Variants of katG, inhA and nat genes are not associated with mutations in efflux pump genes (mmpL3 and mmpL7) in isoniazid-resistant clinical isolates of Mycobacterium tuberculosis from India

Tuberculosis 107 (2017) 144e148

Contents lists available at ScienceDirect

Tuberculosis journal homepage: http://intl.elsevierhealth.com/journals/tube

Variants of katG, inhA and nat genes are not associated with mutations in efflux pump genes (mmpL3 and mmpL7) in isoniazid-resistant clinical isolates of Mycobacterium tuberculosis from India A. Nusrath Unissa a, *, V.N. Azger Dusthackeer c, Micheal Prem Kumar d, P. Nagarajan e, S. Sukumar b, V. Indira Kumari b, A. Ramya Lakshmi b, L.E. Hanna f a

Post Doctoral Fellow, Centre for Biomedical Informatics, National Institute for Research in Tuberculosis, India Project students, Centre for Biomedical Informatics, National Institute for Research in Tuberculosis, India Scientist B, Department of Bacteriology, National Institute for Research in Tuberculosis, India d Technical Officer, Department of Bacteriology, National Institute for Research in Tuberculosis, India e Technical Assistant, Department of Bacteriology, National Institute for Research in Tuberculosis, India f Scientist E, Division of Clinical Research, National Institute for Research in Tuberculosis, India b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 29 April 2017 Received in revised form 26 July 2017 Accepted 27 July 2017

To understand the impact of efflux pump genes such as mmpL3 and mmpL7 on isoniazid (INH) resistance and to correlate with presence or absence of mutations in essential genes of INH resistance (katG, inhA, and nat) in clinical isolates of Mycobacterium tuberculosis (M. tuberculosis). One hundred (75 resistant and 25 sensitive) clinical isolates of M. tuberculosis from India were selected for the study. The presence of mutations in specific regions of katG, inhA, and nat, efflux pump genes (mmpL3 and mmpL7) associated with INH resistance were analyzed using multiplex allele-specific polymerase chain reaction (MAS-PCR) and DNA sequencing methods, respectively. Substitution mutation AGC-ACC at codon 315 of the katG gene was detected in 65% of resistant isolates. Mutation (C-T at nucleotide position 15) in the inhA promoter region was seen in 22% of resistant isolates. Silent mutation (GGA to GGG) at codon 207 in the nat gene was found in three resistant isolates. No mutations were found in either of the efflux genes (mmpL3 and mmpL7) in any of the isolates. Of the 75 resistant isolates analyzed, 74% had mutation in katG and inhA genes. Thus, this report suggests that the role of mmpL3, mmpL7 and nat genes in INH resistance should not be overestimated in comparison to the primary contribution by katG and inhA in clinical isolates of M. tuberculosis. Further, this concise report is the first of its kind to our knowledge, to show the influence of efflux genes on INH resistance in relation to katG and inhA in clinical isolates of M. tuberculosis. © 2017 Elsevier Ltd. All rights reserved.

Keywords: Mycobacterium tuberculosis Isoniazid resistance mmpL3 mmpL7 nat

1. Introduction Isoniazid (INH) has been extensively used as a frontline antituberculosis (TB) drug and acts as a principle component of the current six-month short course chemotherapy regimen. The use of INH as an effective anti-tuberculosis drug began in 1952, and ever since it has remained as one of the most active compounds used to treat and prevent TB worldwide. The increase in INH-resistant (INHR) TB cases at the global level and their effect on treatment

* Corresponding author. Centre for Biomedical Informatics, National Institute for Research in Tuberculosis (NIRT), Indian Council of Medical Research (ICMR), No. 1, Mayor Sathyamoorthy Road, Chetput, Chennai, 600 031, Tamil Nadu, India. E-mail address: [email protected] (A.N. Unissa). http://dx.doi.org/10.1016/j.tube.2017.07.014 1472-9792/© 2017 Elsevier Ltd. All rights reserved.

outcomes is a matter of great concern. Understanding the magnitude and intensity of INHR TB is important because INH resistance reduces the probability of treatment success, may facilitate the spread of multi drug resistance (MDR), and reduce the effectiveness of INH Preventive Therapy (IPT) [1]. It has long been recognized that INH resistance in Mycobacterium tuberculosis (M. tuberculosis) correlates with the loss of the enzyme catalase and peroxidase (CP) or KatG activities [2]. Basically, INH is a pro-drug that requires cellular activation by KatG protein to its active form, before it can exert its toxic effect on the bacillus. There has been considerable interest to understand the molecular basis of INH resistance. Mutations in several genes (katG, inhA, and others) are known to be associated with INH resistance [3e6]. Of these, inhA promoter mutations lead to low-level INH

A.N. Unissa et al. / Tuberculosis 107 (2017) 144e148

resistance, while mutations in katG lead to high-level resistance [6]. Zhang et al. (1992) demonstrated that mutations in the katG gene, coding for catalase-peroxidase (KatG) protein, was a major mechanism of INH resistance in M. tuberculosis [3]. The inhA gene encodes for enoyl acyl carrier protein reductase (InhA), an enzyme involved in the synthesis of cell wall mycolic acid, and is a target for activated INH [4]. Among all the genes involved in INH resistance, excluding katG, the nat gene coding for N-acetyltransferase (NAT) is unique, as it is the sole gene involved in the metabolism of INH in M. tuberculosis prior to KatG activation [7,8]. INH is metabolized by acetylation with the help of NAT in M. tuberculosis. Also, both KatG and NAT enzymes interacts with the pro-drug directly. Recently, the contribution of efflux pump genes towards INH resistance has gained recognition. A considerable amount of research has gone into understanding the significance of the efflux pump in INH resistance [6,9]. In one such investigation [9], it was demonstrated that strains exposed to critical concentrations of INH became resistant to the drug, and that resistance could be reduced by using efflux inhibitors (EIs) in majority of the strains that were susceptible and monoresistant to RIF. Also, a positive association between overexpression of efflux genes such as efpA, mmpL7, mmr, p55 and Rv1258c and increased efflux pump function was observed, with the help of ethidium bromide, a common efflux pump substrate. Further, exposure to INH resulted in sustained increase in efflux activity along with selection and stabilization of spontaneous mutations and deletions in the katG gene. In another investigation, the same research team [10] also demonstrated the extent of susceptibility to INH in the presence and absence of EIs. The EIs caused a decrease in INH resistance in the INH induced strains; in particular, verapamil promoted a reversal of resistance in some of the strains tested. The induced strains presented an increased efflux activity that was inhibited by the EIs and showed overexpression of the above mentioned efflux pump genes [10]. Thus, the role of efflux pumps in development of INH resistance in M. tuberculosis was established. On the contrary, the role of Mmr in the development of resistance to INH and other drugs in M. tuberculosis is unclear as INH susceptibility did not seem to be affected by either the absence or overexpression of mmr [6]. Hence additional studies are required to fully understand the contribution of efflux pump to INH resistance in M. tuberculosis. A whole genome sequencing study from China, reported on the importance of another efflux gene (mmpL3) which received more attention recently; mmpL3 is considered to be essential for M. tuberculosis growth [11]. Thus, we were interested to investigate the role of mmpL7 and mmpL3 in relation to katG, inhA and nat mutation amongst INHR clinical isolates of M. tuberculosis from India.

2. Materials and methods 2.1. Clinical isolates A total of 75 INHR and 25 INH susceptible clinical isolates of M. tuberculosis were randomly selected at the National Institute for Research in Tuberculosis (NIRT), Chennai, India. The growth conditions for the culture of M. tuberculosis were the same as described earlier [12]. On the basis of drug susceptibility testing (DST) results, 16 strains were found to have a minimum inhibitory concentration (MIC) of 1 mg/L, 49 had an MIC of 5 mg/L, and the remaining 10 showed an MIC >5 mg/L. Twenty five isolates with MIC
0.2 mg/L were considered susceptible to INH. Among the 75 resistant isolates, 20% (n ¼ 15) were MDR cases, and 80% (n ¼ 60) were nonMDR INH mono-resistant cases (Table 1). The laboratory reference strain, M. tuberculosis H37Rv, was used as the control. All the cultures were coded and subjected to further analysis.

145

Table 1 The spectrum of mutations within INH-resistant clinical isolates of M. tuberculosis from India. Isolates number

DST

MIC (mg/L)

katG-315 codon

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72

H MDR MDR H H MDR H H MDR H H H MDR H H H H H H H H MDR H H H H H H H H H H H H H H H H MDR H H MDR H H MDR H H H H H H H H MDR H H H H H H H H H H H H H MDR MDR H MDR MDR

5 1 5 5 5 >5 5 1 5 5 1 5 >5 1 5 5 5 5 5 5 5 5 1 5 5 5 >5 1 5 5 5 1 5 5 5 >5 >5 5 5 5 5 5 1 5 1 1 1 5 5 >5 5 >5 5 5 5 >5 5 1 5 5 5 >5 5 5 5 5 5 5 5 1 >5 1

ACC ACC ACC ACC ACC

ACC ACC

inhA-15th position

nat-207 codon

T T

T T

ACC ACC ACC

ACC

T T T

ACC ACC ACC ACC ACC ACC ACC ACC ACC ACC ACC ACC

GGG

GGG

ACC ACC ACC ACC ACC ACC ACC ACC ACC ACC ACC ACC

T T

ACC ACC ACC ACC

T

ACC ACC

T T

ACC T ACC ACC

GGG T

ACC T ACC ACC ACC ACC

T T (continued on next page)

146

A.N. Unissa et al. / Tuberculosis 107 (2017) 144e148

2.4. Amplification of nat and efflux genes

Table 1 (continued ) Isolates number

DST

MIC (mg/L)

katG-315 codon

73 74 75

MDR H H

5 1 1

ACC

inhA-15th position

nat-207 codon

DST ¼ drug susceptibility testing; H ¼ isoniazid; MDR ¼ multi-drug resistance; MIC ¼ minimum inhibitory concentration.

2.2. Preparation of DNA Genomic DNA was prepared using sodium chloride and cetyl trimethyl ammonium bromide method as described earlier [13].

PCR amplification of nat and efflux genes were done using a mixture containing 1 ml of forward and reverse primer (10 pmol) each, 6 ml of deoxyribonucleoside triphosphate (dNTP) mix (2.5 mM), 2.5 ml of 10X PCR buffer, 10e50 ng of template genomic DNA and 1 unit of Taq DNA Polymerase (Amersham Biosciences, UK). The amplification was performed in a thermal controller (MJ Research, USA). The primer sequences for the respective genes are given in Table 2. The figures showing the amplicons are provided in Fig. 2ABC. The amplicons were purified using enzyme such as Exonuclease and Alkaline phosphatase (Affymetrix, USA) and spin column (PCR clean up kit, Mo Bio Laboratories, CA) following manufacturer's instructions. 2.5. DNA sequencing

2.3. Amplification of katG and inhA genes MAS-PCR is a simple, rapid method that is easy to perform and to interpret; it is based on a single tube PCR and minigel electrophoresis without any further extension tool for detecting with high probability, INH resistance in M. tuberculosis clinical strains. MASPCR was performed for katG and inhA as described previously [14,15]. Figures for amplicons are shown in Fig. 1 ABC.

Sequencing of the amplicon was carried out using an automated DNA sequencer (ABI Prism 310 Genetic Analyzer-Applied Biosystems, USA), using the above mentioned primers and the Bigdye terminator sequencing kit (Applied Biosystems). The data obtained was compared with sequences from the database EMBOSS using the alignment tool accessed via http://www.ebi.ac.uk/emboss/ align/. The sequences of nat, mmpL3 and mmpL7 genes were

Fig. 1. A. katG gene amplification; Lanes 1e3: MT (ACC-Thr-315); 4: 100 bp DNA ladder; 5, 6: WT (AGC); 7: Positive control eH37Rv- WT (AGC-Ser-315). B. inhA MT gene amplification; Lane 1: 100 bp DNA ladder; Lane 2e5: MT (T at -15th). C. inhA WT gene amplification; Lane 1: 100 bp DNA ladder; Lane 2e7: WT (C at -15th).

Table 2 Details of primers and genes. Primer type

Primer sequence

1. F 1R 2R 2F 1R 2R 3. F R 4. F R 5. F R

50 50 50 50 50 50 50 50 50 50 50 50

GCAGATGGGGCTGATCTACG 30 ATACGACCTCGATGCCGC 30 AACGGGTCCGGGATGGTG 30 ACAAACGTCACGAGCGTAACC 30 TCACCCCGACAACCTATCG 30 GTTGGCGTTGATGACCTTCTC 30 GACGAGGTCAAATGGCAAC 30 GGGGTTCGTTTGTTCGGATA 30 CGACAAACTCTTCCCCGGAT 30 CCGAACGCCAAGAACATCAA 30 GCCATCAACCAGGTCAGCCAC′ 30 CGGCCAGTAGCACAGCATCG 30

Amplicon size

Genes

References

292 bp -WT 435 bp- MT

katG

[14]

451 bp-MT 119 bp-WT 928 bp

inhA

[15]

nat

This study

420 bp

mmpL3

This study

958 bp

mmpL7

This study

A.N. Unissa et al. / Tuberculosis 107 (2017) 144e148

147

Fig. 2. A. nat gene amplification; Lane 1: 100bp ladder DNA; Lane 2e6: nat gene. B. mmpL3 gene amplification; Lane 8: 100 bp DNA ladder; Lane 1: Positive control eH37Rv; Lane 2e7: mmpL3 gene. C. mmpL7 gene amplification; Lane 6: 100 bp DNA ladder; Lane 1: Positive control eH37Rv; Lanes 2e5: mmpL7 gene.

obtained from Tuberculist database with accession number: Rv3566c, Rv0206c and Rv2942 respectively. 3. Results and discussion The most prevalent substitution found in the katG gene was Ser315Thr (S315T) [6]. This mutation is considered a reliable biomarker for the detection of INHR in clinical isolates, and assays such as MAS-PCR and PCR-RFLP were developed based on this biomarker [14,16]. Similar observations were made from the present study. The occurrence of this mutation was most frequent among MDR strains; it was seen in 80% of MDR-TB and 61% of INH mono-resistant isolates. This mutation is known to be associated with intermediate or high levels of resistance to INH (1e10 mg/ml) [6]. We also found the S315T substitution in 81% of the 59 isolates that had a high MIC value  5 mg/L, while the mutation was seen in 62% of the remaining 16 isolates that had an MIC value of 1 mg/L (Table 1). Among the 75 phenotypically resistant isolates selected on the basis of MIC values, 56 (74%) were found to be resistant and 19 were found to be susceptible using the MAS-PCR assay (genotypic) method). The frequency of mutations observed in this study was consistent with the global pattern [6]. Amongst the 75 INHR isolates, 65% had ACC in katG and 22% had T at position 15 in the inhA gene. Of the 75 resistant isolates, 74% had mutations in both katG and inhA genes. No mutation was detected in the remaining 19 (25%) phenotypically resistant isolates (Table 1). Further, no mutations were found in the 25 INH sensitive isolates for both katG and inhA genes. The relative roles of katG and nat gene mutations in development of INH resistance in M. tuberculosis, and their relationship to each other has not been investigated in detail, except for a few small studies [5e7]. It was assumed that the INHR isolates that did not have any katG mutation could possibly have mutations in the nat gene. However, sequence analysis failed to identify mutations in the nat gene in the 19 phenotypically resistant isolates that did not have any genotypic mutation in either katG or inhA. A silent mutation (GGA to GGG, Gly to Gly) at codon 207 was found in 3 of the resistant isolates, but none of the isolates had the Gly to Arg (G207R) polymorphism, although, G207R polymorphism was

found to be associated with nat gene in both susceptible and resistant isolates [5e7]. To date no single genotypic study that has attempted to analyze all the genes associated with INH resistance has shown 100% agreement with phenotypic susceptibility test results. More recently, studies by Rodrigues et al. suggest the contribution of efflux pump towards INH resistance, and hypothesize that this phenomenon could explain the basis of resistance seen in approximately 20e30% of the phenotypically resistant isolates that do not harbour any genotypic mutation [9,10]. These studies determined expression levels of efflux pump genes and drew correlations with the phenotype and MIC of INH in the presence and absence of efflux pump inhibitors. However, in these studies genotypic correlation with katG and inhA genes particularly with clinically resistant strains of M. tuberculosis were not made. Hence, in the present study, we explored the contribution of the efflux pump gene, mmpL7, based on its significance to INH resistance, by performing similar analysis done in a previous study that analyzed the efpA gene [5]. The M. tuberculosis genome encodes 13 members of the mycobacterial membrane protein large (MmpL) family; of these, MmpL7 catalyzes the export of pthiocerol dimycocerosate (PDIM), and confers a high level resistance to INH by directly transporting the drug outside the cell when over-expressed in M. smegmatis [17]. Another member of the MmpL family namely, mmpL3, is predicted to be an essential gene based on studies in M. tuberculosis due to its involvement in mycolate transport, since mycolic acids are essential for viability in mycobacteria [18]. MmpL3 is a putative membrane protein belonging to the resistance, nodulation, and division (RND) protein family of multidrug resistance pumps that mediate the transport of a diverse array of ionic or neutral compounds as well as heavy metals and fatty acids [18]. A study from China found 2 independent nonsynonymous mutations in resistant isolates of M. tuberculosis [11]. Contrary to our expectations, the present study did not identify any mutation in the mmpL3 and mmpL7 genes of the isolates that were phenotypically resistant to INH but did not harbour any resistance associated mutations in katG or inhA. This makes us believe that there could be mutations in the other regions of the gene which were not taken into account for the present analysis that could be responsible for this phenomenon. For instance, in the case of mmpL7, sequencing

148

A.N. Unissa et al. / Tuberculosis 107 (2017) 144e148

was confined to a length of 958 bp while the entire gene comprises of 2.7 kb. In one of our previous studies on INH resistant isolates, we demonstrated the absence of mutation in about 34% of phenotypically resistant isolates in katG (two regions), inhA (two regions), ahpC and kasA genes [13]. Yet another of our studies that investigated the presence of katG S315T mutation in 105 resistant samples using three molecular methods, also showed an absence of mutation in 39% of phenotypically resistant isolates [12]. These studies collectively suggest the existence of other yet undefined mechanisms that contribute to INH resistance, that are not accompanied by genotypic mutations, reinforcing the present finding of no mutation even in the nat and efflux pump genes, in 25% of the resistant isolates. However, we surmise that inclusion of full length of mmpL3 (2.8 kbp) and mmpL7 (2.7 kbp) genes, as well as other efflux pump genes such as p55 and Rv1258c in the analysis could probably have provided more insights, which limits the scope of the present study. The roles of efpA and mmr have already been studied in connection to INH resistance [5,6]. Nevertheless, the information from our isolates, although not very elaborative, still provides an overview on the influence of efflux pump genes in INH resistance in clinical isolates of M. tuberculosis. We infer from the findings of the present study that the significance of the efflux pump genes such as mmpL3 and mmpL 7 genes in INH resistance cannot be over emphasized in the present context. Conflict of interest No conflict of interest amongst the authors. Authors' contribution ANU conceived the study, carried out experimental work and drafted the manuscript. VNAD provided the M. tuberculosis clinical isolates. MPK and PN provided technical assistance. SS, VIK and ARL provided experimental support. LEH helped to revise the manuscript. All authors read and approved the final manuscript. Acknowledgements Dr. A. Nusrath Unissa received financial support for post doctoral fellowship from the Indian Council of Medical Research (No. 3/1/3/ PDF(8)/2013). References [1] Jenkins HE, Zignol M, Cohen T. Quantifying the burden and trends of isoniazid

resistant tuberculosis, 1994e2009. PLoS One 2011;6:e22927. [2] Middlebrook G. Isoniazid-resistance and catalase activity of tubercle bacilli; a preliminary report. Am Rev Tuberc 1954;69:471. [3] Zhang Y, Heym B, Allen B, Young D, Cole S. The catalase-peroxidase gene and isoniazid resistance of Mycobacterium tuberculosis. Nature 1992;358:591e3. [4] Banerjee A, Dubnau E, Quemard A, Balasubramanian V, Um KS, Wilson T, et al. inhA, a gene encoding a target for isoniazid and ethionamide in Mycobacterium tuberculosis. Science 1994;263:227e30. [5] Ramaswamy SV, Reich R, Dou SJ, Jasperse L, Pan X, Wanger A, et al. Single nucleotide polymorphisms in genes associated with isoniazid resistance in Mycobacterium tuberculosis. Antimicrob Agents Chemother 2003;47:1241e50. [6] Unissa AN, Subbian S, Hanna LE, Selvakumar N. Overview on mechanisms of isoniazid action and resistance in Mycobacterium tuberculosis. Infect Genet Evol 2016;45:474e92. [7] Payton M, Auty R, Delgoda R, Everett M, Sim E. Cloning and characterization of arylamine N-acetyltransferase genes from Mycobacterium smegmatis and Mycobacterium tuberculosis: increased expression results in isoniazid resistance. J Bacteriol 1999;181:1343e7. [8] Upton AM, Mushtaq A, Victor TC, Sampson SL, Sandy J, Smith DM, et al. Arylamine N-acetyltransferase of Mycobacterium tuberculosis is a polymorphic enzyme and a site of isoniazid metabolism. Mol Microbiol 2001;42:309e17. [9] Machado D, Couto I, Perdigao JO, Rodrigues L, Portugal I, Baptista P, et al. Contribution of efflux to the emergence of isoniazid and multidrug resistance in Mycobacterium tuberculosis. PLoS One 2012;7:e34538. [10] Rodrigues L, Machado D, Couto I, Amaral L, Viveiros M. Contribution of efflux activity to isoniazid resistance in the Mycobacterium tuberculosis complex. Inf Genet Evol 2012;12:695e700. [11] Zhang H, Li D, Zhao L, Fleming J, Lin N, Wang T, et al. Genome sequencing of 161 Mycobacterium tuberculosis isolates from China identifies genes and intergenic regions associated with drug resistance. Nat Genet 2013;45: 1255e60. [12] Unissa AN, Narayanan S, Suganthi C, Selvakumar N. Detection of IsoniazidResistant Clinical isolates of Mycobacterium tuberculosis from India using Ser315Thr marker by Comparison of molecular methods. Int J Mol Clin Microbiol 2011;1:52e9. [13] Unissa AN, Selvakumar N, Narayanan S, Narayanan PR. Molecular analysis of isoniazid-resistant clinical isolates of Mycobacterium tuberculosis from India. Int J Antimicrob agents 2008;31:71e5. [14] Mokrousov I, Otten T, Filipenko M, Vyazovaya A, Chrapov E, Limeschenko E, et al. Detection of isoniazid-resistant Mycobacterium tuberculosis strains by a multiplex allele-specific PCR assay targeting katG codon 315 variation. J Clin Microbiol 2002;40:2509e12. [15] Leung ETY, Ho PL, Yuen KY, Woo WL, Lam TH, Kao RY, et al. Molecular characterization of isoniazid resistance in Mycobacterium tuberculosis: identification of a novel mutation in inhA. Antimicrob Agents Chemother 2006;50: 1075e8. [16] Kiepiela P, Bishop KS, Smith AN, Roux L, York DF. Genomic mutations in the katG, inhA and aphC genes are useful for the prediction of isoniazid resistance in Mycobacterium tuberculosis isolates from Kwazulu Natal, South Africa. Tuber Lung Dis 2000;80:47e56. [17] Pasca MR, Guglirame P, Rossi ED, Zara F, Ricchardi D. mmpL7 gene of Mycobacterium tuberculosis is responsible for isoniazid efflux in Mycobacterium smegmatis. Antimicrob Agents Chemother 2005;49:4775e7. [18] Domenech P, Reed MB, Barry III CE. Contribution of the Mycobacterium tuberculosis MmpL protein family to virulence and drug resistance. Infect Immun 2005;73:3492e501.