X. Zhang, C. Feng, M. Gao, Q. Shen, Effects of composting process on the dissipation of extractable sulfonamides in swine manure, Bioresour. Technol. 175 (2015) 284–290. [12] O. Arikan, L. Sikora, W. Mulbry, S. Khan, G. Foster, Composting rapidly reduces levels of extractable oxytetracycline in manure from therapeutically treated beef calves, Bioresour. Technol. 98 (2007) 169–176. [13] P. Sun, M.L. Cabrera, C. Huang, S.G. Pavlostathis, Biodegradation of veterinary ionophore antibiotics in broiler litter and soil microcosms, Environ. Sci. Technol. 48 (2014) 2724–2731. [14] P.J. Johnsen, J.P. Townsend, T. Bøhn, G.S. Simonsen, A. Sundsfjord, K.M. Nielsen, Retrospective evidence for a biological cost of vancomycin resistance determinants in the absence of glycopeptide selective pressures, J. Antimicrob. Chemother. 66 (2011) 608–610. [15] S. Jechalke, H. Heuer, J. Siemens, W. Amelung, K. Smalla, Fate and effects of veterinary antibiotics in soil, Trends Microbiol. 22 (2014) 536–545. [16] J.L. Martinez, Antibiotics and antibiotic resistance genes in natural environments, Science 321 (2008) 365–367. [17] L.L. Wang, Y. Oda, S. Grewal, M. Morrison, F.C. Michel, Z.T. Yu, Persistence of resistance to erythromycin and tetracycline in swine manure during simulated composting and lagoon treatments, Microb. Ecol. 63 (2012) 32–40. [18] K. Eguchi, Y. Nakai, K. Otawa, R. Ohishi, H. Nagase, T. Ogata, H. Nagai, N. Murata, H. Ishikawa, K. Hirata, Y. Nakai, Establishment of evaluation method to determine effects of veterinary medicinal products on manure fermentation using small-scale composting apparatus, J. Biosci. Bioeng. 114 (2012) 312–317. [19] L. Zhao, Y.H. Dong, H. Wang, Residues of veterinary antibiotics in manures from feedlot livestock in eight provinces of China, Sci. Total Environ. 408 (2010) 1069–1075.

[20] M. Qiao, W. Chen, J. Su, B. Zhang, C. Zhang, Fate of tetracyclines in swine manure of three selected swine farms in China, J. Environ. Sci. 24 (2012) 1047–1052. [21] N. Udikovic-Kolic, F. Wichmann, N.A. Broderick, J. Handelsman, Bloom of resident antibiotic-resistant bacteria in soil following manure fertilization, Proc. Natl. Acad. Sci. U. S. A. 111 (2014) 15202–15207. [22] Q.X. Yang, S.W. Ren, T.Q. Niu, Y.H. Guo, S.Y. Qi, X.K. Han, D. Liu, F. Pan, Distribution of antibiotic-resistant bacteria in chicken manure and manure-fertilized vegetables, Environ. Sci. Pollut. Res. 21 (2014) 1231–1241. [23] J.A. López-González, F. Suárez-Estrella, M.C. Vargas-García, M.J. López, M.M. Jurado, J. Moreno, Dynamics of bacterial microbiota during lignocellulosic waste composting: studies upon its structure, functionality and biodiversity, Bioresour. Technol. 175 (2015) 406–416. [24] R.C. Edgarm, UPARSE: highly accurate OTU sequences from microbial amplicon reads, Nat. Methods 10 (2013) 996–998. [25] R.C. Edgar, Search and clustering orders of magnitude faster than BLAST, Bioinformatics 26 (2010) 2460–2461. [26] B.L. Maidak, G.J. Olsen, N. Larsen, R. Overbeek, M.J. McCaughey, C.R. Woese, The RDP (ribosomal database project), Nucleic Acids Res. 25 (1997) 109–110. [27] RcoreTeam, A Language and Environment for Statistical Computing, R Foundation for Statistical Computing, Vienna, Austria, 2014 http://www.Rproject.org. [28] B. Liu, M. Pop, ARDB-antibiotic resistance genes database, Nucleic Acids Res. 37 (2009) 443–447. [29] N. Ding, W. Li, C. Liu, Q. Fu, B. Guo, H. Li, N. Li, Y. Lin, Decline in extractable kitasamycin during the composting of kitasamycin manufacturing waste with dairy manure and sawdust, J. Environ. Manage. 134 (2014) 39–46. [30] C.P. Youngquist, J. Liu, L.H. Orfe, S.S. Jones, D.R. Call, Ciprofloxacin residues in municipal biosolid compost do not selectively enrich populations of resistant bacteria, Appl. Environ. Microbiol. 80 (2014) 7521–7526. [31] J.A. Resende, C.G. Diniz, V.L. Silva, M.H. Otenio, A. Bonnafous, P.B. Arcuri, J.J. Godon, Dynamics of antibiotic resistance genes and presence of putative pathogens during ambient temperature anaerobic digestion, J. Appl. Microbiol. 117 (2014) 1689–1699. [32] C.M. Thomas, K.M. Nielsen, Mechanisms of and barriers to, horizontal gene transfer between bacteria, Nat. Rev. Microbiol. 3 (2005) 711–721. [33] D. Wu, Z. Huang, K. Yang, D. Graham, B. Xie, Relationships between antibiotics and antibiotic resistance gene levels in municipal solid waste leachates in Shanghai, China, Environ. Sci. Technol. 49 (2015) 4122–4128. [34] H.N. Storteboom, S. Kim, K.C. Doesken, K.H. Carlson, J.G. Davis, A. Pruden, Response of antibiotics and resistance genes to high-intensity and low-intensity manure management, J. Environ. Qual. 36 (2007) 1695–1703. [35] B. Wei, F.Y. Huang, J.Q. Su, Effect of composting on tetracyclines and tetracycline resistance genes in sewage sludge, Chin. J. Environ. Eng. 12 (2014) 5431–5438. [36] J.Q. Su, B. Wei, C.Y. Xu, M. Qiao, Y.G. Zhu, Functional metagenomic characterization of antibiotic resistance genes in agricultural soils from China, Environ. Int. 65 (2014) 9–15. [37] D. Mao, Y. Luo, J. Mathieu, Q. Wang, L. Feng, Q. Mu, C. Feng, P.J.J. Alvarez, Persistence of extracellular DNA in river sediment facilitates antibiotic resistance gene propagation, Environ. Sci. Technol. 48 (2014) 71–78. [38] T.R. Burch, M.J. Sadowsky, T.M. LaPara, Fate of antibiotic resistance genes and class 1 integrons in soil microcosms following the application of treated residual municipal wastewater solids, Environ. Sci. Technol. 48 (2014) 5620–5627. [39] J. Guan, A. Wasty, C. Grenier, M. Chan, Influence of temperature on survival and conjugative transfer of multiple antibiotic-resistant plasmids in chicken manure and compost microcosms, Poult. Sci. 86 (2007) 610–613. [40] J.S. Chapman, Disinfectant resistance mechanisms cross-resistance, and co-resistance, Int. Biodeterior. Biodegrad. 51 (2003) 271–276. [41] G.D. Recchia, R.M. Hall, Gene cassettes: a new class of mobile elements, Microbiology 141 (1995) 3015–3027. [42] A.C. Fluit, F.J. Schmitz, Class 1 integrons gene cassettes, mobility, and epidemiology, Eur. J. Clin. Microbiol. Infect. Dis. 18 (1999) 761–770. [43] Y. Luo, D.Q. Mao, M. Rysz, Q.X. Zhou, H.J. Zhang, X. Lin, P.J.J. Alvarez, Trends in antibiotic resistance genes occurrence in the Haihe River, China, Environ. Sci. Technol. 44 (2010) 7220–7225. [44] B. Chen, X. Liang, X. Nie, X. Huang, S. Zou, X. Li, The role of class I integrons in the dissemination of sulfonamide resistance genes in the Pearl River and Pearl River Estuary, South China, J. Hazard. Mater. 282 (2015) 61–67. [45] J. Chen, Z. Yu, F.J. Michel, T. Wittum, M. Morrison, Development and application of real-time PCR assays for quantification of erm genes conferring resistance to macrolides-lincosamides-streptogramin B in livestock manure and manure management systems, Appl. Environ. Microbiol. 73 (2007) 4407–4416. [46] F.X. Gomis-Rüth, G. Moncalián, R. Pérez-Luque, A. González, E. Cabezón, F.D.L. Cruz, M. Coll, The bacterial conjugation protein TrwB resembles ring helicases and F1-ATPase, Nature 409 (2001) 637–641. [47] C.M. Thomas, K.M. Nielsen, Mechanisms of and barriers to, horizontal gene transfer between bacteria, Nat. Rev. Microbiol. 3 (2005) 711–721. [48] A. Pruden, R. Pei, H. Storteboom, K.H. Carlson, Antibiotic resistance genes as emerging contaminants: studies in Northern Colorado, Environ. Sci. Technol. 40 (2006) 7445–7450. [49] P.J. McNamara, T.M. LaPara, P.J. Novak, The impacts of triclosan on anaerobic community structures, function, and antimicrobial resistance, Environ. Sci. Technol. 48 (2014) 7393–7400.

X. Qian et al. / Journal of Hazardous Materials 315 (2016) 61–69 [50] D. Mazel, Integrons: agents of bacterial evolution, Nat. Rev. Microbiol. 4 (2006) 608–620. [51] J. Su, B. Wei, W. Ou-Yang, F. Huang, Y. Zhao, H. Xu, Y. Zhu, Antibiotic resistome and its association with bacterial communities during sewage sludge composting, Environ. Sci. Technol. 49 (2015) 7356–7363. [52] S. Jia, P. Shi, Q. Hu, B. Li, T. Zhang, Xu-Xiang Zhang, Bacterial community shift drives antibiotic resistance promotion during drinking water chlorination, Environ. Sci. Technol. 49 (2015) 12271–12279. [53] V.M. D’Costa, K.M. McGrann, D.W. Hughes, G.D. Wright, Sampling the antibiotic resistome, Science 311 (2006) 374–377. [54] S. Rampelli, S.L. Schnorr, C. Consolandi, S. Turroni, M. Severgnini, C. Peano, P. Brigidi, A.N. Crittenden, A.G. Henry, M. Candela, Metagenome sequencing of the Hadza hunter–gatherer gut microbiota, Curr. Biol. 25 (2015) 1682–1693.

69

[55] Y. Hu, X. Yang, J. Qin, N. Lu, G. Cheng, N. Wu, Y. Pan, J. Li, L. Zhu, X. Wang, Z. Meng, F. Zhao, D. Liu, J. Ma, N. Qin, C. Xiang, Y. Xiao, L. Li, H. Yang, J. Wang, R. Yang, G.F. Gao, J. Wang, B. Zhu, Metagenome-wide analysis of antibiotic resistance genes in a large cohort of human gut microbiota, Nat. Commun. 4 (2013) 2151. [56] E. Kaszab, S. Szoboszlay, C. Dobolyi, J. Háhn, N. Pék, B. Kriszt, Antibiotic resistance profiles and virulence markers of pseudomonas aeruginosa strains isolated from composts, Bioresour. Technol. 102 (2011) 1543–1548. [57] C. Wang, Z. Sui, S.O. Leclercq, G. Zhang, M. Zhao, W. Chen, J. Feng, Functional characterization and phylogenetic analysis of acquired and intrinsic macrolide phosphotransferases in the Bacillus cereus group, Environ. Microbiol. 17 (2015) 1560–1573.